Orthologs Set ID: EOG4003GD

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Callithrix jacchus 25880 61, 97, 230, 403, 499, 706, 806, 988, 1113, 1231, 1382, 1526, 1544, 1594, 1606, 1641, 1661, 1667, 1707, 1828, 1987, 2137, 2208, 2443, 2547, 2734, 2847
Cavia porcellus 24325 61, 94, 230, 403, 499, 706, 806, 988, 1032, 1113, 1231, 1385, 1513, 1707, 1828, 1987, 2137, 2208, 2443, 2547, 2734, 2847, 3032
Dipodomys ordii 11532 61, 97, 230, 403, 499, 706, 806, 837, 988, 1116, 1233, 1385, 1522, 1707, 1828, 1987, 2137, 2163, 2202, 2208, 2443, 2547, 2734, 2847, 3004
Gorilla gorilla 32803 61, 97, 230, 403, 499, 706, 806, 988, 1113, 1231, 1385, 1522, 1707, 1828, 1987, 2137, 2208, 2443, 2547, 2734, 2847, 3004
Homo sapiens 21048 97, 230, 403, 499, 706, 806, 988, 1113, 1231, 1385, 1522, 1707, 1828, 1987, 2137, 2208, 2443, 2547, 2734, 2847, 3004
Microcebus murinus 13316 61, 97, 230, 403, 499, 706, 806, 988, 1113, 1231, 1385, 1522, 1707, 1749, 1818, 1828, 1987, 2137, 2208, 2443, 2547, 2734, 2847, 2986, 3007, 3076
Mus musculus 14547 61, 97, 230, 403, 499, 706, 806, 988, 1113, 1231, 1385, 1522, 1707, 1828, 1987, 2137, 2208, 2443, 2547, 2734, 2847, 3004
Ochotona princeps 11162 48, 61, 97, 230, 283, 351, 403, 499, 706, 806, 988, 1113, 1231, 1385, 1522, 1707, 1828, 1971, 1987, 2137, 2208, 2443, 2547, 2734, 2847, 3004
Otolemur garnettii 1481 97, 230, 309, 403, 499, 510, 537, 585, 706, 806, 988, 1113, 1231, 1385, 1522, 1707, 1716, 1749, 1785, 1818, 1828, 1833, 1987, 2137, 2208, 2443, 2520, 2547, 2734, 2847, 3004
Pan troglodytes 9320 61, 97, 230, 403, 499, 706, 806, 988, 1113, 1231, 1385, 1522, 1707, 1828, 1987, 2137, 2208, 2443, 2547, 2734, 2847, 3004
Rattus norvegicus 32728 61, 97, 230, 403, 499, 706, 806, 988, 1113, 1231, 1385, 1522, 1707, 1828, 1987, 2137, 2208, 2443, 2547, 2734, 2847, 3004
Spermophilus tridecemlineatus 15992 61, 97, 230, 403, 472, 499, 706, 806, 988, 1113, 1231, 1382, 1596, 1703, 1707, 1828, 1917, 1987, 2137, 2208, 2292, 2443, 2547, 2847, 3004, 3050
Tarsius syrichta 4930 230, 403, 499, 706, 806, 833, 888, 988, 1113, 1231, 1385, 1522, 1605, 1643, 1707, 1828, 1987, 2137, 2208, 2443, 2547, 2734, 2847, 3004
Tupaia belangeri 8930 97, 230, 403, 499, 706, 806, 988, 1113, 1231, 1385, 1522, 1707, 1828, 1987, 2137, 2208, 2442, 2547, 2734, 2847, 3004

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 25880 ENSCJAT00000034748 100386201 ENSCJAG00000017809 CNTN1 calJac3
Cavia porcellus 24325 ENSCPOT00000008889 100731131 ENSCPOG00000008811 CNTN1 cavPor3
Dipodomys ordii 11532 ENSDORT00000004522 ENSDORG00000004521 Cntn1 dipOrd1
Gorilla gorilla 32803 ENSGGOT00000016671 101130831 ENSGGOG00000016609 CNTN1 gorGor3
Homo sapiens 21048 ENST00000348761 1272 ENSG00000018236 CNTN1 hg19,GRCh37
Microcebus murinus 13316 ENSMICT00000012381 ENSMICG00000012376 CNTN1 micMur1
Mus musculus 14547 ENSMUST00000000109 12805 ENSMUSG00000055022 Cntn1 mm9
Ochotona princeps 11162 ENSOPRT00000008980 ENSOPRG00000008956 CNTN1 OchPri2.0
Otolemur garnettii 1481 ENSOGAT00000001430 100952742 ENSOGAG00000001426 CNTN1 otoGar1
Pan troglodytes 9320 ENSPTRT00000046590 451836 ENSPTRG00000004834 CNTN1 panTro2
Rattus norvegicus 32728 ENSRNOT00000006219, NM_057118 117258 ENSRNOG00000004438 Cntn1 rn4
Spermophilus tridecemlineatus 15992 ENSSTOT00000015993 101973079 ENSSTOG00000015991 Cntn1 speTri1
Tarsius syrichta 4930 ENSTSYT00000013408 ENSTSYG00000013402 CNTN1 tarSyr1
Tupaia belangeri 8930 ENSTBET00000008931 ENSTBEG00000008915 CNTN1 tupBel1

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 18021 ENSCJAP00000032880 100386201 ENSCJAG00000017809 CNTN1 calJac3
Cavia porcellus 19279 ENSCPOP00000007909 100731131 ENSCPOG00000008811 CNTN1 cavPor3
Dipodomys ordii 10820 ENSDORP00000004232 ENSDORG00000004521 Cntn1 dipOrd1
Gorilla gorilla 25282 ENSGGOP00000016212 101130831 ENSGGOG00000016609 CNTN1 gorGor3
Homo sapiens 67857 ENSP00000261160 1272 ENSG00000018236 CNTN1 hg19,GRCh37
Microcebus murinus 11268 ENSMICP00000011273 ENSMICG00000012376 CNTN1 micMur1
Mus musculus 25138 ENSMUSP00000000109 12805 ENSMUSG00000055022 Cntn1 mm9
Ochotona princeps 9730 ENSOPRP00000008220 ENSOPRG00000008956 CNTN1 OchPri2.0
Otolemur garnettii 1268 ENSOGAP00000001271 100952742 ENSOGAG00000001426 CNTN1 otoGar1
Pan troglodytes 23586 ENSPTRP00000046202 451836 ENSPTRG00000004834 CNTN1 panTro2
Rattus norvegicus 6587 ENSRNOP00000006219 117258 ENSRNOG00000004438 Cntn1 rn4
Spermophilus tridecemlineatus 14312 ENSSTOP00000014312 101973079 ENSSTOG00000015991 Cntn1 speTri1
Tarsius syrichta 4514 ENSTSYP00000012300 ENSTSYG00000013402 CNTN1 tarSyr1
Tupaia belangeri 7730 ENSTBEP00000007741 ENSTBEG00000008915 CNTN1 tupBel1

multiple sequence alignment in CLUSTALW format

Otolemur_garnettii|1481             ------------------------------------------------------------
Tarsius_syrichta|4930               ------------------------------------------------------------
Tupaia_belangeri|8930               ------------------------------------------------------------

Tarsius_syrichta|4930               ---------------------------------------TCTGAAGAAGACAAAGGATTT
Homo_sapiens|21048                  ------------------------------------GTTTCTGAGGAAGACAAAGGATTT
                                                                           .  .  .  .     .. ...

                                    ..     . .. .  . .       .   .    ...     .  .  .   . .  .. 

                                       .. .   .    ..  ...   . .   .    ..    ....    .*****.***

                                    ***** ** ** ** ** ** ** *. ** ** ** ** ***** **.**          

                                     .          .       .   .  .  ..    .  .  ..  . .  .        

                                    .  ..  ....  .  .    .  .      .. . .. .. . . . .     ..    

                                       .  .   .    . .** ...**.**.*****.**.**.*****  * ***** ** 

                                    ** ** ** ** ** ****  . . .  .     .            ..  ..    .. 

                                    ..  .     ... .    .  . .. ....    .      ..     . .   . .  

                                       .. . .   .  .     ..    .  .  .. .. .. .   .   ..   ..   

                                      . . .. ..  .    ..  .     .  .          .   .             

                                    .     . ..   .  . ..    ..   ..   . .      .. ....       ...

                                        . .  .. .. .   . ..      ...    .   .  . ... ..   ..  . 

                                    .      ..         . .. . .  .    .  .. .  ..  .     .  .    

                                     .   . . .  .  .  ..  . .  .  .. . .. ..      .    ..   ..  

                                             .      . .  ..    .  ..    .  ..... .      .   ..  

                                       .  ....     ..  . .   . .  ...   ..  . .     ..   .      

                                           .  . ... .       .. .    .. .      .. .   .  .  . .  

                                    .  ...   ....     .  ..  ...     ..  . .  .           ..    

                                     . .  .     .  .   .     .  . .   . .        ....   .   .   

                                     ..  .     . .  ...  .     .. ..  ....  .  . .  ..          

                                    .  .              .. .  ... .    ..    .  ... . ..        . 

Spermophilus_tridecemlineatus|15992 AGT---------------------------------------------------------

Spermophilus_tridecemlineatus|15992 ------------------------------------------------------------

Spermophilus_tridecemlineatus|15992 ------------------------------------------------------------

Spermophilus_tridecemlineatus|15992 ---------GGAAAAAAAGTTCACATGTGGTATGCTTCC---TTT---GATCCAGTCTTG
                                             .                   .   .        ..    **      . * 

                                    .* *: .. :* .*  .     :.** ** *: ***** .: ** *   ..**.      

                                     * .* **  :  .    :* :*  .  . .           .   .  .  .  .    

Otolemur_garnettii|1481             GCCCAGCTG------------AGGTACACATGCACGGCTCAGACA---GTGGACAATTCT
                                    .    . .              . .     ..    .    .      .. .     .  

                                    .  .  .  . ..   .    .   . ..       ..       .. ..  .. .  . 

                                    .  .   .  . .     .  . .    .   .... .  . .. .  .        ** 

                                    ** ** ** **.***** ** ***.*.*.**. .: ** ** ************** * .

                                    **.** * .       .  ...  ..     ... .   .     .  .. .   .  . 

                                       ... ...  .  .  ..  . ..  . .            . ..    .. .     

                                     .  .    .         .       .  .. .  .**** ** ***** ** ** ** 

                                    **    ** **.** **** .*****.**.** ** **:**    **.** **.** ***

                                    **.***** ** ** ** *********** .* ** **.** **.** ** ** **:*: 

                                    **.*****.***   ** ** ** ** ** ** ** **..*.** ** ** **.** **.

                                    :  **** ***  * ** ** ** ***** ***** **.** *******. **.** ** 

                                    **.** ** ** ** . .** ***** :* ** *** *.** *       ..  .     

                                          .. ..       ..  . .  .  . ..   . .  ..    ...      .. 

Spermophilus_tridecemlineatus|15992 TTAGAAAAAATAGTGGAAAGTTATCAG---------------------------------
                                              . .. .     .                                      

Spermophilus_tridecemlineatus|15992 ------------------------------------------------------------

Spermophilus_tridecemlineatus|15992 ------------------------------------------------------------

Spermophilus_tridecemlineatus|15992 ------------------------------------CCTAGCCAGCCACCAAGAATCATC
                                                                            .           .  .  . 

                                     . .   .  . .  .. .     .   .  .    ....     .. .. .   . .  

                                       .  .     ..    .. .    . .  . .   .    .  ..      .   .. 

                                      . ...  .              .   . .  ..     .     . .  .. .  .  

                                    .. .. .  ..  . .      . .  .. .. .  .. .. ....     ..     ..

Callithrix_jacchus|25880            TCAGGT------------------------------------------------------

Dipodomys_ordii|11532               ATCCTTGTG---TACTTGGAATTCTGA
Otolemur_garnettii|1481             ATCCTCGTC---TATTTGGAATTTTGA
Tarsius_syrichta|4930               ATCCTTGTC---TACTTGGAATTCTGA
Spermophilus_tridecemlineatus|15992 ATCCTTGTC---TACTTGGAATTCTGA
Callithrix_jacchus|25880            ---------------------------
Cavia_porcellus|24325               ATACCAGTG---ATGACTGAAGCC---
Gorilla_gorilla|32803               ATCCTTGTC---TACTTGGAATTCTGA
Pan_troglodytes|9320                ATCCTTGTC---TACTTGGAATTCTGA
Homo_sapiens|21048                  ATCCTTGTC---TACTTGGAATTCTGA
Mus_musculus|14547                  TTTCTTGTC---TACTCGGAATTCTGA
Rattus_norvegicus|32728             TTTCTCGTCTTCTATTCGGAATTCTGA
Microcebus_murinus|13316            NNNNNNNNN---NNNNTGGAATTCTGA
Ochotona_princeps|11162             GTCCTCGTC---TTCTTGGAATTCTGA
Tupaia_belangeri|8930               ATCCTCGTC---TACTTGGAATTCTGA

multiple sequence alignment in CLUSTALW format

Otolemur_garnettii|1268             ---------------------FTWHRRYGHG-VSEEDKGFGPIFEEQPINTIYPEESLEG
Tarsius_syrichta|4514               ---------------------------------SEEDKGFGPIFEEQPINTIYPEESLEG
Tupaia_belangeri|7730               ---------------------FTWHRRYGHG-XXXXXXXXXXXXXXXXXXXXXXXXXXXX







Spermophilus_tridecemlineatus|14312 MKKKILAAKGGRVIIECKPKAAPKPKFSWSKGTEWLVNSSS-------------------

Spermophilus_tridecemlineatus|14312 -------------------------------------------GKKVHMWYAS-F-DPVL
                                                                                            *  *

                                    :  ::   **:** *  *  .:: .                                   

                                                                           *********::. *******.

                                    **                                                   *******

                                    * **** ******* ***************:******** **** *****:*********

                                    :*:*:***********.******** *** **:*                          

Spermophilus_tridecemlineatus|14312 LEKIVESYQ---------------------------------------------------


Callithrix_jacchus|18021            KLYSTHKHSIEVPIPRDGEYVVEVRAHSDGGDGVVSQVKISG------------------

Dipodomys_ordii|10820               ILV-YLEF
Otolemur_garnettii|1268             ILV-YLEF
Tarsius_syrichta|4514               ILV-YLEF
Spermophilus_tridecemlineatus|14312 ILV-YLEF
Callithrix_jacchus|18021            --------
Cavia_porcellus|19279               IPV-MTEA
Gorilla_gorilla|25282               ILV-YLEF
Pan_troglodytes|23586               ILV-YLEF
Homo_sapiens|67857                  ILV-YLEF
Mus_musculus|25138                  FLV-YSEF
Rattus_norvegicus|6587              FLVFYSEF
Microcebus_murinus|11268            XXX-XXEF
Ochotona_princeps|9730              VLV-FLEF
Tupaia_belangeri|7730               ILV-YLEF