Orthologs Set ID: EOG4003J2

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Callithrix jacchus 50023 29, 94, 203, 336, 477, 589
Cavia porcellus 20142 94, 203, 336, 477
Dipodomys ordii 10273 29, 94, 203, 336, 477, 583, 588, 605, 621
Gorilla gorilla 28419 29, 94, 203, 336, 477
Homo sapiens 35310 29, 94, 203, 336, 477, 589
Microcebus murinus 11484 29, 94, 203, 336, 477, 586
Mus musculus 7927 29, 94, 203, 336, 477
Ochotona princeps 12859 29, 94, 203, 336, 477, 586, 609, 624
Oryctolagus cuniculus 11838 29, 94, 203, 336, 477
Otolemur garnettii 6357 29, 94, 203, 336, 477, 586, 603
Pan troglodytes 15535 29, 94, 203, 336, 477, 586
Rattus norvegicus 7273 29, 94, 203, 336, 477
Spermophilus tridecemlineatus 16069 29, 94, 179, 203
Tarsius syrichta 4713 29, 94, 203, 336, 477
Tupaia belangeri 1588 29, 94, 203, 336, 477, 595, 600

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 50023 ENSCJAT00000039358 100388188 ENSCJAG00000020030 calJac3
Cavia porcellus 20142 ENSCPOT00000004356 100734331 ENSCPOG00000004310 cavPor3
Dipodomys ordii 10273 ENSDORT00000001596 ENSDORG00000001596 Gosr2 dipOrd1
Gorilla gorilla 28419 ENSGGOT00000031205 101134453 ENSGGOG00000001255 gorGor3
Homo sapiens 35310 ENST00000439730 9570 ENSG00000108433 GOSR2 hg19,GRCh37
Microcebus murinus 11484 ENSMICT00000010685 ENSMICG00000010683 micMur1
Mus musculus 7927 ENSMUST00000021329 56494 ENSMUSG00000020946 Gosr2 mm9
Ochotona princeps 12859 ENSOPRT00000015630 101519222 ENSOPRG00000015635 OchPri2.0
Oryctolagus cuniculus 11838 ENSOCUT00000003118 100342992 ENSOCUG00000003119 oryCun2.0
Otolemur garnettii 6357 ENSOGAT00000006126 100955118 ENSOGAG00000006123 GOSR2 otoGar1
Pan troglodytes 15535 ENSPTRT00000017126 ENSPTRG00000009323 panTro2
Rattus norvegicus 7273 ENSRNOT00000005046, NM_031685 64154 ENSRNOG00000003506 Gosr2 rn4
Spermophilus tridecemlineatus 16069 ENSSTOT00000016071 101960103 ENSSTOG00000016069 Gosr2 speTri1
Tarsius syrichta 4713 ENSTSYT00000004418 ENSTSYG00000004441 tarSyr1
Tupaia belangeri 1588 ENSTBET00000001589 ENSTBEG00000001598 tupBel1

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 41075 ENSCJAP00000037260 100388188 ENSCJAG00000020030 calJac3
Cavia porcellus 15862 ENSCPOP00000003887 100734331 ENSCPOG00000004310 cavPor3
Dipodomys ordii 9642 ENSDORP00000001493 ENSDORG00000001596 Gosr2 dipOrd1
Gorilla gorilla 22060 ENSGGOP00000020798 101134453 ENSGGOG00000001255 gorGor3
Homo sapiens 35953 ENSP00000390577 9570 ENSG00000108433 GOSR2 hg19,GRCh37
Microcebus murinus 9733 ENSMICP00000009737 ENSMICG00000010683 micMur1
Mus musculus 15535 ENSMUSP00000021329 56494 ENSMUSG00000020946 Gosr2 mm9
Ochotona princeps 11218 ENSOPRP00000014279 101519222 ENSOPRG00000015635 OchPri2.0
Oryctolagus cuniculus 11586 ENSOCUP00000002707 100342992 ENSOCUG00000003119 oryCun2.0
Otolemur garnettii 5469 ENSOGAP00000005470 100955118 ENSOGAG00000006123 GOSR2 otoGar1
Pan troglodytes 10534 ENSPTRP00000015853 ENSPTRG00000009323 panTro2
Rattus norvegicus 19801 ENSRNOP00000005046 64154 ENSRNOG00000003506 Gosr2 rn4
Spermophilus tridecemlineatus 14382 ENSSTOP00000014383 101960103 ENSSTOG00000016069 Gosr2 speTri1
Tarsius syrichta 4318 ENSTSYP00000004045 ENSTSYG00000004441 tarSyr1
Tupaia belangeri 1388 ENSTBEP00000001380 ENSTBEG00000001598 tupBel1

multiple sequence alignment in CLUSTALW format

                                          .* **     .. ..:*  . *..  ...    . . .   .. .    .... 

Dipodomys_ordii|10273               CGCCTGGAGACGGCAGACAAGCAGTCTGTACACTGGCTGGGA------------------
                                     .  ******  **.********* *  *.***    *.*.*                  

Dipodomys_ordii|10273               ------------------------------------------------------------

                                    ** *..**.**.** ** *.*** ** ** **.*** *.**.** ** *  *.***  **

                                    **.** ** ** .* *:*** ***** *. *** . *  .. **. *.**.** **.***

Spermophilus_tridecemlineatus|16069 CGAGAGGAGCTTCTGTCTCGTACCTTCACCACTAAT------------------------
                                    ***** **.**  *.** ** :* ** ** .* **                         

Spermophilus_tridecemlineatus|16069 ------------------------------------------------------------

Spermophilus_tridecemlineatus|16069 ------------------------------------------------------------

Spermophilus_tridecemlineatus|16069 ------------------------------------------------------------

Tarsius_syrichta|4713               CTGGTCGAGAAGCGGGCCTTCCAGGATAAGTACTTCATGGTG------------------
Homo_sapiens|35310                  CTCATCGAGAAGCGGGCTTTCCAGGACAAGTACTTTATGATA------Gaaacggggttt
Ochotona_princeps|12859             CTGATCGAGAAGCGGGCCTTCCAGGACAAGTACTTCATGCTC---GGT------------
Spermophilus_tridecemlineatus|16069 ------------------------------------------------------------

Tarsius_syrichta|4713               ------------------------------------------------------------
Homo_sapiens|35310                  ctccatgttgggcaggctggtctcgaactcctgacttcaggtgatccacccacctcggcc
Tupaia_belangeri|1588               GGATCACACGAGCACACTGGAGAGAGATGTGCAAGGAGCAGC------------------
Ochotona_princeps|12859             ------GCCGGATTCCAGCAAACACAATATGTGAAGAACACT------------------
Gorilla_gorilla|28419               TGTGTGGTCATGTTCCTCGTGGTGCAGTACCTGACA------------------------
Cavia_porcellus|20142               TGTGTAGTCATGTTCCTTGTGGTTCAGTACCTGACA------------------------
Dipodomys_ordii|10273               TGCCAGGCAGCACACTTTGGAAGC------------------------------------
Pan_troglodytes|15535               TGCCAGACAGCACACTTTGGAGGAAGGTCTGCAGGGAGCAGC------------------
Oryctolagus_cuniculus|11838         TGTGTGGTCATGTTCCTCGTGGTGCAGTACCTGACG------------------------
Microcebus_murinus|11484            TGCCAGACAGCACACTTTGGAGGAAAGTATGCAAGGAGCAGCTGT---------------
Otolemur_garnettii|6357             TGCGCGGTA---CACTTTGGAGGAAGGTATTCAAGGAGCAGC------------------
Spermophilus_tridecemlineatus|16069 ------------------------------------------------------------
Mus_musculus|7927                   TGTGCAGTCATGTTCCTCGTGGTACAGTACCTGACA------------------------
Rattus_norvegicus|7273              TGTGCAGTTATGTTTCTCGTGGTGCAGTACCTGACA------------------------

Tarsius_syrichta|4713               ---------------------------------------------
Homo_sapiens|35310                  tcccaaagtgctgggattactggcataagccaccgcagccgg---
Tupaia_belangeri|1588               ------------------------------------------TGA
Ochotona_princeps|12859             ------------------------------------------TGA
Gorilla_gorilla|28419               ------------------------------------------TGA
Cavia_porcellus|20142               ------------------------------------------TGA
Dipodomys_ordii|10273               ------------------------------------------TGA
Callithrix_jacchus|50023            TCCCAAAGTGCTGGGGTTACAGGCGTGAACCAC------------
Pan_troglodytes|15535               ------------------------------------------TGA
Oryctolagus_cuniculus|11838         ------------------------------------------TGA
Microcebus_murinus|11484            ---------------------------------------------
Otolemur_garnettii|6357             ------------------------------------------TGA
Spermophilus_tridecemlineatus|16069 ---------------------------------------------
Mus_musculus|7927                   ------------------------------------------TGA
Rattus_norvegicus|7273              ------------------------------------------TGA

multiple sequence alignment in CLUSTALW format

Dipodomys_ordii|9642                MEPLYQQTHKQVHEIQSHMGRLETADKQSVHWLG--------------------------
                                      .* ..:              * ****::* :                           

                                    *:****:***:*****.:******  **::* ..*:*:***:**:**:**:*        

Spermophilus_tridecemlineatus|14382 ------------------------------------------------------------

Tarsius_syrichta|4318               LVEKRAFQDKYFMV----------------------------------------
Tupaia_belangeri|1388               LIEKRAFQDKYFMI----GTGSHEHTGERCARSS--------------------
Ochotona_princeps|11218             LIEKRAFQDKYFML-G------AGFQQTQYVKNT--------------------
Gorilla_gorilla|22060               LIEKRAFQDKYFMIGGMLLTCVVMFLVVQYLT----------------------
Cavia_porcellus|15862               LIEKRAFQDKYLMIGGMLLTCVVMFLVVQYLT----------------------
Dipodomys_ordii|9642                LIEKRAFQDKYLMIGSE--SCQAAHFGS--------------------------
Pan_troglodytes|10534               LIEKRAFQDKYFMI-GTQGSCQTAHFGGRSAGSS--------------------
Oryctolagus_cuniculus|11586         LIEKRAFQDKYFMIGGMLLTCVVMFLVVQYLT----------------------
Microcebus_murinus|9733             LIEKRAFQDKYFMI-GTRGSCQTAHFGGKYARSSC-------------------
Otolemur_garnettii|5469             LIEKRAFQDKYLMI-DTQGSCAV-HFGGRYSRSS--------------------
Spermophilus_tridecemlineatus|14382 ------------------------------------------------------
Mus_musculus|15535                  LIEKRAFQDKYFMIGGMLLTCAVMFLVVQYLT----------------------
Rattus_norvegicus|19801             LIEKRAFQDKYFMIGGMLLTCAVMFLVVQYLT----------------------