Orthologs Set ID: EOG4003GP

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Callithrix jacchus 33995 220, 420, 531, 567, 828, 941, 1207, 1341, 1546, 1718, 1840, 2001
Cavia porcellus 15936 135, 220, 420, 538, 828, 941, 1207, 1341, 1546, 1718, 1840, 2001
Dipodomys ordii 12580 420, 538, 828, 941, 1132, 1207, 1341, 1546, 1718, 1840, 2001
Homo sapiens 166048 220, 420, 538, 828, 941, 1207, 1341, 1546, 1718, 1840, 2001
Mus musculus 44513 220, 420, 538, 828, 941, 1207, 1341, 1546, 1718, 1840, 2001
Ochotona princeps 1338 220, 420, 538, 828, 941, 1207, 1341, 1546, 1602, 1718, 1840, 2001, 2121, 2139
Oryctolagus cuniculus 3777 99, 225, 420, 538, 828, 941, 1207, 1341, 1546, 1718, 1840, 2001
Otolemur garnettii 6943 207, 220, 420, 538, 557, 584, 634, 828, 840, 852, 888, 900, 930, 933, 941, 1132, 1141, 1341, 1606, 1776, 1800, 1824, 1840, 2001
Pan troglodytes 32208 220, 420, 538, 828, 941, 1132, 1207, 1341, 1546, 1718, 1840, 2001
Rattus norvegicus 34385 1718, 1840, 2001
Spermophilus tridecemlineatus 7664 420, 538, 828, 941, 1132, 1207, 1341, 1546, 1715, 1718, 1840
Tarsius syrichta 8578 420, 538, 616, 627, 828, 941, 1207, 1341, 1546, 1718, 1840, 2001, 2157
Tupaia belangeri 3257 9, 220, 420, 538, 828, 941, 1207, 1212, 1341, 1546, 1718, 1840, 2001

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 33995 ENSCJAT00000059465 100387598 ENSCJAG00000010003 MTO1 calJac3
Cavia porcellus 15936 ENSCPOT00000013227 100714255 ENSCPOG00000013100 MTO1 cavPor3
Dipodomys ordii 12580 ENSDORT00000015528 ENSDORG00000015529 Mto1 dipOrd1
Homo sapiens 166048 ENST00000498286 25821 ENSG00000135297 MTO1 hg19,GRCh37
Mus musculus 44513 ENSMUST00000034896 68291 ENSMUSG00000032342 Mto1 mm9
Ochotona princeps 1338 ENSOPRT00000016674 ENSOPRG00000016673 MTO1 OchPri2.0
Oryctolagus cuniculus 3777 ENSOCUT00000008472 100328659 ENSOCUG00000008468 MTO1 oryCun2.0
Otolemur garnettii 6943 ENSOGAT00000006696 100946829 ENSOGAG00000006692 MTO1 otoGar1
Pan troglodytes 32208 ENSPTRT00000033929 750865 ENSPTRG00000018346 Q4G209_PANTR panTro2
Rattus norvegicus 34385 ENSRNOT00000057138 300852 ENSRNOG00000037659 Mto1 rn4
Spermophilus tridecemlineatus 7664 ENSSTOT00000007665 ENSSTOG00000007666 MTO1 speTri1
Tarsius syrichta 8578 ENSTSYT00000010017 ENSTSYG00000009988 MTO1 tarSyr1
Tupaia belangeri 3257 ENSTBET00000003258 ENSTBEG00000003257 MTO1 tupBel1

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 25798 ENSCJAP00000049926 100387598 ENSCJAG00000010003 MTO1 calJac3
Cavia porcellus 12548 ENSCPOP00000011792 100714255 ENSCPOG00000013100 MTO1 cavPor3
Dipodomys ordii 11832 ENSDORP00000014614 ENSDORG00000015529 Mto1 dipOrd1
Homo sapiens 51026 ENSP00000419561 25821 ENSG00000135297 MTO1 hg19,GRCh37
Mus musculus 7064 ENSMUSP00000034896 68291 ENSMUSG00000032342 Mto1 mm9
Ochotona princeps 1159 ENSOPRP00000015228 ENSOPRG00000016673 MTO1 OchPri2.0
Oryctolagus cuniculus 18947 ENSOCUP00000007322 100328659 ENSOCUG00000008468 MTO1 oryCun2.0
Otolemur garnettii 5987 ENSOGAP00000005988 100946829 ENSOGAG00000006692 MTO1 otoGar1
Pan troglodytes 26692 ENSPTRP00000031353 750865 ENSPTRG00000018346 Q4G209_PANTR panTro2
Rattus norvegicus 22929 ENSRNOP00000053966 300852 ENSRNOG00000037659 Mto1 rn4
Spermophilus tridecemlineatus 6857 ENSSTOP00000006854 ENSSTOG00000007666 MTO1 speTri1
Tarsius syrichta 7850 ENSTSYP00000009188 ENSTSYG00000009988 MTO1 tarSyr1
Tupaia belangeri 2820 ENSTBEP00000002818 ENSTBEG00000003257 MTO1 tupBel1

multiple sequence alignment in CLUSTALW format

Dipodomys_ordii|12580              ------------------------------------------------------------
Tupaia_belangeri|3257              CTATTTTCT---------------------------------------------------
Spermophilus_tridecemlineatus|7664 ------------------------------------------------------------
Tarsius_syrichta|8578              ------------------------------------------------------------
Rattus_norvegicus|34385            ------------------------------------------------------------

Dipodomys_ordii|12580              ------------------------------------------------------------
Spermophilus_tridecemlineatus|7664 ------------------------------------------------------------
Tarsius_syrichta|8578              ------------------------------------------------------------
Rattus_norvegicus|34385            ------------------------------------------------------------

Dipodomys_ordii|12580              ------------------------------------------------------------
Spermophilus_tridecemlineatus|7664 ------------------------------------------------------------
Tarsius_syrichta|8578              ------------------------------------------------------------
Rattus_norvegicus|34385            ------------------------------------------------------------

Dipodomys_ordii|12580              ------------------------------------------CAGATGTCCTGTAATCCT
Spermophilus_tridecemlineatus|7664 ------------------------------------------CAGATGTCCTGTAATCCT
Tarsius_syrichta|8578              ------------------------------------------CAGATGTCATGTAATCCT
Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Otolemur_garnettii|6943            ---------AGTCATGTTAAAGAACTAGCAGGA------CGATACTGTCCCTCCATTGAA
Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Otolemur_garnettii|6943            TGC---------------------------------------------------------
Tupaia_belangeri|3257              ------------------------------------------------------------
Ochotona_princeps|1338             ------------------------------------------------------------
Cavia_porcellus|15936              ------------------------------------------------------------
Tarsius_syrichta|8578              ------------------------------------------------------------
Oryctolagus_cuniculus|3777         ------------------------------------------------------------
Callithrix_jacchus|33995           ------------------------------------------------------------
Homo_sapiens|166048                ------------------------------------------------------------
Pan_troglodytes|32208              ttgctcttgttgcccaggatggagtgcaatggtgcgatctcggctcaccacaacctcccc
Rattus_norvegicus|34385            ------------------------------------------------------------
Mus_musculus|44513                 ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Rattus_norvegicus|34385            ------------------------------------------------------------

Otolemur_garnettii|6943            NNN---------------------------------------------------------
Rattus_norvegicus|34385            ---------------------------------------TTCTTAGCTCATGAGGATGCT

                                      .. ....         . . .      . .   ... ..   .  .   .    .  

                                   .   .   ...  ..   .   ..     ..   .       ...      ..  .    

                                        .    .  ..          .        .  . .   . .  ..  .      .

                                   .  .  .. .   ...  .   . .     .   ..   .      .   .      .  

                                     .   ..        . .      .  .     . .  .*    ** **.**..    .

Spermophilus_tridecemlineatus|7664 AAACATCAGCTACAAGAAATAAAGGAAGTTCAACGAGAAGAAGCT---------------
                                       : **. *.*** *****.***..* ***....** **..*                

Spermophilus_tridecemlineatus|7664 ------------------------------------------------------------

Spermophilus_tridecemlineatus|7664 ------------------------------------------------------------

Spermophilus_tridecemlineatus|7664 ------------------------------------------------------------

Ochotona_princeps|1338             GAGTCACCTGGAACTAATGGA---GTCTGCGATACAAACCAA------------------
Spermophilus_tridecemlineatus|7664 ------------------------------------------------------------
Oryctolagus_cuniculus|3777         GAACTGCCACAGACTGAC------------------------------------------
Rattus_norvegicus|34385            GAG---CACCAGACCAATCAGTGCTTA---------------------------------
Mus_musculus|44513                 ------------------------------------------------------------

Otolemur_garnettii|6943            ---TAG
Dipodomys_ordii|12580              ------
Tupaia_belangeri|3257              ---TAG
Ochotona_princeps|1338             ------
Spermophilus_tridecemlineatus|7664 ------
Cavia_porcellus|15936              ---TAG
Tarsius_syrichta|8578              ---TAG
Oryctolagus_cuniculus|3777         ---TGA
Callithrix_jacchus|33995           CAG---
Homo_sapiens|166048                ---TAG
Pan_troglodytes|32208              ---TAG
Rattus_norvegicus|34385            ---TGA
Mus_musculus|44513                 ---TGA

multiple sequence alignment in CLUSTALW format

Dipodomys_ordii|11832              ------------------------------------------------------------
Tupaia_belangeri|2820              LFS--------------------APFRNDNALPRTPHFDVVAIGGGHAGTEAAAAAARCG
Spermophilus_tridecemlineatus|6857 ------------------------------------------------------------
Tarsius_syrichta|7850              ------------------------------------------------------------
Rattus_norvegicus|22929            ------------------------------------------------------------

Dipodomys_ordii|11832              --------------QMSCNPSFGGIGKGHLMREVDALDGLCSRICDQSGVHYKVLNRRKG
Spermophilus_tridecemlineatus|6857 --------------QMSCNPSFGGIGKGHLMREVDALDGLCSRICDQSGVHYKVLNRRKG
Tarsius_syrichta|7850              --------------QMSCNPSFGGIGKGHLMREVDALDGLCSRICDQSGIHYKVLNRRKG
Rattus_norvegicus|22929            ------------------------------------------------------------

Rattus_norvegicus|22929            ------------------------------------------------------------

Rattus_norvegicus|22929            ------------------------------------------------------------

Rattus_norvegicus|22929            ------------------------------------------------------------

Rattus_norvegicus|22929            ------------------------------------------------------------

Otolemur_garnettii|5987            KMITCIRGLEKAKMIQPEGTC-----------------------YGVQYDYLDPRHISPS
Tupaia_belangeri|2820              KMITCIKGLEKAKMIQ-------------------------PAYYGVQYDYLDPRQITPS
Ochotona_princeps|1159             KMITCIRGLEEARMVQ-------------------------PG-YGVQYDYFDPRQISPS
Cavia_porcellus|12548              KMITCIRGLEKAKMMQ-------------------------PG-YGVQYDYLDPRQITPS
Tarsius_syrichta|7850              KVITSIRGLEKARVIQ-------------------------PG-YGVQYDYLDPRQITTS
Oryctolagus_cuniculus|18947        KMIACIRGLEKAKMIQ-------------------------PG-YGVQYDYLDPRQISPS
Callithrix_jacchus|25798           KMITCIRGLEKAKVIQ-------------------------PG-YGVQYDYLDPRQITPS
Homo_sapiens|51026                 KMITCIRGLEKAKVIQ-------------------------PG-YGVQYDYLDPRQITPS
Rattus_norvegicus|22929            ------------------------------------------------------------
Mus_musculus|7064                  KMITCIRGLEKAKMVH-------------------------PG-YGVQYDYLDPRQISPS

Rattus_norvegicus|22929            ------------------------------------------------------------

Otolemur_garnettii|5987            XXXXXXXXXXXXXXXXXXXXX--------------------XXXXXXXXXXXXXXXXXXX
Rattus_norvegicus|22929            ---------------------------------FLAHEDAGCVSPQRYKRALWMKSSLEE


Spermophilus_tridecemlineatus|6857 TQCRELAERLKIEATYESVLKHQLQEIKEVQREEA-------------------------
                                                  ***    ***:*: .*::*:                         

Spermophilus_tridecemlineatus|6857 ------------------------------------------------------------
Oryctolagus_cuniculus|18947        HFSRPQTIGAASRIPGVTPAAIVNLLRFVKTTQQRQATVNELPQTD--------------
Mus_musculus|7064                  HLSRPQTIGAASRIPGVTPAAIINLLRFVRSTRQSRQQ----------------------

Otolemur_garnettii|5987            -
Dipodomys_ordii|11832              -
Tupaia_belangeri|2820              -
Ochotona_princeps|1159             -
Spermophilus_tridecemlineatus|6857 -
Cavia_porcellus|12548              -
Tarsius_syrichta|7850              -
Oryctolagus_cuniculus|18947        -
Callithrix_jacchus|25798           Q
Homo_sapiens|51026                 -
Pan_troglodytes|26692              -
Rattus_norvegicus|22929            -
Mus_musculus|7064                  -