Orthologs Set ID: EOG4003GT

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Callithrix jacchus 14877 237, 276, 319, 432, 513, 619, 699, 766, 818, 941, 1037, 1132, 1198, 1263, 1353, 1407, 1517, 1620, 1695
Dipodomys ordii 9105 237, 276, 319, 387, 402, 432, 513, 619, 699, 762, 818, 941, 1037, 1132, 1198, 1263, 1353, 1407, 1517, 1620, 1695
Gorilla gorilla 10842 237, 276, 319, 432, 513, 619, 699, 762, 818, 941, 1037, 1132, 1198, 1263, 1353, 1407, 1517, 1620, 1695
Homo sapiens 63238 237, 276, 319, 432, 513, 619, 699, 762, 818, 941, 1037, 1132, 1198, 1263, 1353, 1407, 1517, 1620, 1695
Microcebus murinus 2168 618, 762, 818, 941, 1037, 1079, 1131, 1353, 1407, 1517, 1620, 1695
Mus musculus 12147 237, 276, 319, 432, 513, 619, 699, 762, 818, 941, 1037, 1132, 1198, 1263, 1353, 1407, 1517, 1620, 1695
Ochotona princeps 143 276, 319, 432, 513, 619, 699, 762, 818, 941, 1037, 1132, 1198, 1263, 1353, 1407, 1517, 1620, 1695
Oryctolagus cuniculus 19332 237, 276, 319, 432, 513, 619, 699, 762, 818, 941, 1037, 1132, 1198, 1263, 1353, 1407, 1517, 1620, 1695
Otolemur garnettii 5519 237, 276, 319, 432, 513, 619, 699, 762, 818, 941, 1037, 1132, 1198, 1263, 1353, 1407, 1494, 1497, 1509, 1517, 1620, 1695
Pan troglodytes 26380 237, 276, 319, 432, 513, 619, 699, 762, 818, 941, 1037, 1132, 1198, 1263, 1353, 1407, 1517, 1620, 1695
Rattus norvegicus 13597 237, 276, 319, 432, 513, 619, 699, 753, 762, 818, 941, 1037, 1132, 1198, 1263, 1353, 1407, 1517, 1620, 1695
Spermophilus tridecemlineatus 7901 432, 513, 619, 699, 762, 818, 941, 1037, 1132, 1196, 1198, 1263, 1353, 1390, 1407, 1517, 1620, 1695
Tarsius syrichta 3496 237, 276, 319, 432, 513, 619, 699, 762, 818, 941, 1037, 1132, 1198, 1215, 1263, 1353, 1407, 1517, 1620, 1695
Tupaia belangeri 7468 169, 237, 276, 319, 432, 513, 520, 619, 699, 762, 818, 941, 1037, 1132, 1198, 1263, 1353, 1407, 1517, 1569, 1620

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 14877 ENSCJAT00000039114 100386826 ENSCJAG00000019910 DENND6A calJac3
Dipodomys ordii 9105 ENSDORT00000008823 ENSDORG00000008820 Dennd6a dipOrd1
Gorilla gorilla 10842 ENSGGOT00000041117 101127470 ENSGGOG00000034949 DENND6A gorGor3
Homo sapiens 63238 ENST00000311128, NM_152678 201627 ENSG00000174839 DENND6A hg19,GRCh37
Microcebus murinus 2168 ENSMICT00000002020 ENSMICG00000002018 DENND6A micMur1
Mus musculus 12147 ENSMUST00000037585 211922 ENSMUSG00000040818 Dennd6a mm9
Ochotona princeps 143 ENSOPRT00000015297 101527957 ENSOPRG00000015295 DENND6A OchPri2.0
Oryctolagus cuniculus 19332 ENSOCUT00000000826 100354110 ENSOCUG00000000826 DENND6A oryCun2.0
Otolemur garnettii 5519 ENSOGAT00000005326 100965600 ENSOGAG00000005320 DENND6A otoGar1
Pan troglodytes 26380 ENSPTRT00000028179 460472 ENSPTRG00000015052 DENND6A panTro2
Rattus norvegicus 13597 ENSRNOT00000015597 306229 ENSRNOG00000011636 Fam116a rn4
Spermophilus tridecemlineatus 7901 ENSSTOT00000007902 ENSSTOG00000007895 DENND6A speTri1
Tarsius syrichta 3496 ENSTSYT00000006485 ENSTSYG00000006484 DENND6A tarSyr1
Tupaia belangeri 7468 ENSTBET00000007469 ENSTBEG00000007457 DENND6A tupBel1

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 7549 ENSCJAP00000037036 100386826 ENSCJAG00000019910 DENND6A calJac3
Dipodomys ordii 8535 ENSDORP00000008279 ENSDORG00000008820 Dennd6a dipOrd1
Gorilla gorilla 9080 ENSGGOP00000028719 101127470 ENSGGOG00000034949 DENND6A gorGor3
Homo sapiens 58589 ENSP00000311401 201627 ENSG00000174839 DENND6A hg19,GRCh37
Microcebus murinus 1845 ENSMICP00000001847 ENSMICG00000002018 DENND6A micMur1
Mus musculus 30902 ENSMUSP00000039361 211922 ENSMUSG00000040818 Dennd6a mm9
Ochotona princeps 123 ENSOPRP00000013974 101527957 ENSOPRG00000015295 DENND6A OchPri2.0
Oryctolagus cuniculus 22194 ENSOCUP00000000719 100354110 ENSOCUG00000000826 DENND6A oryCun2.0
Otolemur garnettii 4758 ENSOGAP00000004762 100965600 ENSOGAG00000005320 DENND6A otoGar1
Pan troglodytes 22947 ENSPTRP00000025998 460472 ENSPTRG00000015052 DENND6A panTro2
Rattus norvegicus 8749 ENSRNOP00000015597 306229 ENSRNOG00000011636 Fam116a rn4
Spermophilus tridecemlineatus 7068 ENSSTOP00000007071 ENSSTOG00000007895 DENND6A speTri1
Tarsius syrichta 3208 ENSTSYP00000005937 ENSTSYG00000006484 DENND6A tarSyr1
Tupaia belangeri 6451 ENSTBEP00000006460 ENSTBEG00000007457 DENND6A tupBel1

multiple sequence alignment in CLUSTALW format

Microcebus_murinus|2168            ------------------------------------------------------------
Spermophilus_tridecemlineatus|7901 ------------------------------------------------------------
Tupaia_belangeri|7468              ------------------------------------------------------------
Ochotona_princeps|143              ------------------------------------------------------------

Microcebus_murinus|2168            ------------------------------------------------------------
Spermophilus_tridecemlineatus|7901 ------------------------------------------------------------
Tupaia_belangeri|7468              ------------------------------------------------------------
Ochotona_princeps|143              ------------------------------------------------------------

Microcebus_murinus|2168            ------------------------------------------------------------
Spermophilus_tridecemlineatus|7901 ------------------------------------------------------------
Tupaia_belangeri|7468              ---------------------------------CTGCGGCGCCTGGGCGGCTTCTCCGCC
Ochotona_princeps|143              ------------------------------------------------------------

Microcebus_murinus|2168            ------------------------------------------------------------
Spermophilus_tridecemlineatus|7901 ------------------------------------------------------------
Ochotona_princeps|143              ---------------------------------------------------------GTA

Microcebus_murinus|2168            ------------------------------------------------------------
Spermophilus_tridecemlineatus|7901 ------------------------------------------------------------

Microcebus_murinus|2168            ------------------------------------------------------------
Spermophilus_tridecemlineatus|7901 ---------------------TGTCTTGGAGATACCCAGTTTTGTTTTAGATTTCGACAG

Microcebus_murinus|2168            ------------------------------------------------------------

Microcebus_murinus|2168            ------------------------------------------------------------

Microcebus_murinus|2168            ---------------------------------TCATTGGTTTTGATCAGCAAGCTACCA
                                                                    ** ****************..**.** 

                                   ** *********** ***** ** ** *****.*****:**.**.** ** *****.*.*

Microcebus_murinus|2168            GAACCTTATTTGGAAGCA------------------------------------------
                                   *.:** ** **.******                                          

Microcebus_murinus|2168            ---------------------------------------GTACGGATTCCCACATGTCAT
                                                                          ..  .  .       ..   .

                                   .    .   ..           .      .           .   .           . .

                                    .. .. .       ...   .   . . . ....  ..***** ***********  * 

                                   ** ** **.***** *****. **** ** *****.**.***.* **.** *****.** 

                                   ** **.** **.** *****.** **. **** ** ** ** * *** ** **: *.**.

                                   ** *  ******** **.***** ** :* ** ** ** *****.*****.**.** ***

                                   ***** ** ********.   .  ..  . .. .. ..          .......     

                                       .   .   ...       .. .. .  . .. .   ..     .            

Microcebus_murinus|2168            ------------------------------------------------------------

Microcebus_murinus|2168            ------------------------------------------------------------

                                      . . .      .    ..   .  .  .      . ..  .. .  .  . .  ...

                                   ....   .        . ..  .  ..   .. .   . .  .. .   .  .  ..  .

                                    .        .. . .     ...  . ..          .  .    ..  ..   .  

                                   .  ... ..       . .        ..   .  . .    .*: **.****.*.    

                                         .  *****  *     .  .   .. .     ... . ..  ... .   .   

                                    .  .        ..          .    .       . . .  .     ..      .

                                   .   .  .  . ... .   .         .  .. .     .. .   .... ...  .

Tupaia_belangeri|7468              CTGAAAAATAAGTTG---------------------------------------------
                                    ..     .    ..                                             

Tupaia_belangeri|7468              ------------------------------------------------------------

Otolemur_garnettii|5519            ATACTGCTCAAAACGGGCATGACATGA
Microcebus_murinus|2168            ATACTACTCAAAACAGGCATGACATGA
Spermophilus_tridecemlineatus|7901 ATACTGCTCAAAACAGGCATGACGTGA
Tupaia_belangeri|7468              ---------------------------
Tarsius_syrichta|3496              ATACTGCTCAAAACAGGCATGACATGA
Dipodomys_ordii|9105               ATACTGCTCAAAACTGGCATGACATGA
Callithrix_jacchus|14877           ATACTGCTCAAAACGGGCATGACGTGA
Gorilla_gorilla|10842              ATACTGCTCAAAACAGGCATGACATGA
Homo_sapiens|63238                 ATACTGCTCAAAACGGGCATGACATGA
Pan_troglodytes|26380              ATACTGCTCAAAACGGGCATGACATGA
Oryctolagus_cuniculus|19332        ATATTGCTCAAAACGGGCATGACATGA
Ochotona_princeps|143              ATATTGCTCAAAACGGGCATGACATGA
Mus_musculus|12147                 ATACTGCTCAAGACCGGCATGACATAA
Rattus_norvegicus|13597            ATACTGCTCAAGACTGGCATGACATGA

multiple sequence alignment in CLUSTALW format

Microcebus_murinus|1845            ------------------------------------------------------------
Spermophilus_tridecemlineatus|7068 ------------------------------------------------------------
Tupaia_belangeri|6451              ---------------------------------------------------LRRLGGFSA
Ochotona_princeps|123              ------------------------------------------------------------

Microcebus_murinus|1845            ------------------------------------------------------------
Spermophilus_tridecemlineatus|7068 -----------------------------------------------CLGDTQFCFRFRQ
Ochotona_princeps|123              -------------------VIYPQHSKLTDKEKTNICYLSFPDSNSGCLGDTQFCFRFRQ

Microcebus_murinus|1845            ---------------------------------------------------SLVLISKLP

Microcebus_murinus|1845            YIHFFHTVLKQIAPEYFEKNEPYLEA---------------------------VRIPTCH
                                   *******************. *****                                  


                                   **************.****** *******:****************              

Microcebus_murinus|1845            XXXXXXXXXXXXXXXXX-------------------------------------------


                                                   :*.    **                                   

Tupaia_belangeri|6451              DLLLWIQKHTEVETVDLVLKLKNKL-----------------------------------

Otolemur_garnettii|4758            ILLKTGMT
Microcebus_murinus|1845            ILLKTGMT
Spermophilus_tridecemlineatus|7068 ILLKTGMT
Tupaia_belangeri|6451              --------
Tarsius_syrichta|3208              ILLKTGMT
Dipodomys_ordii|8535               ILLKTGMT
Callithrix_jacchus|7549            ILLKTGMT
Gorilla_gorilla|9080               ILLKTGMT
Homo_sapiens|58589                 ILLKTGMT
Pan_troglodytes|22947              ILLKTGMT
Oryctolagus_cuniculus|22194        ILLKTGMT
Ochotona_princeps|123              ILLKTGMT
Mus_musculus|30902                 ILLKTGMT
Rattus_norvegicus|8749             ILLKTGMT