Orthologs Set ID: EOG4006BK

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Drosophila melanogaster 19907 133
Drosophila yakuba 10925 133

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Drosophila melanogaster 19907 FBtr0070550, NM_166957 31280 FBgn0052793 CG32793 dm3
Drosophila yakuba 10925 FBtr0262805 6524346 FBgn0233823 GE16287 droYak2

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Drosophila melanogaster 18390 FBpp0070525 31280 FBgn0052793 CG32793 dm3
Drosophila yakuba 6659 FBpp0261297 6524346 FBgn0233823 GE16287 droYak2

multiple sequence alignment in CLUSTALW format

                              ******************************************** ***** *********


                              *************. *********************** ******************.**

                              *******:**** ************* *****************:*.*************

                              ************** *********************************************

                              ***********.** ************      ******** .**************** 

                              ********.********.************************** *********** ***

                              **.** ******** ***************** ***********.***************

                               **********************************.*****.***** *****.** **.

                              **.************** ******** ***********.**************.******

Drosophila_melanogaster|19907 GGCAACCGCAATGGAAACCGC------------------------AATGGCAATGGAAAC
                              ********************.                        ***************

                              ***** ** ****** ******************* *****:************** ***

                              ******************** ***** ** ******************************

                              ***** ***************************************** *********** 

                              *** *******************.**.***************************.*****


                              ********.***************** *********************************

Drosophila_melanogaster|19907 tcacaggatgaggaggaattggacgatgatgagaacgagaacgacgatgaggaggaggaa
                              **.**************.***** *****       ******** *********** ***

Drosophila_melanogaster|19907 gagcaggtccaggaggacgaCAGCCAAGAGCAGGACTTTCAGCCGGAGCCGATCTATGGC
                              ******** *****************.*********** ***** **********: ** 

                              *****************************.*********** ************** ***


                              *.***  ***.*.*.*****.***:*.************** ***************** 

                              ******** *****.*****************.***************** *********

                              *****.**.******************** **************************.***



                              *****..**** ***********.*********** ************************

                              ************** ******.* ***************** *****.*****.***** 

                              **************.************** ***** ********.***************

                              ****************************.***:*** *.***************** **.

                              ** ******************** *********************** **** ******:

                              ***** ********.*****************************.********.** ***

                              .*******.:*******************.*.***.** .*******.******.*****

                              ****************** **.* **.**** ********. ******************

                              *****************************.**.***** ******** ************

                              ** ***************************** ***** *** * ********.** ***

                              ** ********************** ******* ****.*****:* **** ***.****

Drosophila_melanogaster|19907 GCCCCCAAGGGAGACTTGCagaaggaggagaagccaaaggaggaggagcagaaggagaag
                              ********.*****.* *************.: **.******.**************.**

Drosophila_melanogaster|19907 cttccaaaggaggaagttcagctagaggagattaagaaggaggagccccagaaggaggag
                              *****.***.*.***** *** ***************.*********************.

Drosophila_melanogaster|19907 ctccagaaggaggagccacaaaaggaggagccccagaaggaggagccacgaaaggaggag
                              .:*.* *** **.****.**.** ******..*.* ******.****.*.**..******


Drosophila_melanogaster|19907 CCCAAAGTGGAAACCCCACAG---------------------------CCTCTGGAGCAG
                              ***.*..:****.. .*.***                           ..: ****..* 

Drosophila_melanogaster|19907 TCAAAACTGCCAGCCTAA
Drosophila_yakuba|10925       CCACAGCTGGCAGCATAA
                               **.*.*** ****.***

multiple sequence alignment in CLUSTALW format

                              ****************:*************************** **************:

                              ** *.***:****** *********************************  ***.*****


                              ***************************        *************************


                              ************:**********************************:**  ******:*






                              ******::** **.****************************************:*****

                              ********:**:*** *: *****: **** ***:****:***:***:****.*******

                               :*::**:** :**:*:.*************** ** ****: * .*          :*:

Drosophila_melanogaster|18390 SKLPA
Drosophila_yakuba|6659        PQLAA