Orthologs Set ID: EOG4003GQ

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Callithrix jacchus 25712 264, 1153, 1318, 1545, 1677, 1794, 1915
Cavia porcellus 10629 1153, 1318, 1545, 1677, 1794, 1915
Dipodomys ordii 1369 978, 998, 1153, 1318, 1545, 1677, 1794, 1915, 2109
Homo sapiens 66773 1153, 1318, 1545, 1677, 1794, 1915
Microcebus murinus 16273 555, 603, 633, 663, 739, 759, 774, 780, 786, 825, 1153, 1318, 1545, 1677, 1794, 1915
Mus musculus 32903 1153, 1318, 1545, 1677, 1794, 1915
Ochotona princeps 2889 360, 366, 1153, 1318, 1545, 1677
Oryctolagus cuniculus 8093 414, 621, 892, 1153, 1318, 1545, 1677, 1794, 1915
Otolemur garnettii 16635 75, 105, 120, 132, 153, 163, 441, 456, 465, 507, 534, 552, 1153, 1318, 1541, 1545, 1677, 1794, 1915, 2106
Pan troglodytes 28292 1153, 1318, 1545, 1677, 1794, 1915
Rattus norvegicus 11407 1153, 1318, 1545, 1677, 1794, 1915
Spermophilus tridecemlineatus 3795 762, 825, 840, 1153, 1318, 1509, 1545, 1677, 1794, 1915
Tupaia belangeri 14546 1153, 1318, 1545, 1677, 1794, 1915, 2119

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 25712 ENSCJAT00000007877 100400490 ENSCJAG00000004102 NOA1 calJac3
Cavia porcellus 10629 ENSCPOT00000021531 100729731 ENSCPOG00000027252 NOA1 cavPor3
Dipodomys ordii 1369 ENSDORT00000010074 ENSDORG00000010075 Noa1 dipOrd1
Homo sapiens 66773 ENST00000264230 84273 ENSG00000084092 NOA1 hg19,GRCh37
Microcebus murinus 16273 ENSMICT00000015157 ENSMICG00000015150 NOA1 micMur1
Mus musculus 32903 ENSMUST00000047860 56412 ENSMUSG00000036285 Noa1 mm9
Ochotona princeps 2889 ENSOPRT00000008101 101533515 ENSOPRG00000008107 NOA1 OchPri2.0
Oryctolagus cuniculus 8093 ENSOCUT00000016338 100341545 ENSOCUG00000016330 NOA1 oryCun2.0
Otolemur garnettii 16635 ENSOGAT00000015999 100965655 ENSOGAG00000015994 NOA1 otoGar1
Pan troglodytes 28292 ENSPTRT00000029980 735814 ENSPTRG00000016088 NOA1 panTro2
Rattus norvegicus 11407 ENSRNOT00000002810 289562 ENSRNOG00000002055 RGD1359460 rn4
Spermophilus tridecemlineatus 3795 ENSSTOT00000003795 101963293 ENSSTOG00000003793 Noa1 speTri1
Tupaia belangeri 14546 ENSTBET00000014547 ENSTBEG00000014550 NOA1 tupBel1

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 17857 ENSCJAP00000007454 100400490 ENSCJAG00000004102 NOA1 calJac3
Cavia porcellus 8298 ENSCPOP00000018683 100729731 ENSCPOG00000027252 NOA1 cavPor3
Dipodomys ordii 1285 ENSDORP00000009469 ENSDORG00000010075 Noa1 dipOrd1
Homo sapiens 41883 ENSP00000264230 84273 ENSG00000084092 NOA1 hg19,GRCh37
Microcebus murinus 13817 ENSMICP00000013826 ENSMICG00000015150 NOA1 micMur1
Mus musculus 29259 ENSMUSP00000045948 56412 ENSMUSG00000036285 Noa1 mm9
Ochotona princeps 2525 ENSOPRP00000007411 101533515 ENSOPRG00000008107 NOA1 OchPri2.0
Oryctolagus cuniculus 22240 ENSOCUP00000014048 100341545 ENSOCUG00000016330 NOA1 oryCun2.0
Otolemur garnettii 14320 ENSOGAP00000014322 100965655 ENSOGAG00000015994 NOA1 otoGar1
Pan troglodytes 15477 ENSPTRP00000027668 735814 ENSPTRG00000016088 NOA1 panTro2
Rattus norvegicus 19670 ENSRNOP00000002810 289562 ENSRNOG00000002055 RGD1359460 rn4
Spermophilus tridecemlineatus 3401 ENSSTOP00000003401 101963293 ENSSTOG00000003793 Noa1 speTri1
Tupaia belangeri 12622 ENSTBEP00000012617 ENSTBEG00000014550 NOA1 tupBel1

multiple sequence alignment in CLUSTALW format

Cavia_porcellus|10629              ------------------------------------------------------------
Spermophilus_tridecemlineatus|3795 ------------------------------------------------------------
Microcebus_murinus|16273           ------------------------------------------------------------
Tupaia_belangeri|14546             ------------------------------------------------------------

Cavia_porcellus|10629              ------------------------------------------------------------
Oryctolagus_cuniculus|8093         GCGGTGCGG---------------------CTGCTGCGGACGGGATGCGCGGCCGCCGCC
Spermophilus_tridecemlineatus|3795 ------------------------------------------------------------
Microcebus_murinus|16273           ------------------------------------------------------------
Tupaia_belangeri|14546             ------------------------------------------------------------

Cavia_porcellus|10629              ------------------------------------------------------------
Spermophilus_tridecemlineatus|3795 ------------------------------------------------------------
Microcebus_murinus|16273           ------------------------------------------------------------
Tupaia_belangeri|14546             ------------------------------------------------------------

Cavia_porcellus|10629              ------------------------------------------------------------
Spermophilus_tridecemlineatus|3795 ------------------------------------------------------------
Microcebus_murinus|16273           ------------------------------------------------------------
Tupaia_belangeri|14546             ------------------------------------------------------------

Rattus_norvegicus|11407            CGGACCCCTGaggaacagctgcgggaattgcgggagctgcgggagttgcagcagctgcag
Cavia_porcellus|10629              ------------------------------------------------------------
Oryctolagus_cuniculus|8093         CCGGAGCCCCCGCCGACGCCTGAGGAGCTG------------------------------
Spermophilus_tridecemlineatus|3795 ------------------------------------------------------------
Microcebus_murinus|16273           ------------------------------------------------------------
Tupaia_belangeri|14546             ------------------------------------------------------------
Callithrix_jacchus|25712           CCGGAGCCGGAACCTACCCCCAAAAACCTA------------------------------
Pan_troglodytes|28292              CCGGAGCCGGAACCCACCCGCGAAAagcag------ctgcaggagctccagcaacagcag

Rattus_norvegicus|11407            caggagaaagaacgacagaggttgcagcggcgggaggagcggcttcagcagaaactgcgg
Cavia_porcellus|10629              ---------------------------------------------CAGCAGAAACTGCGG
Oryctolagus_cuniculus|8093         ------------------------------------------------------------
Spermophilus_tridecemlineatus|3795 ------------------------------------------------------------
Microcebus_murinus|16273           ------------------------------------------------------------
Tupaia_belangeri|14546             ------------------------------------------------------------
Callithrix_jacchus|25712           ---------------------------------------------------------CGG
Pan_troglodytes|28292              gaggaggaggagcgacagaggcagcagcggcgggaggagcggcgacagcaAAACCTACGG

Ochotona_princeps|2889             GAACGC------------------------------GACCCGACCGTGCCGCCCAGCGGC
Oryctolagus_cuniculus|8093         ---------------CTGCGGGCGCTGCGGGAGCGGGAGCAGGAGCAGGAGGAGAGCGGC
Spermophilus_tridecemlineatus|3795 ------------------------------------------------------------
Microcebus_murinus|16273           ------------------------------------------------------------
Tupaia_belangeri|14546             ------------------------------------------------------------

Spermophilus_tridecemlineatus|3795 ------------------------------------------------------------
Microcebus_murinus|16273           ------------------------------------------------------------
Tupaia_belangeri|14546             ------------------------------------------------------------

Spermophilus_tridecemlineatus|3795 ------------------------------------------------------------
Microcebus_murinus|16273           ------------------------------------------------------------
Tupaia_belangeri|14546             ---------------------------------------------CTGGCGCGGACCGTG

Spermophilus_tridecemlineatus|3795 ------------------------------------------------------------

Oryctolagus_cuniculus|8093         GCGCAGTACCTGCAGCAGGTG------------------------------cTGGTGCTC
Spermophilus_tridecemlineatus|3795 ------------------------------------------------------------

Spermophilus_tridecemlineatus|3795 ---------------------------------------------------AAGCTGGTG
                                                                                       ..**  *.

                                   .*  *.**.**. * :**** ** ** ** **. *.*** *           .  .  * 

Oryctolagus_cuniculus|8093         GACTACCGGCGGCGGCTCCGCCAGCGGCTGTGGGACGAGTGC------------------
                                   *.****      .* ** **  * .*  * ***.. ** **                   

Oryctolagus_cuniculus|8093         ---------------------------------------------------GACGAGGAG
Callithrix_jacchus|25712           CTGGCCCCTGGCCACCGAGGGCCACAG------------------------GACCGGGAG
                                                                                      **    .: 

Oryctolagus_cuniculus|8093         CAGAGCGCG---------------TCCCGCACGGTGGTCAGGGACGTGCGGCTGGTCAGC
                                       .   *                   **.* **.** ...*****..*  * .* ***

                                   ** ***** *..** **    **.**. * *****  *  .   . .    ... . .  

                                    . .. .  .. .   . .....             ..    .      . ..       

                                    .  .    .  .  .  ..    .    ...    .  .   . .     .      . 

                                   .     ...   .* ** **. *.***** ** ***** ** ** *  *****.***** 

                                   ** ********  ..**.** ..*.*.***.*. . **   ..   .. * **.** ** 

                                   ** *.  .. *.**.**...*...** ..     * **.*..*. ** ** .* .* **.

Mus_musculus|32903                 AGAGTTGGAAGAACATTCTCGTACTCCAGAGAACAG---GACGAAGTT------------
Cavia_porcellus|10629              AGAGTTGGAAGGACGTTCTTGTATTCAGCAGAACAGAAGCATGAC---------------
                                   **.** *****.** ** * . * :*.  . * **.    . .*                

                                            *** : ** ***   ** ** ** ** ** *******.**.*** ** ** 

                                               .*.      .* .*.*...   *. *.**  *: * ** **.*..** 

                                   ** ******   ***** **.** **.** :  ******   ..  .  .   . .  . 

                                      .     .   .       ... .              .. .     .    .. .. 

                                    .       ..   ...  . ... .... .   . .   .  . .  ..  .   ... 

                                         .  .  .....    .. .. .  .         .    ..     .    .  

                                   .. .    ..  .  .   . .    .      .  ..        .  .   .      

Ochotona_princeps|2889             ------------------------------------------------------------

Ochotona_princeps|2889             ------------------------------------------------------------

Ochotona_princeps|2889             ------------------------------------------------------------

Ochotona_princeps|2889             ------------------------------------------------------------

Ochotona_princeps|2889             ------------------------------------------------------------

Otolemur_garnettii|16635           AAGAAGAAGATAAATGTC------TGA
Dipodomys_ordii|1369               AAAAAGAAAGTGACAGATGTCGGA---
Mus_musculus|32903                 AAGCACAGA---------------TGA
Rattus_norvegicus|11407            AAGCACAGA---------------TGA
Ochotona_princeps|2889             ---------------------------
Cavia_porcellus|10629              AAGAAA---------------------
Oryctolagus_cuniculus|8093         AAGAAGAAAAACAAA---------TAA
Spermophilus_tridecemlineatus|3795 AAGAAGAAAAAAACAACAAATGTATGA
Microcebus_murinus|16273           AAGAAGAAAGGA------------TGA
Tupaia_belangeri|14546             AAGAAGAAACAGGCAAACGTACGC---
Callithrix_jacchus|25712           AAGAAGAAAGGACAGAGAGCTGTATAA
Homo_sapiens|66773                 AAGAAGAAAGGAAAGATAAATGTATGA
Pan_troglodytes|28292              AAGAAGAAAGGAAAGATAAATGTATGA

multiple sequence alignment in CLUSTALW format

Cavia_porcellus|8298               ------------------------------------------------------------
Spermophilus_tridecemlineatus|3401 ------------------------------------------------------------
Microcebus_murinus|13817           ------------------------------------------------------------
Tupaia_belangeri|12622             ------------------------------------------------------------

Cavia_porcellus|8298               -------------------------------------------------------QQKLR
Oryctolagus_cuniculus|22240        ----GDDTEERFLFPEYTPEPEPPPTPEEL------------------------------
Spermophilus_tridecemlineatus|3401 ------------------------------------------------------------
Microcebus_murinus|13817           ------------------------------------------------------------
Tupaia_belangeri|12622             ------------------------------------------------------------
Callithrix_jacchus|17857           DFEESADMQEHFLFPEYLLEPEPEPTPKNL-----------------------------R

Spermophilus_tridecemlineatus|3401 ------------------------------------------------------------
Microcebus_murinus|13817           ------------------------------------------------------------
Tupaia_belangeri|12622             -------------------------------------------------------LARTV

Spermophilus_tridecemlineatus|3401 ---------------------------------------------------------KLV

Oryctolagus_cuniculus|22240        GPKQLIVLGNKVDLLPQDAPDYRRRLRQRLWDEC-----------------------DEE
                                   ..**::*****:**     ..*  ***.*** :*                       :  

                                           . .**:****:**** ** **:**:                           

                                                            **********.******** *::**: *   :*::

                                   *. :** :*  :*::**::******* :: .*  .        * ** ******* .:**

                                       :. ::: :**..**:**** ****** **                           


Ochotona_princeps|2525             ------------------------------------------------------------

Ochotona_princeps|2525             ------------------------------------------------