Orthologs Set ID: EOG4003G9

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Callithrix jacchus 20667 420, 568, 2064
Gorilla gorilla 28037 420, 568, 2064
Homo sapiens 72117 420, 568, 2064
Microcebus murinus 15649 420, 459, 491, 568, 2064, 3172, 3813
Otolemur garnettii 6866 191, 274, 281, 420, 568, 1338, 2346, 2412, 3800
Pan troglodytes 31179 420, 568, 2064
Tarsius syrichta 6 420, 568, 1476, 1489, 1560, 1593, 1602, 1620, 1660, 2064, 2544, 3315, 3507

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 20667 ENSCJAT00000036429 100397601 ENSCJAG00000018566 ZBED9 calJac3
Gorilla gorilla 28037 ENSGGOT00000002378 101146862 ENSGGOG00000002365 SCAND3 gorGor3
Homo sapiens 72117 ENST00000452236 114821 ENSG00000232040 ZBED9 hg19,GRCh37
Microcebus murinus 15649 ENSMICT00000014558 ENSMICG00000014561 ZBED9 micMur1
Otolemur garnettii 6866 ENSOGAT00000006616 100964526 ENSOGAG00000006616 ZBED9 otoGar1
Pan troglodytes 31179 ENSPTRT00000033004 471922 ENSPTRG00000017880 ZBED9 panTro2
Tarsius syrichta 6 ENSTSYT00000000644 ENSTSYG00000000644 ZBED9 tarSyr1

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 13051 ENSCJAP00000034493 100397601 ENSCJAG00000018566 ZBED9 calJac3
Gorilla gorilla 21777 ENSGGOP00000002328 101146862 ENSGGOG00000002365 SCAND3 gorGor3
Homo sapiens 16557 ENSP00000395259 114821 ENSG00000232040 ZBED9 hg19,GRCh37
Microcebus murinus 13272 ENSMICP00000013271 ENSMICG00000014561 ZBED9 micMur1
Otolemur garnettii 5917 ENSOGAP00000005914 100964526 ENSOGAG00000006616 ZBED9 otoGar1
Pan troglodytes 10998 ENSPTRP00000030488 471922 ENSPTRG00000017880 ZBED9 panTro2
Tarsius syrichta 7 ENSTSYP00000000594 ENSTSYG00000000644 ZBED9 tarSyr1

multiple sequence alignment in CLUSTALW format

Otolemur_garnettii|6866  ------------------------------------------------------------

Otolemur_garnettii|6866  ------------------------------------------------------------

Otolemur_garnettii|6866  ------------------------------------CAGCGCTTTAGGCAGTTTTGCTAT
                                                             ******** **.***** ******

                         **.*********** ***.*.***** ********. ****.********* ********

                         ****. ************* *********************************.***** 

                          **** *** **** ***********. * *********** *. *.*****.**.*** 

                         **.**.* .**.*** ** *.*************..***********.*******:****

                         ..       .     . ....  ..  ...  . ...  .   ..     . . . .. .

                         .    ..  . ... ..      . .   .. . ...  .   .  ...  ....  . .

                            . .          ..   . .  .....  ......... ...      ... .   

                             ...... .. .    .  .  . .. . .  .  ..  .  .   ...     .  

                             .. . .     .. ..  .  . .. .     ..  . .         ..  .   

                           .  . . .... .   .     .  ...  . .. .   ..  ...   .  .     

                         . .  ..       ..  .  ....  .   .. . .... . . .... ...  .  ..

                         ..    ..    . .    .  ... .. . .   .....     .      .  ... .

                         .  ..     ... ..   . ....  ***** ** .* **.******************

                         ** ***** ** ********.*****. *.**.**.***** ***** ************

                         ********* *.**  ****.********.******************************

                         **.******.******** ***************.*************************

                         ********.**.*********** **.** *.****** :************* **  . 

                         *****.**** ************. ****.******** **:. ************ ** 

                         ***********:******* *. ***..  ** ********.**.**:.*******.** 

                         ********.** **..**..  ...   .  ..  . .....   .  ...    . .  

                           ....  .         ..     .     ...     .       .            

Tarsius_syrichta|6       ------------------------------AGGAATCCACCACATTGGANNNNNNNNNNN
                                                                      ...  ..  ......

                         ... .  ..  . ..               . .    .  .  ..        .   ...

Otolemur_garnettii|6866  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---------------------------
                                        . ..    .    ....                            

Otolemur_garnettii|6866  ------------------------------------------------------------

Otolemur_garnettii|6866  ------------------------------------------------------------

Otolemur_garnettii|6866  ------------------------------------------------------------

Otolemur_garnettii|6866  ------------------------------------------------------------

Otolemur_garnettii|6866  ------------------------------------------------------------

Otolemur_garnettii|6866  ------------------------------------------------------------

Otolemur_garnettii|6866  ------------------------------------------------------------

Otolemur_garnettii|6866  ------------------------------------------------------------

Otolemur_garnettii|6866  ------------------------------------------------------------

Otolemur_garnettii|6866  ------------------------------------------------------------

Otolemur_garnettii|6866  ------------------------------------------------------------

Otolemur_garnettii|6866  ---------------------------------------NNNNNNAAACTTAAACGACAT
                                                                   .  **.*****.***** 

                         ******   ************.*:********* *******.******************

                         *****.**.***   *****.**.*:***.***** *:*** ******** .**** ***

                         ********:**.*****************.** ** **.********.**:*****.***

                         ** *****.**.******** *** .    .  .. .. ....   .... ....  . .

                         .  .    .  ... .     ..     ...    ..      . . . .  .. ..  .

                         .   . . .  .. . ...  .      .  . .      .     . .    .. ....

                         .  ...    ... ..  ..  . . . ... .    .. .  .. .... .. . ....

                          ......        . .. . .    .  .  .. .......  .  . ...       

                                 . . .  .   . .  .  . ...   .  .. . .....      ......

                         ....  ...   ........ .. .. .... .. .....  .      ..   ..    

                           .. ..  .....      . ..  ..   ...     .  ...            .. 

                         ..  ..  . . .   .. ...   ..       . .  . ..   .   . ....  ..

                           ..   . ..     .....  ..   .    .    .   ..   ..   . .. .. 

                         . ...  . .... .  . ...  . .. .  .  .    ....  ..  .. .. . . 

                          ....... .    ...    ... ...   .  ......   .  .    .   .  . 

                         ...... ..   ..   .       . ....      .....   .  ..   ....   

                         .   .  ... ..  ..   .. . . ..  .. .....  .. . .    . .. . ..

                            ..      ..     . .....   ...  .      ...  ..            .

                         .. .  . ....       .  ... .     ..... ..   ....   .  ...    

                             .. .   ..  .. ...  .  .   . . ...    . .       ... .  ..

                         .    . ..     ...... .  .......  .... ....   .     .  . .   

                          .  . ..       ... .      .   ... ...  .     . .   ..   ... 

                           . .   . .   .. .  .......  . ...     .  .  .. ...        .

                         ....    .   .  .   .   ..  ...... .      .     ..  . .  .. .

                          ..   . . . . ...                ** **********. ** ******** 

                         **.******** ***** ***********.***** .******************* ***

                         *** ****.**.*** *.**.*****************.********.**.*********

Tarsius_syrichta|6       CAAGCTCACTTATCACATTAA
Microcebus_murinus|15649 CAAGCTCACTTATCACACTAA
Otolemur_garnettii|6866  CAAGCTCACTTATCACATTAA
Callithrix_jacchus|20667 CAGGCTCACTTATCACATTGA
Gorilla_gorilla|28037    CAAGCTCACTTATCACATTAA
Homo_sapiens|72117       CAAGCTCACTTATCACATTAA
Pan_troglodytes|31179    CAAGCTCACTTATCACATTAA
                         **.************** *.*

multiple sequence alignment in CLUSTALW format

Otolemur_garnettii|5917  ----------------------------------------------------QRFRQFCY

                         ***************** ***.****:**********************:***::.* .*

                         **.**:*****:***:** *                                        




                         ***:**.****.******************:**:***** ***:******** * *****

                         ******  *.******:** *****:                                  


Otolemur_garnettii|5917  ------------------------------------------------------------

Otolemur_garnettii|5917  ------------------------------------------------------------

Otolemur_garnettii|5917  ------------------------------------------------------------

Otolemur_garnettii|5917  -----------------------------------------------------XXKLKRH

                         ** ****:***.************ *** *** ****:**********************








                                    **** ********************************************

Tarsius_syrichta|7       QAHLSH
Microcebus_murinus|13272 QAHLSH
Otolemur_garnettii|5917  QAHLSH
Callithrix_jacchus|13051 QAHLSH
Gorilla_gorilla|21777    QAHLSH
Homo_sapiens|16557       QAHLSH
Pan_troglodytes|10998    QAHLSH