Orthologs Set ID: EOG4003GH

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Callithrix jacchus 20220 318, 409, 521, 637, 763, 855, 1153, 1371, 1545, 1765, 1899, 2020, 2070, 2178, 2234, 2322, 2442, 2540, 2659, 2793, 2832
Cavia porcellus 24287 318, 409, 521, 637, 763, 855, 966, 1153, 1257, 1329, 1545, 1765, 1899, 2020, 2070, 2178, 2234, 2322, 2442, 2540, 2659, 2793, 2878, 3041
Dipodomys ordii 14163 121, 281, 318, 409, 521, 637, 763, 855, 966, 1153, 1371, 1545, 1765, 1899, 2020, 2070, 2178, 2234, 2322, 2442, 2540, 2659, 2793, 2878, 3041
Gorilla gorilla 26121 70, 121, 318, 409, 521, 637, 763, 855, 966, 1153, 1371, 1545, 1765, 1899, 2020, 2070, 2178, 2234, 2322, 2442, 2540, 2659, 2793, 2878, 2988
Homo sapiens 21159 70, 121, 318, 409, 521, 637, 763, 855, 966, 1153, 1371, 1545, 1765, 1899, 2020, 2070, 2178, 2234, 2322, 2442, 2540, 2659, 2793, 2878, 3041
Microcebus murinus 9651 70, 121, 318, 409, 521, 637, 763, 855, 966, 1153, 1161, 1371, 1545, 1765, 1899, 2020, 2070, 2178, 2234, 2322, 2442, 2540, 2659, 2793, 2878, 3041
Mus musculus 14605 318, 409, 521, 637, 763, 855, 1153, 1350, 1545, 1765, 1899, 2020, 2070, 2178, 2234, 2322, 2442, 2540, 2659, 2793, 2878, 3041
Ochotona princeps 9381 84, 93, 111, 118, 318, 409, 432, 465, 493, 512, 521, 637, 763, 855, 966, 1153, 1371, 1545, 1765, 1899, 2020, 2070, 2178, 2234, 2322, 2442, 2540, 2659, 2793, 2878, 3041
Otolemur garnettii 5674 70, 121, 318, 409, 468, 521, 637, 763, 855, 966, 1153, 1194, 1371, 1545, 1765, 1899, 2020, 2070, 2178, 2234, 2322, 2442, 2540, 2659, 2793, 2878, 3041
Pan troglodytes 9258 121, 318, 409, 431, 521, 637, 763, 855, 960, 1153, 1371, 1545, 1765, 1899, 2020, 2070, 2178, 2234, 2322, 2442, 2540, 2659, 2793, 2878, 3041
Rattus norvegicus 32781 318, 409, 593, 637, 763, 855, 966, 1153, 1371, 1545, 1765, 1899, 2020, 2070, 2178, 2234, 2322, 2442, 2540, 2659, 2793, 2878, 3041
Spermophilus tridecemlineatus 1869 121, 318, 409, 521, 637, 763, 855, 966, 1153, 1371, 1545, 1765, 1899, 1977, 2020, 2070, 2136, 2149, 2163, 2174, 2178, 2234, 2322, 2442, 2540, 2626, 2659, 2793, 2878, 3021, 3039, 3041
Tupaia belangeri 17027 121, 318, 409, 521, 637, 763, 855, 966, 1147, 1371, 1545, 1765, 1899, 2020, 2070, 2178, 2234, 2322, 2442, 2508, 2514, 2540, 2659, 2793, 2878, 3041

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 20220 ENSCJAT00000029228 100402023 ENSCJAG00000014979 HDAC7 calJac3
Cavia porcellus 24287 ENSCPOT00000006077 100734930 ENSCPOG00000006013 HDAC7 cavPor3
Dipodomys ordii 14163 ENSDORT00000016268 ENSDORG00000016267 Hdac7 dipOrd1
Gorilla gorilla 26121 ENSGGOT00000025612 101124293 ENSGGOG00000016461 HDAC7 gorGor3
Homo sapiens 21159 ENST00000080059, NM_015401 51564 ENSG00000061273 HDAC7 hg19,GRCh37
Microcebus murinus 9651 ENSMICT00000008993 ENSMICG00000008981 HDAC7 micMur1
Mus musculus 14605 ENSMUST00000116408 56233 ENSMUSG00000022475 Hdac7 mm9
Ochotona princeps 9381 ENSOPRT00000010199 ENSOPRG00000010179 HDAC7 OchPri2.0
Otolemur garnettii 5674 ENSOGAT00000005478 100962489 ENSOGAG00000005471 HDAC7 otoGar1
Pan troglodytes 9258 ENSPTRT00000009008 466968 ENSPTRG00000004868 HDAC7 panTro2
Rattus norvegicus 32781 ENSRNOT00000011322 ENSRNOG00000008308 HDAC7_RAT rn4
Spermophilus tridecemlineatus 1869 ENSSTOT00000001869 101960868 ENSSTOG00000001863 Hdac7 speTri1
Tupaia belangeri 17027 ENSTBET00000017028 ENSTBEG00000017000 HDAC7 tupBel1

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 12640 ENSCJAP00000027657 100402023 ENSCJAG00000014979 HDAC7 calJac3
Cavia porcellus 19250 ENSCPOP00000005427 100734930 ENSCPOG00000006013 HDAC7 cavPor3
Dipodomys ordii 13297 ENSDORP00000015305 ENSDORG00000016267 Hdac7 dipOrd1
Gorilla gorilla 20355 ENSGGOP00000022957 101124293 ENSGGOG00000016461 HDAC7 gorGor3
Homo sapiens 76021 ENSP00000080059 51564 ENSG00000061273 HDAC7 hg19,GRCh37
Microcebus murinus 8179 ENSMICP00000008193 ENSMICG00000008981 HDAC7 micMur1
Mus musculus 20929 ENSMUSP00000112109 56233 ENSMUSG00000022475 Hdac7 mm9
Ochotona princeps 8164 ENSOPRP00000009320 ENSOPRG00000010179 HDAC7 OchPri2.0
Otolemur garnettii 4892 ENSOGAP00000004897 100962489 ENSOGAG00000005471 HDAC7 otoGar1
Pan troglodytes 22641 ENSPTRP00000008320 466968 ENSPTRG00000004868 HDAC7 panTro2
Rattus norvegicus 6764 ENSRNOP00000011322 ENSRNOG00000008308 HDAC7_RAT rn4
Spermophilus tridecemlineatus 1663 ENSSTOP00000001667 101960868 ENSSTOG00000001863 Hdac7 speTri1
Tupaia belangeri 14782 ENSTBEP00000014805 ENSTBEG00000017000 HDAC7 tupBel1

multiple sequence alignment in CLUSTALW format

Spermophilus_tridecemlineatus|1869 ------------------------------------------------------------
Otolemur_garnettii|5674            ---------------------------------------------------ATGCACAGC
Tupaia_belangeri|17027             ------------------------------------------------------------
Ochotona_princeps|9381             ------------------------------------------------------------
Dipodomys_ordii|14163              ------------------------------------------------------------
Microcebus_murinus|9651            ---------------------------------------------------ATGCACAGC
Mus_musculus|14605                 ------------------------------------------------------------
Rattus_norvegicus|32781            ------------------------------------------------------------
Cavia_porcellus|24287              ------------------------------------------------------------
Homo_sapiens|21159                 ---------------------------------------------------ATGCACAGC
Pan_troglodytes|9258               ------------------------------------------------------------
Callithrix_jacchus|20220           ------------------------------------------------------------

Ochotona_princeps|9381             ------------------GGGAACGTGAGTCAGGCCCACCACTCCAGACCCAGCACAGNN
Mus_musculus|14605                 ------------------------------------------------------------
Rattus_norvegicus|32781            ------------------------------------------------------------
Cavia_porcellus|24287              ------------------------------------------------------------
Callithrix_jacchus|20220           ------------------------------------------------------------

Mus_musculus|14605                 ------------------------------------------------ATGGACCTGCGG
Callithrix_jacchus|20220           ------------------------------------------------ATGGACCTGCGG
                                                                                    ...   .. . 

                                   .. ..     ..      .... .         . .       .  ..    ..      

                                          .  .              . ..  . .  ..  .                   

                                         .      .. .. . .   . .         ..   .   ..      .     

                                      .         .  .     .. .       .      .     .  . .   . .  

                                    .  .  . ..   .       . .  .  ... .  .            ..  .   . 

Rattus_norvegicus|32781            GAGAGAACAGTCCACCCCAGCAGCCCCAGTATCCCCTAC---------------------
                                   .   .                 .     .       .                       

Rattus_norvegicus|32781            ---------------------------------------------------AGCCTGCCC

                                   * ***. * ** **.** ** **  *.** **.****  *****.** *** ****. *.

                                   ***** **.** **.**.:*  ****..* .* ***** ** ***** .* **.***** 

                                   ** **  **** ** *.*.*..*... .* **..*  * ****  .  .      .  . 

                                    .  .       .  .  .. ..  . .       ..   . . .    .          

Mus_musculus|14605                 GCCCTAGGCTCAGAGGCT------------------------------------------
Callithrix_jacchus|20220           ATCCTGGGCTCGGAGAGT------------------------------------------
                                       . .. .  . .                                             

Mus_musculus|14605                 ------------------------------------------------------------
Callithrix_jacchus|20220           ------------------------------------------------------------

Callithrix_jacchus|20220           ---------------GACCGCAGGACCCATCCGACTCTGGGCCCTCGGGGGCCGATCCTG
                                                  .      .              . ..   . .        .  . 

                                   ..                       . ..  .       ..  . .     . ..  ...

                                   ..     .    .   .  .        .  .  .  ...        .  . .      

                                       ..     . ..   ..    ...    .    ..     . .    .    .    

                                             .  . .  .. .  ..  .     .     .     ..    . .  . .

Ochotona_princeps|9381             CCCCTT---------------------------------------CAACCACACCTGGAG
Cavia_porcellus|24287              CAGCTC---------------------------------------GAGCCTCACTTCCAG

Spermophilus_tridecemlineatus|1869 NNNNNNNNNNNNNNNNNNNNN---------------------NNNNNNNNNNNNNNNNNN
Otolemur_garnettii|5674            NNNNNNNNNNNNNNNNNNNNN---------------------NNNNNNNNNNNNNNNNNN
Tupaia_belangeri|17027             NNNNNNNNNNNNNNNNNNNNN---------------------NNNNNNNNNNNNNNNNNN
Ochotona_princeps|9381             CAGCTGAGACCTCACCTGCAG---------------------CTGGCTGAGAGGCCCGCC
Dipodomys_ordii|14163              CGGCTCCAACCTGATGTCCAG---------------------GTGATCAAGAGGCCAGCC
Microcebus_murinus|9651            CGGCTCAAACCTCACATCCAG---------------------CTGATCAAGAGGCCAGCC
Rattus_norvegicus|32781            CGGCTCAAACCTCATGTCCAG---------------------CTGATCAAGAGGCCTGCC
Cavia_porcellus|24287              CTGATCAAGCTTGACGTCACC---------------------CCTCCCCAGAGAACAGCC
Homo_sapiens|21159                 CAGCTCAAAACTCACGTCCAG---------------------GTGATCAAGAGGTCAGCC
Pan_troglodytes|9258               CAGCTCAAAACTCACGTCCAG---------------------GTGATCAAGAGGTCAGCC
Callithrix_jacchus|20220           CAGCTCAAAACTCACATGCAG---------------------GTGATCAAGAGGTCAGCC
Gorilla_gorilla|26121              CAGCTCAAAACTCACGTCCAG---------------------GTGATCAAGAGGTCAGCC
                                     . .      .    .                                 . .    .  

                                     .     .. .  .       .      . .    .  .  .  .     . .   . .

                                   .. ..        .                 .    .      ...      .       

                                         .        ..         .     .           ..        ....  

                                                  ...  .         ..       .. .      .. .  .    

                                     .     .          .     ...   .      ..  .     .  .     .  

                                   .   .          . .       .   .                . .  .        

Mus_musculus|14605                 GCT------------------ACAGGGCTGGTCTATGACTCGGTGATGCTGAAACACCAA
Rattus_norvegicus|32781            GCC------------------ACAGGGCTGGTCTATGACTCGGTGATGCTGAAACACCAA
                                                           ... .  . .  .  .  .   .. .          

                                   ..    .. .. .      .          . .   .  ..  .  .   . .  . ...

                                   .   .. .    .   . ..  .  .  .    .. . ...  .  . ..  .    .  

                                       . .  .   .   ..  ..    .  .   .     .. .  . .  ..       

                                       .  .  .  .     ...       .  . .    .   .  . .    .     .

                                   .. ..  .. .    ..... . . ....... .    ..      . ...   . . . 

                                     ..  .    ..  .   . ....     ..  . ****. **.** ***** **.** 

                                   **    ** .** * ***   .. .. .  .....  .       ..       .  .  

                                      .     .   .... .. .. .. ..    .  .. .   . .  ..        . 

                                                  .   .   . .  .  .... .  ....  ..       ..    

                                   ..             .. .     .        ... . .   . .   .   . .    

                                   .     ..    .. ..    ..  . ....  ....  . ... ..    ..    .. 

                                   . ... ..     .    ....  ....  .. ..  . .         .....      

                                   . ..   . .  .  ..  .. . .. ..  ..    . .     .  ..   .   .  

                                    . ..  . .. .  . ... ....  . ..  . ...       .      .... .. 

                                   .     .. . ..     .* ** **.*.******.**.**. ******.  **** ***

                                   ** ** ****** *.*** *.**.** ** ***********.** ***** ** ** ** 

                                   **.** ** **.** ** **  *.** ** *.****** **  *  ** ****..*****

Callithrix_jacchus|20220           AAACAGAAACCCCAA---------------------------------------------

Spermophilus_tridecemlineatus|1869 NNNNNN------------------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Otolemur_garnettii|5674            AAATAC------------------------TGGGGCTGCATGCAGCGCCTGGCATCCTGC
Tupaia_belangeri|17027             AAATAC------------------------TGGGGCTGCATGCAGCGCCTGGCCTCCTGT
Ochotona_princeps|9381             AAGTAC------------------------TGGGTCTGTATGAAGCGTCTGGCCGCCTGC
Dipodomys_ordii|14163              AAATAC------------------------TGGGGTTGCATGCAGCGCTTGGCTTCCTGT
Microcebus_murinus|9651            AAATAC------------------------TGGGACTGCATGCAGCGCCTGGCCTCCTGC
Mus_musculus|14605                 AAATAC------------------------TGGGGCTGCATGCAGCGCTTGGCCTCCTGT
Rattus_norvegicus|32781            AAATAC------------------------TGGGGCTGCATGCAGCGCTTGGCCTCCTGT
Cavia_porcellus|24287              AAATAT------------------------TGGGGCTGCATGCAGCGCCTAGCCTCCTCT
Homo_sapiens|21159                 AAATAC------------------------TGGGGCTGCATGCAGCGCCTGGCCTCCTGT
Pan_troglodytes|9258               AAATAC------------------------TGGGGCTGCATGCAGCGCCTGGCCTCCTGT
Callithrix_jacchus|20220           ------------------------------------------CGCCATCTGCTCTCTGGA

Callithrix_jacchus|20220           ---------------GGCCGTGATCCGGGTGCACAG------------------------
                                                      .        .                               

Callithrix_jacchus|20220           ------------------------------------------------------------

Spermophilus_tridecemlineatus|1869 GAAGAGGAAGAACCTATGAATCTCTAA
Otolemur_garnettii|5674            GAGGAGGAAGAACCTATGAATCTCTAA
Tupaia_belangeri|17027             GAGGAGGAAGAACCCATGAATCTCTAA
Ochotona_princeps|9381             GAAGAGGAGGAGCCCATGCATCTGTAA
Dipodomys_ordii|14163              GAAGAGGAAGAGCCGATGAATCTC---
Microcebus_murinus|9651            GAGGAGGAGGAACCAATGAATCTCTAA
Mus_musculus|14605                 GAAGAGGAAGAACCCATGAACCTCTAG
Rattus_norvegicus|32781            GAAGAGGAAGAACCCATGAACCTCTAG
Cavia_porcellus|24287              GAAGAGGAAGAACCGATGAATCTCTAA
Homo_sapiens|21159                 GAGGAGGAAGAACCTATGAATCTCTAA
Pan_troglodytes|9258               GAGGAGGAAGAACCTATGAATCTCTAA
Callithrix_jacchus|20220           ------------------------TAA
Gorilla_gorilla|26121              ACAAAGAAGAAGTGGAGGCAG---TGA

multiple sequence alignment in CLUSTALW format

Spermophilus_tridecemlineatus|1663 ------------------------GTQVSPGAHCLSPPGTXXXXXXXXXXXXXXXXXXXX
Otolemur_garnettii|4892            -----------------MHSPSADGTQVSPGAHCPSPSGTGCPLPRADTPGPQPQPMDLR
Tupaia_belangeri|14782             ------------------------GTQVSPGTHCPRPLGTGCPTLCADTPGPQPQPMDLR
Ochotona_princeps|8164             --------------------------GNVSQAHHSRPSTXXXXXXXXXXXXXXXXXXXXX
Dipodomys_ordii|13297              ------------------------GTQLSPRAHCLSPLGTGCPALRAVTPGPQPQPMDLR
Microcebus_murinus|8179            -----------------MHSPSADGTQVSPGARCPSPPGTGCPKPRADTPGPQPQPMDLR
Mus_musculus|20929                 --------------------------------------------------------MDLR
Rattus_norvegicus|6764             ----------------------------------------GCPALQPDTPGSQPQPMDLR
Cavia_porcellus|19250              ----------------------------------------GYPSPCADTPDSQTQPMDLR
Homo_sapiens|76021                 -----------------MHSPGADGTQVSPGAHYCSPTGAGCPRPCADTPGPQPQPMDLR
Pan_troglodytes|22641              ------------------------GTQVSPGAHYCSPTGAGCPRPCADTPGPQPQPMDLR
Callithrix_jacchus|12640           --------------------------------------------------------MDLR



Rattus_norvegicus|6764             -----------------SLPTEPPEHFPLRKTVSEPNLKLRYKPKKSLERRKNPLLRKES

Mus_musculus|20929                 APPSLRRRPAETLGDSSPSSSSTPASGCSSPNDSEHGPNPALGSEA--------------
Callithrix_jacchus|12640           APPSLRRRPTETLGDSSPSSSSTPASGCSSPNDSEHGPNPILGSES--------------
                                   **.**:** :*.:*                                              

Mus_musculus|20929                 -----------------------DGDRRTHSTLGPRGPVLGNPHA--PLFLHHGLEPEAG
Callithrix_jacchus|12640           -------------------------DRRTHPTLGPRGPILGSPHT--PLFLPHGLEPEAG


Ochotona_princeps|8164             PL-------------QPHLEQLRPHLQ-------LAERPAKLNEKPLLRQIPSAEGRESD
Cavia_porcellus|19250              QL-------------EPHFQLIKLDVT-------PPQRTAKSSEKPRLQQIPSAEDLETD





                                   * *:**                                                      


                                                                                  ** ******.***

Callithrix_jacchus|12640           GAVVLALEGGHDLTAICDASEACVAALLGNKVDPLSEEGWKQKPQ---------------

Callithrix_jacchus|12640           --------------RHLLSG-----GRDPGAQ----------------------------

Spermophilus_tridecemlineatus|1663 EEEEPMNL
Otolemur_garnettii|4892            EEEEPMNL
Tupaia_belangeri|14782             EEEEPMNL
Ochotona_princeps|8164             EEEEPMHL
Dipodomys_ordii|13297              EEEEPMNL
Microcebus_murinus|8179            EEEEPMNL
Mus_musculus|20929                 EEEEPMNL
Rattus_norvegicus|6764             EEEEPMNL
Cavia_porcellus|19250              EEEEPMNL
Homo_sapiens|76021                 EEEEPMNL
Pan_troglodytes|22641              EEEEPMNL
Callithrix_jacchus|12640           --------
Gorilla_gorilla|20355              TKKKWRQ-