Orthologs Set ID: EOG4003JC

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Callithrix jacchus 25949
Dipodomys ordii 6077 149
Gorilla gorilla 8633
Homo sapiens 99311
Microcebus murinus 3259
Mus musculus 47910
Ochotona princeps 4901
Oryctolagus cuniculus 27921
Otolemur garnettii 12326
Pan troglodytes 39371
Rattus norvegicus 37715
Tarsius syrichta 3993
Tupaia belangeri 4200

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 25949 ENSCJAT00000061641 100392552 ENSCJAG00000003401 TCEAL1 calJac3
Dipodomys ordii 6077 ENSDORT00000007208 ENSDORG00000007209 Tceal1 dipOrd1
Gorilla gorilla 8633 ENSGGOT00000031990 101132699 ENSGGOG00000012344 TCEAL1 gorGor3
Homo sapiens 99311 ENST00000372626, NM_001006640 9338 ENSG00000172465 TCEAL1 hg19,GRCh37
Microcebus murinus 3259 ENSMICT00000003038 ENSMICG00000003041 TCEAL1 micMur1
Mus musculus 47910 ENSMUST00000055104 237052 ENSMUSG00000049536 mm9
Ochotona princeps 4901 ENSOPRT00000001661 101522228 ENSOPRG00000001675 TCEAL1 OchPri2.0
Oryctolagus cuniculus 27921 ENSOCUT00000000550 100347186 ENSOCUG00000000553 TCEAL1 oryCun2.0
Otolemur garnettii 12326 ENSOGAT00000011848 100961080 ENSOGAG00000011846 TCEAL1 otoGar1
Pan troglodytes 39371 ENSPTRT00000041210, NM_001006639 473710 ENSPTRG00000022130 TCEAL1 panTro2
Rattus norvegicus 37715 ENSRNOT00000044372, NM_001009675 302593 ENSRNOG00000002387 Tceal1 rn4
Tarsius syrichta 3993 ENSTSYT00000001177 103263593 ENSTSYG00000001178 TCEAL1 tarSyr1
Tupaia belangeri 4200 ENSTBET00000004201 ENSTBEG00000004218 TCEAL1 tupBel1

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Callithrix jacchus 18088 ENSCJAP00000051076 100392552 ENSCJAG00000003401 TCEAL1 calJac3
Dipodomys ordii 5700 ENSDORP00000006759 ENSDORG00000007209 Tceal1 dipOrd1
Gorilla gorilla 7449 ENSGGOP00000019189 101132699 ENSGGOG00000012344 TCEAL1 gorGor3
Homo sapiens 6596 ENSP00000361709 hg19,GRCh37
Microcebus murinus 2766 ENSMICP00000002764 ENSMICG00000003041 TCEAL1 micMur1
Mus musculus 32100 ENSMUSP00000061875 237052 ENSMUSG00000049536 mm9
Ochotona princeps 4252 ENSOPRP00000001532 101522228 ENSOPRG00000001675 TCEAL1 OchPri2.0
Oryctolagus cuniculus 12420 ENSOCUP00000000475 100347186 ENSOCUG00000000553 TCEAL1 oryCun2.0
Otolemur garnettii 10599 ENSOGAP00000010600 100961080 ENSOGAG00000011846 TCEAL1 otoGar1
Pan troglodytes 32959 ENSPTRP00000059253 473710 ENSPTRG00000022130 TCEAL1 panTro2
Rattus norvegicus 17189 ENSRNOP00000049958 302593 ENSRNOG00000002387 Tceal1 rn4
Tarsius syrichta 3662 ENSTSYP00000001089 103263593 ENSTSYG00000001178 TCEAL1 tarSyr1
Tupaia belangeri 3655 ENSTBEP00000003638 ENSTBEG00000004218 TCEAL1 tupBel1

multiple sequence alignment in CLUSTALW format

                            *****.**  *.  *  :*..*. .*.**.    *   *** .  *  . *   .* *:.

                            *.* .**** * . .****.    *  *..*. ...      ** **  .          

                                     :* ** **.**  . *****    ** *********** ** **.*** * 

                             * ** *****  * ** ***.****  * *   .  * ** ** * .*.. *.   ** 

                             *    ***..   * * **. . ** . ************.***** ** ** .* **.

                            **.** ***** **.**.**.** ** **.**.**. **** ** :  ***** **.** 

                            * ***.***** ** ***.****  ***  ** **.**.*****.*..** ** ** ** 

Otolemur_garnettii|12326    CTAGAAGAA---------------------------------------------------

Dipodomys_ordii|6077        AGCCGTCCATACCCCATTTAA
Mus_musculus|47910          AGCCGCCCTTACCCTATTTAA
Rattus_norvegicus|37715     AGCCGTCCTTACCCTATTTAA
Tupaia_belangeri|4200       AGCAGGCCTTATCCTATTTGA
Callithrix_jacchus|25949    AGCCGTCCTTATCCTATTTAA
Gorilla_gorilla|8633        AGCCGTCCTTATCCTATTTAA
Homo_sapiens|99311          AGccgtccttatcctatttaa
Pan_troglodytes|39371       AGccgtccttatcctatttaa
Otolemur_garnettii|12326    ---------------------
Tarsius_syrichta|3993       AGCCGTCCTTATCCTATTTAA
Microcebus_murinus|3259     AGCCGTCCTTACCCTATTTAA
Ochotona_princeps|4901      AGCCGCCCCTACCCCATTTAA
Oryctolagus_cuniculus|27921 AGCCGTCCTTATCCAATTTAA

multiple sequence alignment in CLUSTALW format

                            *::.   .:* . *.   :  .*. *    .   ::       :**: ** :*******:

                            *******:**. :** :: *. *  :* * ********:**************** ****

Otolemur_garnettii|10599    RGDIHGRNLSNEEMIQAADDLEE-----------------------