Orthologs Set ID: EOG4003JB

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Callithrix jacchus 15887 212, 241, 265, 281
Gorilla gorilla 1901 108, 225, 281
Homo sapiens 84904 108, 281
Microcebus murinus 6997 147, 167, 222, 252, 281, 297
Otolemur garnettii 7222 147, 166, 234, 279, 282
Pan troglodytes 33749 108, 281
Spermophilus tridecemlineatus 5437 147, 167, 240, 276, 281, 330
Tarsius syrichta 13024 147, 164, 252, 281, 315

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 15887 ENSCJAT00000028695 ENSCJAG00000014746 calJac3
Gorilla gorilla 1901 ENSGGOT00000032311 ENSGGOG00000028349 gorGor3
Homo sapiens 84904 ENST00000258776, NM_025031 80099 ENSG00000136275 C7orf69 hg19,GRCh37
Microcebus murinus 6997 ENSMICT00000006506 ENSMICG00000006506 micMur1
Otolemur garnettii 7222 ENSOGAT00000006961 ENSOGAG00000006960 otoGar1
Pan troglodytes 33749 ENSPTRT00000035435 ENSPTRG00000019173 panTro2
Spermophilus tridecemlineatus 5437 ENSSTOT00000005438 speTri1
Tarsius syrichta 13024 ENSTSYT00000003811 103265280 ENSTSYG00000003811 tarSyr1

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 8514 ENSCJAP00000027142 ENSCJAG00000014746 calJac3
Gorilla gorilla 1805 ENSGGOP00000028142 ENSGGOG00000028349 gorGor3
Homo sapiens 61578 ENSP00000258776 80099 ENSG00000136275 C7orf69 hg19,GRCh37
Microcebus murinus 5944 ENSMICP00000005946 ENSMICG00000006506 micMur1
Otolemur garnettii 6228 ENSOGAP00000006226 ENSOGAG00000006960 otoGar1
Pan troglodytes 15564 ENSPTRP00000032760 ENSPTRG00000019173 panTro2
Spermophilus tridecemlineatus 4875 ENSSTOP00000004866 speTri1
Tarsius syrichta 11952 ENSTSYP00000003486 103265280 ENSTSYG00000003811 tarSyr1

multiple sequence alignment in CLUSTALW format

Spermophilus_tridecemlineatus|5437 ------------------------------------------------------------
Otolemur_garnettii|7222            ------------------------------------------------------------
Microcebus_murinus|6997            ------------------------------------------------------------
Tarsius_syrichta|13024             ------------------------------------------------------------
Callithrix_jacchus|15887           ------------------------------------------------------------
Homo_sapiens|84904                 atgggtttccacttttgcatctggatcatttttctcttgccaccaccatgtaagaagtgc
Pan_troglodytes|33749              acgggttcccacttttgcatctggatcatttttctcttgccaccaccatgtaagaagtgc

Spermophilus_tridecemlineatus|5437 ------------------------------------------------GCTGCCTGTTGG
Otolemur_garnettii|7222            ------------------------------------------------GCCTTTCACTGG
Microcebus_murinus|6997            ------------------------------------------------------------
Tarsius_syrichta|13024             ------------------------------------------------GTTTGTTATTGG
Callithrix_jacchus|15887           ------------------------------------------------GTCTTTTACTAT
Homo_sapiens|84904                 ctttcacctcccaccatgaacctgaggcctcccaagtcatgtggaaatGTCTTTTATTGG
Pan_troglodytes|33749              ctttcacctcccaccatgaatctgaggcctcccgagtcatgtggaaatGTCTTTTATTGG

                                      ***.**** ::**    . * **    **   * * **.*  * **** .** ***.

                                   *.*****.. . .*.*     . : *..*** .  *..:*.. .    *....* .  . 

Spermophilus_tridecemlineatus|5437 ATG------------------------------GGAATAAACGCCACCTACTGGCATATT
Otolemur_garnettii|7222            GAG------------------------------GCAGAAGACACCACCTACTGGCACAAA
                                   .:.                              * .  ...*.******** * **    

                                    *.***:  *.*.*.   ..****   .**      ***.  .. ....*:**  ***  

Spermophilus_tridecemlineatus|5437 TTTTGCAAG---TGA
Otolemur_garnettii|7222            GTTTGCAAACAG---
Microcebus_murinus|6997            TTTTGCAAACAG---
Tarsius_syrichta|13024             TTTTGCAAACAG---
Callithrix_jacchus|15887           TTTCACAAA---TGA
Gorilla_gorilla|1901               TTTCACAAA---TGA
Homo_sapiens|84904                 TTTCACAAA---TGA
Pan_troglodytes|33749              TTTCACAAA---TGA
                                    ** .***.      

multiple sequence alignment in CLUSTALW format

Spermophilus_tridecemlineatus|4875 ------------------------------------AACWVLILYFPLL-NFGQIIKHRA
Otolemur_garnettii|6228            ------------------------------------AFHWVLVLNSTLL-KLGQTIKCTA
Microcebus_murinus|5944            -----------------------------------------LVLNSVLL-KLGQTTKRRA
Tarsius_syrichta|11952             ------------------------------------VCYWVLILNSGVL-NSGQTIKCRA
Callithrix_jacchus|8514            ------------------------------------VFYYVLVLISRLLYKSCQTIKCRA
                                                                            *:*   :* :  *  *  *

                                   .*: :   .   .    :             . .:** * **  .  * :  * . ::  

Spermophilus_tridecemlineatus|4875 FCK-
Otolemur_garnettii|6228            VCKQ
Microcebus_murinus|5944            FCKQ
Tarsius_syrichta|11952             FCKQ
Callithrix_jacchus|8514            FHK-
Gorilla_gorilla|1805               FHK-
Homo_sapiens|61578                 FHK-
Pan_troglodytes|15564              FHK-
                                   . *