Orthologs Set ID: EOG4003J7

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Callithrix jacchus 39492 131, 240
Cavia porcellus 19316 131, 240
Gorilla gorilla 34120
Homo sapiens 69836 131, 240
Microcebus murinus 7893 131, 240
Mus musculus 18890 131, 240
Ochotona princeps 2070 131, 240
Pan troglodytes 29947 131, 240
Rattus norvegicus 16319 131, 240
Spermophilus tridecemlineatus 2036 240
Tupaia belangeri 11606 131, 240

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 39492 ENSCJAT00000021580 100400714 ENSCJAG00000011071 TEX43 calJac3
Cavia porcellus 19316 ENSCPOT00000013250 100731684 ENSCPOG00000013123 TEX43 cavPor3
Gorilla gorilla 34120 ENSGGOT00000012234 ENSGGOG00000012192 TEX43 gorGor3
Homo sapiens 69836 ENST00000357147 389320 ENSG00000196900 TEX43 hg19,GRCh37
Microcebus murinus 7893 ENSMICT00000007333 ENSMICG00000007335 TEX43 micMur1
Mus musculus 18890 ENSMUST00000035640, NM_026099 67343 ENSMUSG00000032900 Tex43 mm9
Ochotona princeps 2070 ENSOPRT00000008174 101518704 ENSOPRG00000008188 TEX43 OchPri2.0
Pan troglodytes 29947 ENSPTRT00000042928 741972 ENSPTRG00000022761 TEX43 panTro2
Rattus norvegicus 16319 ENSRNOT00000039486, NM_001109126 498870 ENSRNOG00000023034 Tex43 rn4
Spermophilus tridecemlineatus 2036 ENSSTOT00000002036 speTri1
Tupaia belangeri 11606 ENSTBET00000011607 ENSTBEG00000011617 TEX43 tupBel1

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 31036 ENSCJAP00000020425 100400714 ENSCJAG00000011071 TEX43 calJac3
Cavia porcellus 15214 ENSCPOP00000011813 100731684 ENSCPOG00000013123 TEX43 cavPor3
Gorilla gorilla 26262 ENSGGOP00000011893 ENSGGOG00000012192 TEX43 gorGor3
Homo sapiens 8044 ENSP00000349669 389320 ENSG00000196900 TEX43 hg19,GRCh37
Microcebus murinus 6673 ENSMICP00000006673 ENSMICG00000007335 TEX43 micMur1
Mus musculus 51913 ENSMUSP00000038152 67343 ENSMUSG00000032900 Tex43 mm9
Ochotona princeps 1811 ENSOPRP00000007477 101518704 ENSOPRG00000008188 TEX43 OchPri2.0
Pan troglodytes 17554 ENSPTRP00000040830 741972 ENSPTRG00000022761 TEX43 panTro2
Rattus norvegicus 2452 ENSRNOP00000033394 498870 ENSRNOG00000023034 Tex43 rn4
Spermophilus tridecemlineatus 1817 ENSSTOP00000001813 speTri1
Tupaia belangeri 10042 ENSTBEP00000010029 ENSTBEG00000011617 TEX43 tupBel1

multiple sequence alignment in CLUSTALW format

Mus_musculus|18890                 ------------------------ATGGCTTCAGAAAAAGATGACGGTCCGGCCTTACCC
Rattus_norvegicus|16319            ATGGCTTctgaaaaagatgctgaaaaagatgctgaaaaagatgcCGTTCCTGCCTTACCC
Cavia_porcellus|19316              ------------------------ATGGCTTCGGGAAAAGACACTTGCCCTCCCTTCCCT
Ochotona_princeps|2070             ---------------------------GCTGCAGGAAAAGACACTCGTCTACTCTTTCCT
Spermophilus_tridecemlineatus|2036 ------------------------------------------------------------
Tupaia_belangeri|11606             ------------------------ATGGCCTCCGGGAAAGACACTTGTCCTACCTTACCG
Callithrix_jacchus|39492           ------------------------ATGGCTTCAGGGAGAGATACTTGCCCTACTTTGCCT
Microcebus_murinus|7893            ------------------------ATGGCTTCAGGAAAAGACACTTGTCCTACCTTACCT
Gorilla_gorilla|34120              ------------------------------------------------------------
Homo_sapiens|69836                 ------------------------ATGGCTTCAGGGAAAGATACTTGTCCTACTTTGCCT
Pan_troglodytes|29947              ------------------------ATGGCTTCAGGGAAAGATACTTGTCCTACTTTGCCT

Rattus_norvegicus|16319            AAACTC---AACAACAACCAAACAGCGGAGAACACAACCAAGCCtgttaaagaccagcct
Spermophilus_tridecemlineatus|2036 ------------------------------------------------------------
Gorilla_gorilla|34120              ------------------------------------------------------------

Gorilla_gorilla|34120              ------------------------------------------------------------

Gorilla_gorilla|34120              ------------------------------------------------------------

                                   .: **..* .  *  **.*** * .  ** **  *.**.** ***** **   *..  .*

                                   ** **..********** ** **.** *. . ..  .** * ...**..  *  ** **.

                                   **:**.** .* ** .***** **** **.** ***** *.******.** ** **.** 

Mus_musculus|18890                 TCCCACGGTTTCCGGAGGCGACTGATCTGA
Rattus_norvegicus|16319            TCCCACGGCTTCAGGAGGCGACTGATCTGA
Cavia_porcellus|19316              TCTCACGGCTTCAGGAGGCGGCTGGTCTGA
Ochotona_princeps|2070             TCCCACGGCTTCCGGAGGAGACTTGTCTGA
Spermophilus_tridecemlineatus|2036 TCCCATGGCTTTAGAAGGCGACTAGTCTGA
Tupaia_belangeri|11606             TCCCACGGCTTCCGGAGGCGCCTGGTCTGA
Callithrix_jacchus|39492           TCCCATGGCTTCAGGAGACAACTAGTCTGA
Microcebus_murinus|7893            TCCCACGGCTTCAGGAGGCGGCTGGTCTGA
Gorilla_gorilla|34120              TCCCATGGCTTCAGGAGGCGACTAGTCTGA
Homo_sapiens|69836                 TCCCATGGCTTCAGGAGGCGACTAGTCTAA
Pan_troglodytes|29947              TCCCATGGCTTCAGGAGGCGACTAGTCTGA
                                   ** ** ** ** .*.**... ** .***.*

multiple sequence alignment in CLUSTALW format

Cavia_porcellus|15214              --------MASGKDTCPPFPKL-ANNCSDENSHKPAN------KYEEIHLPRFSLRQGMI
Ochotona_princeps|1811             ---------AAGKDTRLLFPKL-TNNYSDESCCRPVT------KYKDIHLPRFSLKQGLI
Spermophilus_tridecemlineatus|1817 --------------------------------------------YDEIHLPRFSLKQGMI
Tupaia_belangeri|10042             --------MASGKDTCPTLPKL-ATTCSAENSNKPVT------RYEAIHLPRFSLKQGMI
Callithrix_jacchus|31036           --------MASGRDTCPTLPKI-TNNCSDESPYKPAN------KYEEIHLPRFSLKQGMI
Microcebus_murinus|6673            --------MASGKDTCPTLPKL-ANNCCDENFYKPAN------KYDEIHLPRFSLKQGMI
Gorilla_gorilla|26262              ------------------------------------------------------------
Homo_sapiens|8044                  --------MASGKDTCPTLPKL-TNNCSDESLYKSAN------KYEEIHLPRFSLKQGMI
Pan_troglodytes|17554              --------MASGKDTCPTLPKL-TNNCSDESLYKSAN------KYEEIHLPRFSLKQGMI

Gorilla_gorilla|26262              --------------------QAEVCGIHTGPLEDSLFLNHSERLCHGEDRKVVFQKGPPE
                                                        *. .**::****:*** .  ********:  :::*  **

Mus_musculus|51913                 IKITDMPLHSPLSRYQSTVISHGFRRRLI
Rattus_norvegicus|2452             IKIADMPLHSPLSRYQSTVISHGFRRRLI
Cavia_porcellus|15214              IKIADMPLHSPLSRYQSTVISHGFRRRLV
Ochotona_princeps|1811             IKIADLPLHSPLSRYQSTVISHGFRRRLV
Spermophilus_tridecemlineatus|1817 IKITDMPLHSPLSKYQSTVISHGFRRRLV
Tupaia_belangeri|10042             IKIADMPLHSPLSKYQSTVISHGFRRRLV
Callithrix_jacchus|31036           IKIADMPLHSPLSRYQSTVISHGFRRQLV
Microcebus_murinus|6673            IKIADMPLHSPLSRYQSTVISHGFRRRLV
Gorilla_gorilla|26262              IKIADMPLHSPLSRYQSTVISHGFRRRLV
Homo_sapiens|8044                  IKIADMPLHSPLSRYQSTVISHGFRRRLV
Pan_troglodytes|17554              IKIADMPLHSPLSRYQSTVISHGFRRRLV