Orthologs Set ID: EOG4003HD

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Callithrix jacchus 33180 111, 277
Cavia porcellus 5534 33, 48, 277, 415, 533, 598, 658, 722, 762
Dipodomys ordii 14057 36, 75, 108, 277, 415, 533, 598, 670, 702, 720, 772, 1047, 1074, 1086, 1093
Gorilla gorilla 2512 111, 277, 415, 533, 598, 673, 756, 781
Homo sapiens 14404 111, 277, 415, 533, 598, 673, 756, 781
Microcebus murinus 7042 277, 415, 533, 598, 672, 702, 756, 762, 1068, 1095
Mus musculus 20033 123, 277, 415, 533, 598, 664, 756, 781
Ochotona princeps 15104 15, 90, 109, 111, 174, 189, 277, 415, 533, 598, 667, 772
Otolemur garnettii 6683 277, 415, 533, 598, 673, 756, 762, 936, 942, 977, 987, 999
Pan troglodytes 5243 111, 277, 415, 533, 598, 673, 772
Rattus norvegicus 4386 123, 277, 415, 533, 598, 667, 756, 781
Spermophilus tridecemlineatus 15579 12, 47, 93, 108, 111, 277, 415, 533, 598, 671, 673, 756, 762, 763
Tarsius syrichta 6747 10, 49, 81, 111, 277, 415, 533, 598, 688, 772
Tupaia belangeri 17632 3, 63, 99, 106, 108, 277, 415, 533, 598

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 33180 ENSCJAT00000011017 100397803 ENSCJAG00000005615 FAS calJac3
Cavia porcellus 5534 ENSCPOT00000011699 100726403 ENSCPOG00000011587 FAS cavPor3
Dipodomys ordii 14057 ENSDORT00000012681 ENSDORG00000012679 Fas dipOrd1
Gorilla gorilla 2512 ENSGGOT00000027544 101152441 ENSGGOG00000025975 FAS gorGor3
Homo sapiens 14404 ENST00000355740, NM_000043 355 ENSG00000026103 FAS hg19,GRCh37
Microcebus murinus 7042 ENSMICT00000006548 ENSMICG00000006549 FAS micMur1
Mus musculus 20033 ENSMUST00000025691 14102 ENSMUSG00000024778 Fas mm9
Ochotona princeps 15104 ENSOPRT00000015065 ENSOPRG00000015065 FAS OchPri2.0
Otolemur garnettii 6683 ENSOGAT00000006442 ENSOGAG00000006440 FAS otoGar1
Pan troglodytes 5243 ENSPTRT00000005156 ENSPTRG00000002730 FAS panTro2
Rattus norvegicus 4386 ENSRNOT00000049807 246097 ENSRNOG00000019142 Fas rn4
Spermophilus tridecemlineatus 15579 ENSSTOT00000015580 ENSSTOG00000015576 FAS speTri1
Tarsius syrichta 6747 ENSTSYT00000007289 ENSTSYG00000007305 FAS tarSyr1
Tupaia belangeri 17632 ENSTBET00000017633 ENSTBEG00000017630 FAS tupBel1

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 25025 ENSCJAP00000010424 100397803 ENSCJAG00000005615 FAS calJac3
Cavia porcellus 4308 ENSCPOP00000010424 100726403 ENSCPOG00000011587 FAS cavPor3
Dipodomys ordii 13213 ENSDORP00000011924 ENSDORG00000012679 Fas dipOrd1
Gorilla gorilla 2389 ENSGGOP00000027099 101152441 ENSGGOG00000025975 FAS gorGor3
Homo sapiens 39000 ENSP00000347979 355 ENSG00000026103 FAS hg19,GRCh37
Microcebus murinus 5984 ENSMICP00000005983 ENSMICG00000006549 FAS micMur1
Mus musculus 45425 ENSMUSP00000025691 14102 ENSMUSG00000024778 Fas mm9
Ochotona princeps 13172 ENSOPRP00000013757 ENSOPRG00000015065 FAS OchPri2.0
Otolemur garnettii 5759 ENSOGAP00000005758 ENSOGAG00000006440 FAS otoGar1
Pan troglodytes 19471 ENSPTRP00000004767 ENSPTRG00000002730 FAS panTro2
Rattus norvegicus 29517 ENSRNOP00000040348 246097 ENSRNOG00000019142 Fas rn4
Spermophilus tridecemlineatus 13942 ENSSTOP00000013944 ENSSTOG00000015576 FAS speTri1
Tarsius syrichta 6182 ENSTSYP00000006670 ENSTSYG00000007305 FAS tarSyr1
Tupaia belangeri 15334 ENSTBEP00000015334 ENSTBEG00000017630 FAS tupBel1

multiple sequence alignment in CLUSTALW format

Mus_musculus|20033                  ATGCTGTGGATC------------TGGGCT------------------------------
Rattus_norvegicus|4386              GTG---------------------TGGATTCTCCTCTGTCCTCCT---------------
Otolemur_garnettii|6683             ------------------------------------------------------------
Cavia_porcellus|5534                ------------TTCATTTTTTCCTGGACATTG------ATTCCACAG------------
Microcebus_murinus|7042             ------------------------------------------------------------
Homo_sapiens|14404                  ATGCTGGGCATC------------TGGACCCTC------CTACCT---------------
Pan_troglodytes|5243                atgctcagagtgtgtgcacaaggctggcacgcccagggtcttcctcatggcactaacagt
Dipodomys_ordii|14057               ------------------------------AGTCACAAGCCGGGTAGACACAACCAGGGA

Mus_musculus|20033                  ---------------------------------------------------GTCCTGCCT
Rattus_norvegicus|4386              ------------------------------------------------------------
Tarsius_syrichta|6747               CTACTGGAAGGCGGGACAAAGACA------------------AGGCTGGTGNNNNNNNNN
Ochotona_princeps|15104             ---------------AGTGAGGCAGAGACAAAAATACCCATGAGGCTGGTGATACTCCTT
Otolemur_garnettii|6683             ---------------------------------------------------ATACTTACC
Cavia_porcellus|5534                ---------------------------------------------------GTATTTACC
Microcebus_murinus|7042             ---------------------------------------------------GTACTTACC
Homo_sapiens|14404                  ------------------------------------------------CTGGTTCTTACG
Pan_troglodytes|5243                ctactgaaaggtggaacagagacaagcctatcaacacctacaagactggtgGTTCTTACG


Ochotona_princeps|15104             GGACTGAAA------------------------GAGACTCCGTCCCTCAGTAATCTACAT
Microcebus_murinus|7042             GAGTTGGAATTGAGGAACAGT------------------------------GATGCTCAG

                                                .  ..          ..       .*     . ***  :.  .* *. 

                                    ..*   ..  ..   ....*.   **     * ** ..******... **.** *  ** 

                                    ..    ** * * *  .  ..***.**  .**       ** ** * **..***      

Callithrix_jacchus|33180            ------------------------------------------------------------

Callithrix_jacchus|33180            ------------------------------------------------------------

Callithrix_jacchus|33180            ------------------------------------------------------------

Ochotona_princeps|15104             TCCAAGTATTGTCTTTTGTGGCTGCTTGTCCTT---------------TTACCGATTGCA
Callithrix_jacchus|33180            ------------------------------------------------------------
Dipodomys_ordii|14057               TCTAGATCCAGTTTACACTGGCTGTGGAGCCTC---------------CTCTTGATTCTG
Spermophilus_tridecemlineatus|15579 TTCAATTATAACTGGCTGTGGTTACTC---------------------CTGCTATTCCCA

Rattus_norvegicus|4386              CTATTTGTGTTC------------------------ATATATAAAAGGTACCGGAAGAGG
Tarsius_syrichta|6747               ATTGCTGCTTGG---------------GTGCTGAGAAAACATAAGAAGTGCAGCAATAAA
Ochotona_princeps|15104             GGTCTTGTTTGG---------------------GCAATATGCAAAAAGCGAAGAAAAGAA
Cavia_porcellus|5534                CAACTTTTATAC---------------------AAATACTGTAAGAAGCAACCAAGGGGG
Tupaia_belangeri|17632              GCAATAGCTTAC------------------------------------------------
Microcebus_murinus|7042             ATAATTGTTTGG---------------ACTGCAAATATACTGAAAAAGTGCTGCAATGAA
Callithrix_jacchus|33180            ------------------------------------------------------------
Dipodomys_ordii|14057               GTTACTGGGGGG------------------------GTGATAGCTGTATCACCGATGGCA

Tupaia_belangeri|17632              ------------------------------------------------------------
Callithrix_jacchus|33180            ------------------------------------------------------------

Tupaia_belangeri|17632              ------------------------------------------------------------
Callithrix_jacchus|33180            ------------------------------------------------------------

Tupaia_belangeri|17632              ------------------------------------------------------------
Callithrix_jacchus|33180            ------------------------------------------------------------

Tupaia_belangeri|17632              ------------------------------------------------------------
Callithrix_jacchus|33180            ------------------------------------------------------------

Tupaia_belangeri|17632              ------------------------------------------------------------
Callithrix_jacchus|33180            ------------------------------------------------------------

Tupaia_belangeri|17632              ------------------------------------------------------------
Callithrix_jacchus|33180            ------------------------------------------------------------
Dipodomys_ordii|14057               CTTGCAGAGAAAATTCAGGACATGGTC------------------------GACGATGCT

Mus_musculus|20033                  GGA------AATGAAAATGAAGGACAATGTCTGGAGTGA
Rattus_norvegicus|4386              AGA------AATGAAAATGAAGGACAAAGTCTGGAGTGA
Otolemur_garnettii|6683             ---------TCAGAAAATGAAACTGAAAGCTTGGTCTAG
Tupaia_belangeri|17632              ---------------------------------------
Microcebus_murinus|7042             ------------AAAAATGAAAGCCACCCCTTGTTCTAG
Callithrix_jacchus|33180            ---------------------------------------
Homo_sapiens|14404                  AAC------TTCAGAAATGAAATCCAAAGCTTGGTCTAG
Gorilla_gorilla|2512                AAC------TTCAGAAGTGAAATCCAAAGCTTGGTCTAG
Pan_troglodytes|5243                AAC------TTCAGAAATGAAATCCAAAGCTTGGTCTAG

multiple sequence alignment in CLUSTALW format

Mus_musculus|45425                  MLWI----WA---------------------------VLPLVLAGSQLRVHTQGTNSISE
Rattus_norvegicus|29517             V-------WILLCPP-------------------------LVLAGPELNVRMQGTDSISE
Otolemur_garnettii|5759             -------------------------------------ILTSIAGLTSKSVNARVTEINAG
Cavia_porcellus|4308                ----FIFSWTL--IPQ---------------------VFTFIPGPLSKTANARGIDTSSE
Microcebus_murinus|5984             -------------------------------------VLTFIAGLLSRTINAQITEINSK
Homo_sapiens|39000                  MLGI----WTL--LP---------------------LVLTSVARLSSKSVNAQVTDINSK
Dipodomys_ordii|13213               ----------SHKPGRHNQGLHDPNAETSKPIATRL-VLTFTVGSLSR-VTAQAIDTKS-

                                                                       *  :   .   . * .* **.** :

Callithrix_jacchus|25025            KSHFSSKCRRCRLCDEGH------------------------------------------
                                    . * : .** *  **  *                                          

Ochotona_princeps|13172             -HGIIEECTRTSNTKCK--VSKYCLLWLLVL-----LPIAGLVW-------AICKKRRKE
Tupaia_belangeri|15334              -HGIIEECTQTSNTKCKEQGSRSNLLWLLVLL----VLIPAIAY----------------
Callithrix_jacchus|25025            ------------------------------------------------------------
Dipodomys_ordii|13213               -HGIIEKCTPTSNTKCKNEISRSSLHWLWSL-----LLILVTGG--------VIAVSPMA

Tupaia_belangeri|15334              ------------------------------------------------------------
Callithrix_jacchus|25025            ------------------------------------------------------------

Tupaia_belangeri|15334              ------------------------------------------------------------
Callithrix_jacchus|25025            ------------------------------------------------------------

Mus_musculus|45425                  G--NENEGQCLE
Rattus_norvegicus|29517             R--NENEGQSLE
Tarsius_syrichta|6182               NFRNENESQSLV
Ochotona_princeps|13172             NIRDENEIQSLP
Otolemur_garnettii|5759             ---SENETESLV
Cavia_porcellus|4308                NSTSENERQSLA
Tupaia_belangeri|15334              ------------
Microcebus_murinus|5984             ----KNESHPLF
Callithrix_jacchus|25025            ------------
Homo_sapiens|39000                  N--FRNEIQSLV
Gorilla_gorilla|2389                N--FRSEIQSLV
Pan_troglodytes|19471               N--FRNEIQSLV
Dipodomys_ordii|13213               ENNFKNEQQSLA
Spermophilus_tridecemlineatus|13942 SCRSENERQSLA