Orthologs Set ID: EOG4006BP

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Anolis carolinensis 3998 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138
Apis mellifera 29709 55
Bombyx mori 7387
Bos taurus 22032 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Branchiostoma floridae 33431 1733, 1888, 2031, 2308, 2553, 3035
Branchiostoma floridae 38285 37, 274, 457, 875, 1042, 1215, 1321, 1470, 1672, 1733, 1888, 2031, 2308, 2553, 2964
Caenorhabditis elegans 9599 144, 1079, 1572, 1882
Callithrix jacchus 7966 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Canis familiaris 15952 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454, 2572
Cavia porcellus 12012 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Choloepus hoffmanni 2463 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Culex quinquefasciatus 8590 1733
Danio rerio 22894 34, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1737, 1745, 1888, 2138, 2454
Dasypus novemcinctus 7738 37, 274, 457, 564, 1042, 1215, 1248, 1321, 1470, 1591, 1733
Dipodomys ordii 16649 274, 457, 564, 1042, 1215, 1321, 1401, 1470, 1591, 1733, 1888, 2138, 2454
Echinops telfairi 18862 274, 326, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Echinops telfairi 19173 114, 1021, 1080, 1108, 1113, 1130, 1215, 1926, 2076, 2304, 2379
Equus caballus 23003 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Erinaceus europaeus 12349 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888
Felis catus 36592 37, 274, 457, 519, 1470, 1515, 1536, 1560, 1591, 1593, 1608, 1733, 1821, 1831, 1888, 1941, 1953, 2138
Fugu rubripes 46645 1374, 1591, 1733, 2138, 2457
Fugu rubripes 46726 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138
Gallus gallus 1176 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Gasterosteus aculeatus 8508 37, 256, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138
Gorilla gorilla 11787 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Homo sapiens 20815 35, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Ixodes scapularis 18877
Linepithema humile 1088 55
Loxodonta africana 9089 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Macropus eugenii 9309 524, 557, 564, 576, 884, 918, 940, 981, 1012, 1042, 1215, 1321, 1470, 1524, 1591, 1733, 1888, 2138
Microcebus murinus 2859 37, 274, 457, 564, 1042, 1045, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Monodelphis domestica 30602 274, 457, 564, 1042, 1230, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Mus musculus 37053 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Myotis lucifugus 5822 37, 274, 457, 564, 1042, 1185, 1215, 1321, 1357, 1470, 1591, 1733, 1888, 2138, 2454
Nasonia vitripennis 10339 55, 1295
Nematostella vectensis 3863 970, 1215, 1470, 1681, 1897
Ochotona princeps 8552 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138
Ornithorhynchus anatinus 6525 457, 917, 992, 1031, 1032, 1314, 1470
Ornithorhynchus anatinus 6616 564, 1002, 1051, 1085, 1096, 1123, 1159, 1321, 1470, 1591, 1733, 1977, 2096, 2118
Oryzias latipes 13656 274, 454, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138
Otolemur garnettii 4925 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454, 3350
Pan troglodytes 9474 35, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Pediculus humanus 9206 597, 1122, 1516, 1662, 1934, 2285
Pogonomyrmex barbatus 4791 55, 2294
Pongo abelii 6151 37, 274, 378, 457, 564, 1042, 1215, 1321, 1332, 1470, 1591, 1733, 1888, 2138, 2454
Procavia capensis 16727 564, 578, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 1950, 2138, 2454
Pteropus vampyrus 17753 37, 156, 174, 207, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2076, 2138, 2454
Rattus norvegicus 26410 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2445, 2454, 2563
Rhesus macaque 7159 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Sorex araneus 4441 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Spermophilus tridecemlineatus 6326 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138
Sus scrofa 14768 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Tarsius syrichta 6032 37, 274, 457, 501, 510, 513, 543, 564, 1042, 1071, 1134, 1149, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Tetraodon nigroviridis 17973 274, 457, 564, 1042, 1215, 1321, 1470, 1588, 1739, 1888, 2138, 2457
Tribolium castaneum 12529 997, 1507, 1733
Tupaia belangeri 4654 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Tursiops truncatus 8298 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Vicugna pacos 5884 37, 274, 457, 564, 1042, 1215, 1321, 1470, 1591, 1733, 1888, 2138, 2454
Xenopus tropicalis 15685 564, 1042, 1215, 1321, 1470, 1584, 1733, 1888

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Anolis carolinensis 3998 ENSACAT00000017489 100559305 ENSACAG00000017383 LOC100559305 anoCar1
Apis mellifera 29709 GB16722-PA apiMel3
Bombyx mori 7387 BGIBMGA005666-TA v2.0
Bos taurus 22032 ENSBTAT00000028079 533006 ENSBTAG00000021083 RECQL bosTau4
Branchiostoma floridae 33431 fgenesh2_pg.scaffold_853000001 braFlo1
Branchiostoma floridae 38285 fgenesh2_pg.scaffold_422000008 braFlo1
Caenorhabditis elegans 9599 K02F3.12b, NM_001027486 175246 WBGene00019334 K02F3.12 ce6
Callithrix jacchus 7966 ENSCJAT00000018319 calJac3
Canis familiaris 15952 ENSCAFT00000038563 486641 ENSCAFG00000012221 RECQL canFam2
Cavia porcellus 12012 ENSCPOT00000026836 100719692 ENSCPOG00000024644 RECQL cavPor3
Choloepus hoffmanni 2463 ENSCHOT00000002465 ENSCHOG00000002452 RECQL choHof1
Culex quinquefasciatus 8590 CPIJ017275-RA 6051087 CPIJ017275 CpipJ1
Danio rerio 22894 ENSDART00000101198 566018 ENSDARG00000007175 recql danRer6
Dasypus novemcinctus 7738 ENSDNOT00000013562 101443708 ENSDNOG00000013557 RECQL dasNov2
Dipodomys ordii 16649 ENSDORT00000015884 ENSDORG00000015884 Recql dipOrd1
Echinops telfairi 18862 ENSETET00000018325 ENSETEG00000018325 TENREC
Echinops telfairi 19173 ENSETET00000018630 ENSETEG00000018631 TENREC
Equus caballus 23003 ENSECAT00000026738 100068195 ENSECAG00000024762 RECQL equCab2
Erinaceus europaeus 12349 ENSEEUT00000011121 ENSEEUG00000011123 RECQL eriEur1
Felis catus 36592 ENSFCAT00000019053 ENSFCAG00000018348 RECQL felCat3
Fugu rubripes 46645 ENSTRUT00000004572 ENSTRUG00000001971 recql (2 of 2) fr2
Fugu rubripes 46726 ENSTRUT00000001265 101075647 ENSTRUG00000000534 recql (1 of 2) fr2
Gallus gallus 1176 ENSGALT00000021517 378910 ENSGALG00000013174 RECQL galGal3
Gasterosteus aculeatus 8508 ENSGACT00000001308 ENSGACG00000001005 recql gasAcu1
Gorilla gorilla 11787 ENSGGOT00000011028 101129848 ENSGGOG00000010985 RECQL gorGor3
Homo sapiens 20815 ENST00000396093 5965 ENSG00000004700 RECQL hg19,GRCh37
Ixodes scapularis 18877 ISCW023149-RA ISCW023149 IscaW1
Linepithema humile 1088 LH12768-RA 1.2
Loxodonta africana 9089 ENSLAFT00000000963 100665566 ENSLAFG00000000963 RECQL loxAfr3
Macropus eugenii 9309 ENSMEUT00000009318 ENSMEUG00000009283 RECQL Meug_1.0
Microcebus murinus 2859 ENSMICT00000002667 ENSMICG00000002664 RECQL micMur1
Monodelphis domestica 30602 ENSMODT00000022587 100011463 ENSMODG00000017805 RECQL monDom5
Mus musculus 37053 ENSMUST00000111803, NM_023042 19691 ENSMUSG00000030243 Recql mm9
Myotis lucifugus 5822 ENSMLUT00000005744 102440392 ENSMLUG00000005741 RECQL myoLuc1
Nasonia vitripennis 10339 NV16610-RA 1.2
Nematostella vectensis 3863 estExt_gwp.C_3070032 Nemve1
Ochotona princeps 8552 ENSOPRT00000007496 ENSOPRG00000007493 RECQL OchPri2.0
Ornithorhynchus anatinus 6525 ENSOANT00000031758 ENSOANG00000021930 ornAna1
Ornithorhynchus anatinus 6616 ENSOANT00000003803 ENSOANG00000002400 ornAna1
Oryzias latipes 13656 ENSORLT00000016100 101164117 ENSORLG00000012853 recql oryLat2
Otolemur garnettii 4925 ENSOGAT00000004757 100948205 ENSOGAG00000004754 RECQL otoGar1
Pan troglodytes 9474 ENSPTRT00000068038 465334 ENSPTRG00000004758 RECQL panTro2
Pediculus humanus 9206 PHUM537310-RA 8235341 PHUM537310 PhumU1
Pogonomyrmex barbatus 4791 PB20899-RA 1.2
Pongo abelii 6151 ENSPPYT00000005166 100171554 ENSPPYG00000004352 RECQL ponAbe2
Procavia capensis 16727 ENSPCAT00000012689 ENSPCAG00000012685 RECQL proCap1
Pteropus vampyrus 17753 ENSPVAT00000002455 ENSPVAG00000002457 RECQL pteVam1
Rattus norvegicus 26410 ENSRNOT00000055571 312824 ENSRNOG00000012602 Recql rn4
Rhesus macaque 7159 ENSMMUT00000015186 705871 ENSMMUG00000010857 RECQL rheMac2
Sorex araneus 4441 ENSSART00000004361 ENSSARG00000004363 RECQL sorAra1
Spermophilus tridecemlineatus 6326 ENSSTOT00000006327 101978597 ENSSTOG00000006328 Recql speTri1
Sus scrofa 14768 ENSSSCT00000000624 100621847 ENSSSCG00000000580 RECQL susScr2
Tarsius syrichta 6032 ENSTSYT00000009213 103268271 ENSTSYG00000009224 RECQL tarSyr1
Tetraodon nigroviridis 17973 ENSTNIT00000010225 ENSTNIG00000007242 recql tetNig2
Tribolium castaneum 12529 GLEAN_04664 Tcas3.0
Tupaia belangeri 4654 ENSTBET00000004655 ENSTBEG00000004653 RECQL tupBel1
Tursiops truncatus 8298 ENSTTRT00000003296 ENSTTRG00000003296 RECQL turTru1
Vicugna pacos 5884 ENSVPAT00000007546 ENSVPAG00000007546 RECQL vicPac1
Xenopus tropicalis 15685 ENSXETT00000029632 ENSXETG00000013524 recql xenTro2

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Anolis carolinensis 16826 ENSACAP00000017152 100559305 ENSACAG00000017383 LOC100559305 anoCar1
Apis mellifera 6720 GB16722 apiMel3
Bombyx mori 5666 BGIBMGA005666-PA v2.0
Bos taurus 24424 ENSBTAP00000028079 533006 ENSBTAG00000021083 RECQL bosTau4
Branchiostoma floridae 29294 fgenesh2_pg.scaffold_422000008 braFlo1
Branchiostoma floridae 31798 fgenesh2_pg.scaffold_853000001 braFlo1
Caenorhabditis elegans 12506 K02F3.12b 175246 WBGene00019334 K02F3.12 ce6
Callithrix jacchus 214 ENSCJAP00000017320 calJac3
Canis familiaris 5711 ENSCAFP00000034305 486641 ENSCAFG00000012221 RECQL canFam2
Cavia porcellus 9408 ENSCPOP00000015998 100719692 ENSCPOG00000024644 RECQL cavPor3
Choloepus hoffmanni 2173 ENSCHOP00000002174 ENSCHOG00000002452 RECQL choHof1
Culex quinquefasciatus 18286 CPIJ017275 CpipJ1
Danio rerio 9163 ENSDARP00000091972 566018 ENSDARG00000007175 recql danRer6
Dasypus novemcinctus 6828 ENSDNOP00000010515 101443708 ENSDNOG00000013557 RECQL dasNov2
Dipodomys ordii 15659 ENSDORP00000014943 ENSDORG00000015884 Recql dipOrd1
Echinops telfairi 14874 ENSETEP00000014893 ENSETEG00000018325 TENREC
Echinops telfairi 15123 ENSETEP00000015141 ENSETEG00000018631 TENREC
Equus caballus 22224 ENSECAP00000022335 100068195 ENSECAG00000024762 RECQL equCab2
Erinaceus europaeus 10146 ENSEEUP00000010139 ENSEEUG00000011123 RECQL eriEur1
Felis catus 2050 ENSFCAP00000015498 ENSFCAG00000018348 RECQL felCat3
Fugu rubripes 1259 ENSTRUP00000001259 101075647 ENSTRUG00000000534 recql (1 of 2) fr2
Fugu rubripes 4547 ENSTRUP00000004547 ENSTRUG00000001971 recql (2 of 2) fr2
Gallus gallus 15565 ENSGALP00000021484 378910 ENSGALG00000013174 RECQL galGal3
Gasterosteus aculeatus 1254 ENSGACP00000001307 ENSGACG00000001005 recql gasAcu1
Gorilla gorilla 9778 ENSGGOP00000010708 101129848 ENSGGOG00000010985 RECQL gorGor3
Homo sapiens 42290 ENSP00000379400 5965 ENSG00000004700 RECQL hg19,GRCh37
Ixodes scapularis 18871 ISCW023149-PA ISCW023149 IscaW1
Linepithema humile 14186 LH12768-PA 1.2
Loxodonta africana 6793 ENSLAFP00000000805 100665566 ENSLAFG00000000963 RECQL loxAfr3
Macropus eugenii 8480 ENSMEUP00000008484 ENSMEUG00000009283 RECQL Meug_1.0
Microcebus murinus 2425 ENSMICP00000002429 ENSMICG00000002664 RECQL micMur1
Monodelphis domestica 6914 ENSMODP00000022198 100011463 ENSMODG00000017805 RECQL monDom5
Mus musculus 14913 ENSMUSP00000107434 19691 ENSMUSG00000030243 Recql mm9
Myotis lucifugus 5248 ENSMLUP00000005250 102440392 ENSMLUG00000005741 RECQL myoLuc1
Nasonia vitripennis 6518 NV16610-PA 1.2
Nematostella vectensis 15216 estExt_gwp.C_3070032 Nemve1
Ochotona princeps 7452 ENSOPRP00000006863 ENSOPRG00000007493 RECQL OchPri2.0
Ornithorhynchus anatinus 3591 ENSOANP00000003802 ENSOANG00000002400 ornAna1
Ornithorhynchus anatinus 6961 ENSOANP00000027960 ENSOANG00000021930 ornAna1
Oryzias latipes 15233 ENSORLP00000016099 101164117 ENSORLG00000012853 recql oryLat2
Otolemur garnettii 4251 ENSOGAP00000004252 100948205 ENSOGAG00000004754 RECQL otoGar1
Pan troglodytes 25424 ENSPTRP00000059635 465334 ENSPTRG00000004758 RECQL panTro2
Pediculus humanus 9033 PHUM537310-PA 8235341 PHUM537310 PhumU1
Pogonomyrmex barbatus 10899 PB20899-PA 1.2
Pongo abelii 9221 ENSPPYP00000004971 100171554 ENSPPYG00000004352 RECQL ponAbe2
Procavia capensis 15649 ENSPCAP00000011854 ENSPCAG00000012685 RECQL proCap1
Pteropus vampyrus 16733 ENSPVAP00000002319 ENSPVAG00000002457 RECQL pteVam1
Rattus norvegicus 9438 ENSRNOP00000052434 312824 ENSRNOG00000012602 Recql rn4
Rhesus macaque 4430 ENSMMUP00000014230 705871 ENSMMUG00000010857 RECQL rheMac2
Sorex araneus 3963 ENSSARP00000003964 ENSSARG00000004363 RECQL sorAra1
Spermophilus tridecemlineatus 5661 ENSSTOP00000005659 101978597 ENSSTOG00000006328 Recql speTri1
Sus scrofa 610 ENSSSCP00000000610 100621847 ENSSSCG00000000580 RECQL susScr2
Tarsius syrichta 5523 ENSTSYP00000008455 103268271 ENSTSYG00000009224 RECQL tarSyr1
Tetraodon nigroviridis 16936 ENSTNIP00000010045 ENSTNIG00000007242 recql tetNig2
Tribolium castaneum 4546 GLEAN_04664 Tcas3.0
Tupaia belangeri 4011 ENSTBEP00000004013 ENSTBEG00000004653 RECQL tupBel1
Tursiops truncatus 7832 ENSTTRP00000003092 ENSTTRG00000003296 RECQL turTru1
Vicugna pacos 5471 ENSVPAP00000007019 ENSVPAG00000007546 RECQL vicPac1
Xenopus tropicalis 58 ENSXETP00000029632 ENSXETG00000013524 recql xenTro2

multiple sequence alignment in CLUSTALW format

Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Caenorhabditis_elegans|9599        ---------------ATGAGCGATGTTCTGCTCTCCAAGTTGTCCACAGAGCTTGCCGAT
Pediculus_humanus|9206             ---------------------ATGGTCGACATGGTCACTGAAGAAGATGAAATAAAAGCT
Linepithema_humile|1088            ------------------------------ATGATAGACGACGACGAGTGTCAAGTCACA
Ixodes_scapularis|18877            ------------------------ATGTCGCAAATATCCCTGCAGAAGGAGCTAAGTGAG
Bombyx_mori|7387                   ---------------------ATGAAGACCATAGAAGAACTACAAAATGAACTTATCAGC
Danio_rerio|22894                  ---------------------ATGGCTAATGTTGATGATGCTCGGGAAGAGTTGGACTCG
Fugu_rubripes|46645                ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------GTTTCTGCTTCAGATGTGCAGGACCAGCTGGATATG
Gasterosteus_aculeatus|8508        ---------------AAGGATTCTGAAGTTGAGTCTTATGCGCAGGCGGAGCTGGAAACT
Oryzias_latipes|13656              ---------------------------------TCAGATGTGCAGGCGGAGCTGGACTCG
Branchiostoma_floridae|38285       ---------------------ATGTCAAACGTTGAGGAGCTGACGTCGGAACTGGTCGAG
Branchiostoma_floridae|33431       ------------------------------------------------------------
Nematostella_vectensis|3863        ---------------------------------ATGGATACCGTGAAAGAACTACAAGAA
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ---------------------------------------CTAACTGAGGAACTGGAGTCT
Felis_catus|36592                  ---------------------ATGGCATCCATTTCAANNNNNNNNNNNNNNNNNNNNNNN
Microcebus_murinus|2859            ---------------------ATGGCATCTGTTTCAGCTCTAACTGAGGAACTGGATTCT
Myotis_lucifugus|5822              ---------------------ATGGCATCTGTTTCAGCTCTAACTGAGGAATTGGATTCG
Otolemur_garnettii|4925            ---------------------ATGGTGTCCATTTCAGCTCTAACCGAGGAACTGGATTCC
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------CCTTCCATTTTAGTGTTGCAAGAGGAACTTTCTTCT
Dipodomys_ordii|16649              ---------------------------------------CTCACGGAAGAACTGGAATCT
Gallus_gallus|1176                 ---------------------ATGACAGCTGTGGAAGTGTTAGAGGAGGAACTTCTTTCC
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ---------------------ATGGCGTCCGTTACAGCTTTAACTGAGGAACTGGATTCC
Tursiops_truncatus|8298            ---------------------ATGGCATCCATTTCAGCTCTAAGTGAGGAACTGGATTCT
Choloepus_hoffmanni|2463           ---------------------ATGGCCTCTGTTACAGCTCTGACTGAGGAACTGGATTCA
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ---------------------ATGGAGTCTGTTTCAGCCCTAACTGAGGAACTGGATTCT
Pteropus_vampyrus|17753            ---------------------ATGGCATCTATTTCAGNNNNNNNNNNNNNNNNNNNNNNN
Vicugna_pacos|5884                 ---------------------ATGGCATCCATTTCAGNNNNNNNNNNNNNNNNNNNNNNN
Rattus_norvegicus|26410            ---------------------ATGGCTTCCATCCCAGCTCTAACGGATGAACTGGAGTCT
Monodelphis_domestica|30602        ---------------------CTTCTGTTTCCTATAGAGCTAAGTGAGGAATTAGATTCC
Echinops_telfairi|19173            ---------------------------------------CTAACTGAGGAACTGGAGCCT
Mus_musculus|37053                 ---------------------ATGGCATCCGTCTCAGCTTTGACAGAGGAACTGGAATCC
Equus_caballus|23003               ---------------------TTTTCCTGCCTTGTAGCTCTAACTGAGGAATTGGATTCT
Tarsius_syrichta|6032              ---------------------ATGGCTTCCATTTCAGCTCTAACTGAGGAACTGGAGTCT
Canis_familiaris|15952             ---------------------TTTTCCTTCCTTGTAGCTCTAACTGAAGAATTGGATTCT
Loxodonta_africana|9089            ---------------------TTTATCCCTCTCATAGTTCTAACCGAGGAACTGGAGTCT
Sus_scrofa|14768                   ---------------------ATGGCATCCATTTCAGCTCTGAGTGAGGAACTGGATTCT
Bos_taurus|22032                   ---------------------ATGGCATCCATTTCAGCTCTGAGTGAGGAACTAGATTCT
Ochotona_princeps|8552             ---------------------ATGGCATCCATTTCAGCTCTCACCGAGGAACTGGATTCC
Callithrix_jacchus|7966            ---------------------ATGACTTCTCTACAACCTCTAACTGAGGAACTGGATTCT
Gorilla_gorilla|11787              ---------------------ATGGCGTCCGTTTCAGCTCTAACTGAGGAACTGGATTCT
Homo_sapiens|20815                 ------------------------CAGTCTGTGAAAGCTCTAACTGAGGAACTGGATTCT
Pan_troglodytes|9474               ------------------------CAGTCTGTGAAAGCTCTAACTGAGGAACTGGATTCT
Pongo_abelii|6151                  ---------------------ATGGCGTCTGTTTCAGCTCTAACTGAGGAACTGGATTCT
Rhesus_macaque|7159                ---------------------ATGGCGTCCGTTTCAGCTCTGACTGAGGAACTGGATTCT
Cavia_porcellus|12012              ------------------------------------GCTCTAACAGAGGAACTGGATTCT
Spermophilus_tridecemlineatus|6326 ---------------------ATGGCTTCTATTTCAGCACTAACCGAGGAATTGGATTCT

Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Fugu_rubripes|46645                ------------------------------------------------------------
Tetraodon_nigroviridis|17973       GTGGAGGCAGAACTACAGGAGGTGGACCTGCAAattgctgagctgcagcagaagaaagtT
Fugu_rubripes|46726                GTGGAGGCGGAGCTAGAGGAGGTTGACCTACAGAttgctgtgctgcagcagaagaaggct
Oryzias_latipes|13656              GTGGAggaagagctgcagctgctgcaggtccaGATCTCGGAGCTCCTGGAGAAGCAGGCG
Branchiostoma_floridae|33431       ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------

Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Fugu_rubripes|46645                ------------------------------------------------------------
Tetraodon_nigroviridis|17973       GAGCTGAACGGTCGCAGGgacgctctgctgcagcacctggaggaAGCCTGCGATGCG---
Branchiostoma_floridae|33431       ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------

Tribolium_castaneum|12529          ---------------------GACACCTTGAGCGAC------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ---------------------AGCGAGCTGGCCAAACAGGAC------------------
Caenorhabditis_elegans|9599        ---------------------GACTCGGATGTTGTGACGGATCGT---------------
Pediculus_humanus|9206             ---------------------GAAAAACTAGCAAGTAAAAAT------------------
Nasonia_vitripennis|10339          ---------------------AACGCTCTTCTAAAAAAGAGTTTCAACCTATCAAAGAAA
Apis_mellifera|29709               ---------------------GATGCACTTTTAAAAAAAAGTTTATCTGTATCAAAAAAG
Linepithema_humile|1088            ---------------------GATATCCTTTTAAAAAAGAGTTTCTCGCTGTCCAAGAAA
Pogonomyrmex_barbatus|4791         ---------------------GATGCTCTCTTGAAGAAAAGTTTTTCTCTGTCCAAGAAA
Ixodes_scapularis|18877            ---------------------GAGGTGAACCAAACGGAC---------------------
Bombyx_mori|7387                   ---------------------GAAACATTAGCGAGCGTTGAC------------------
Danio_rerio|22894                  CAG------------------CCTTCCGGATCCGGCAAAACTCCCAAATCTTCATTCAGC
Fugu_rubripes|46645                ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ---------------------GCGGAACCGTCCCCCTCGTCTTTCTCCAAGTCACCCAGG
Fugu_rubripes|46726                CAaccatcc------------tcctcttcacagGCCTCCCGAGGTGAACCAGCGGCCAGC
Gasterosteus_aculeatus|8508        ---------------------CAGCCGTCATCCTCAAAATTATCTGGAGCGAATCCAGTG
Oryzias_latipes|13656              CAgtcatcctcctcatcctcggCTTCCTCAAAGTCTTTGGCGTCAGAGCCCGTGATGAGC
Branchiostoma_floridae|38285       ---------------------AAGGCTGCGGTGCTGAGGGAGAAGGAC------------
Branchiostoma_floridae|33431       ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ---------------------GATGCGGAGGCAAGCCACGAATGCGATTCGTCACCTGAC
Felis_catus|36592                  ---------------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Microcebus_murinus|2859            ---------------------GATGTGGGGGCAAGTGACAACTGTGATTCTTCACCTGCT
Myotis_lucifugus|5822              ---------------------GATGCTGGGGGAAGCAATGAATGTGATTCTTCACCTGCC
Otolemur_garnettii|4925            TCT------------------GATGCTGGGGCAAGCAACGAGTGTGATTCTTCACCTGCT
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ---------------------GAGAGCGGGAGCAGCAAAGATACTGAATCAGCAGCAGAG
Dipodomys_ordii|16649              ---------------------GGTGCCGGGACGAGTACTGAGGGGGACTCTTCCCCTGCC
Gallus_gallus|1176                 ---------------------GCAGCAGGGGGAAGTAAAGAGACCGAAACTTCAGTTGAA
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ---------------------TCTTGTGCTGGAAGCAACAAATGTGATTCTTCACCTGCT
Tursiops_truncatus|8298            ---------------------GATGCTGGCGAGAGCAGCGAATGTGATTCGTCACCTGCC
Choloepus_hoffmanni|2463           ---------------------CATGCTGGGGCAAGCAATGAGTGTGATTCTTCACCTGCT
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              CAT------------------GATGCCGGGGCAAGCAATGAATGTGATTCTTCACCTGCT
Pteropus_vampyrus|17753            ---------------------TCTGATGCGAAAAGCAGTGAATGTGATTCTTCCTCACGT
Vicugna_pacos|5884                 ---------------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Rattus_norvegicus|26410            ---------------------GCTGCCGAGGCGAGCGGCGACTGTGACACGTCTCCAGCT
Monodelphis_domestica|30602        ---------------------GGTGCTGGAGCAAGCTCAGAATTTGATTCTTCACCTGAG
Echinops_telfairi|19173            ---------------------GATGCTGAGGCAAGCCACGGATGCGATTCTTCACCTGAC
Mus_musculus|37053                 ---------------------TCGGCTGAGGCGAGCAGCGACTTGGACACATCACCAGCT
Equus_caballus|23003               ---------------------GGTGCTGGGGAAAGCAACGAATGTGATTCTTCACCTGCT
Tarsius_syrichta|6032              ---------------------GATGCTGGGACAAGCAACGAATGTGATTCTTCACCTGCT
Canis_familiaris|15952             ---------------------GACGTTGGGGAAAGCAGTGAATCGGATTCTTCACCTGCT
Loxodonta_africana|9089            ---------------------GATGCTGGGGCAAGCAACGATTGTGATTCTTCCCCTGAT
Sus_scrofa|14768                   ---------------------GATGCTGGGGAAAGCAGTGAATATGATTCTTCACCTGCC
Bos_taurus|22032                   ---------------------GATGCTGGGGAGAGCAGTGAATGTGATTCTTCACCTGCC
Ochotona_princeps|8552             ---------------------GGTGCCGGAGCCAGCAACGAGTATGATTCTTCGCCAGCT
Callithrix_jacchus|7966            ---------------------GATGCCGGGGCAAGCAGCGAATGTGATTCTTCACCAGCT
Gorilla_gorilla|11787              ---------------------GATGCCGGGGCAAGCAATGAATATGATTCTTCACCTGCC
Homo_sapiens|20815                 ---------------------GATGCCGGGGCAAGCAATGAATATGATTCTTCACCTGCC
Pan_troglodytes|9474               ---------------------GATGCCGGGGCAAGCAATGAATATGATTCTTCACCTGCC
Pongo_abelii|6151                  ---------------------GATGCCGGGGCAAGCAACGAATATGATTCTTCACCTGCC
Rhesus_macaque|7159                ---------------------GATGCCGGGGCAAGCAACGAACATGATTCTTCACCTGCC
Cavia_porcellus|12012              ---------------------GAGGCTGGGGCCAGCAAAGAATGTGATTCTTCACCAGCT
Spermophilus_tridecemlineatus|6326 ---------------------GATGCTGGGACAAGCAACGAGTGTGATTCTTCACCTGCC

Tribolium_castaneum|12529          ------------------TGGCTTGAG---GAGAAGTTTCCCTGGTCGGCCCAACTCAAA
Ornithorhynchus_anatinus|6525      ---------------------------------GATTTCCCCTGGGCCGGGAAGGTGAAG
Culex_quinquefasciatus|8590        ------------------TGGAACGCG---GAAGGCCACGCGTGGTCGGGCACGGTGCGG
Caenorhabditis_elegans|9599        ------------------TGGGATCGA---GATGGGTTCCCATGGTCCGATGAAGCTACA
Pediculus_humanus|9206             ------------------TGGTCATTG---AAAACTTTTCCATGGTCTCAAAAAGTAGAT
Nasonia_vitripennis|10339          ------------AAC---TGGGACTTG---GAAAAATTCCCTTGGTCAAAGAATCTTAAG
Apis_mellifera|29709               ------------GAT---TGGAGTAAA---GAAGACTTTACATGGTCTAAAAATTTGAAA
Linepithema_humile|1088            ------------GAC---TGGAATAAT---GCAAATTTTGATTGGTCCGCAAGACTCCAA
Pogonomyrmex_barbatus|4791         ------------AAT---TGGAGCAAT---CGAGATTTCCCTTGGTCCACGAAACTCGTG
Ixodes_scapularis|18877            ------------------TGGCACAAG---TCAACCTACCCCTGGTCGGCTGGGGTCTTG
Bombyx_mori|7387                   ------------------TGGGCTGGT---ACTGAATACGAGTGGTCGGAAGACGTCAAA
Fugu_rubripes|46645                ------------------ATGGTCGAG---------------------------------
Tetraodon_nigroviridis|17973       ------------CCC---CAACCGGCA---ATGAATTTCCCATGGTCCAAAGAGGTCGCG
Oryzias_latipes|13656              CAGCAGGAGATGCAGCGGTACGATGAA---GCAGagttcccctggtctGCAGCGGTGGAC
Branchiostoma_floridae|38285       ------------------TGGAGCAGG---ACTGATTTTGAATGGTCCTCCAAACTGCAG
Branchiostoma_floridae|33431       ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------TGGTCTTCA---ACGGCGTTTTCGTGGTCTCAAGAGGTCGAG
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------TTCCCGTGGTCCGGCCAAGTGAAG
Echinops_telfairi|18862            ------------GCT---TGGAACAAA---GAAGATTTTCCATGGTCTGATAAGGTTAAA
Felis_catus|36592                  ------------NNN---NNNNNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Microcebus_murinus|2859            ------------GCT---TGGAATAAA---GAAGATTTTCCATGGTCTGGTAAAGTGAAA
Myotis_lucifugus|5822              ------------TCT---TGGAATAAA---GAAGNNNNNNNNNNNNNNNNNNNNNNNNNN
Otolemur_garnettii|4925            ------------GCT---TGGAATAAA---GAAGATTTTCCCTGGTCTGGTAAAGTGAAA
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------GAC---TGGAACAAG---GAAGATTTTCCATGGTCCAAAAAGGTCAGA
Dipodomys_ordii|16649              ------------GCT---TGGAATAAA---GAAGATTTCCCTTGGTCGAGTAAAGTTAAA
Gallus_gallus|1176                 ------------GCA---TGGAACAGA---ACAGATTTTCCATGGTATGAGAAGATAAAA
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------GCT---TGGAATAAA---GAAGATTTTCCCTGGTCTGGAAAGGTTAAA
Tursiops_truncatus|8298            ------------TCT---TGGAATAAA---GAAGATTTTCCATGGTCTGGTAAAGTTAAA
Choloepus_hoffmanni|2463           ------------GCT---TGGAATAAA---GAAGATTTTCCCTGGTCTGGTAAGGTTAAA
Erinaceus_europaeus|12349          ------------------------------------TTTCCGTGGTCTGGCAAAGTTAAA
Tupaia_belangeri|4654              ------------GCT---TGGAATAAA---GAAGNNNNNNNNNNNNNNNNNNNNNNNNNN
Pteropus_vampyrus|17753            ------------GCCTCTTGGAATAAA---GAAGATTTTCCATGGTCTGATAAAGTTAAA
Vicugna_pacos|5884                 ------------NNN---NNNNNNNNN---NNNNATTTTCCGTGGTCTGGTAAAGTTAAA
Rattus_norvegicus|26410            ------------GCA---TGGAGTAAA---GAAGATTTCCCATGGTCCGGAAAGGTAAAA
Monodelphis_domestica|30602        ------------AGC---TGGAATAAA---CAAGATTTTCCATGGTCTGAGAAAGTTAAA
Echinops_telfairi|19173            ------------GCC---TGGAACAAA---GAAGATTTTCCATGGTCTGATAAGGTTAAA
Mus_musculus|37053                 ------------GCT---TGGAATAAA---GAAGATTTTCCATGGTTCGGAAAGGTAAAA
Equus_caballus|23003               ------------GCT---TGGAATAGA---GAAGATTTTCCATGGTCTGGTAAAGTTAAA
Tarsius_syrichta|6032              ------------GCT---TGGAATAAA---GAAGATTTTCCATGGTCTGGTAAAGTTAAA
Canis_familiaris|15952             ------------GCT---TGGAATAAA---GAAGATTTTCCCTGGTCTAGTAAAGTTAAA
Loxodonta_africana|9089            ------------ACT---TGGAATAAA---GAAGATTTTCCATGGTCTGATAGGGTTAAA
Sus_scrofa|14768                   ------------TCT---TGGAATAAA---GAAGATTTTCCATGGTCTGGTAAAGTTAAA
Bos_taurus|22032                   ------------TCT---TGGAATAAA---GAAGATTTTCCATGGTCTGGTAAAGTTAAA
Ochotona_princeps|8552             ------------GCA---TGGAAGAAA---GAAGATTTTCCGTGGTCTGGAAAAGTTAAA
Callithrix_jacchus|7966            ------------GCT---TGGAATAAA---GAAGATTTTCCATGGTCTGGTAAAGTTAAA
Gorilla_gorilla|11787              ------------GCT---TGGAATAAA---GAAGATTTTCCATGGTCTGGTAAAGTTAAA
Homo_sapiens|20815                 ------------GCT---TGGAATAAA---GAAGATTTTCCATGGTCTGGTAAAGTTAAA
Pan_troglodytes|9474               ------------GCT---TGGAATAAA---GAAGATTTTCCATGGTCTGGTAAAGTTAAA
Pongo_abelii|6151                  ------------GCT---TGGAATAAA---GAAGATTTTCCATGGTCTGGGAAAGTTAAA
Rhesus_macaque|7159                ------------GCT---TGGAATAAA---GAAGATTTTCCATGGTCTGGTAAAGTTAAA
Cavia_porcellus|12012              ------------GCT---TGGAATAAA---GAAGATTTTCCATGGTCTGCTAAAGTGAAA
Spermophilus_tridecemlineatus|6326 ------------GCT---TGGAATAAA---GAAGATTTTCCATGGTCTGGTAAAGTCAAA

Fugu_rubripes|46645                ------------------------------------------------------------
Fugu_rubripes|46726                cagcatctgcaggacaCCTTCCATCTGCCGCGGTTCCGCccgctgcagctcagggtgATT
Branchiostoma_floridae|33431       ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------

Fugu_rubripes|46645                ------------------------------------------------------------
Tetraodon_nigroviridis|17973       AACCTGACGCTGTCCGGCAGGGATCTCTTCCTGGTCATGCCCacaggaagagggaaaagc
Branchiostoma_floridae|33431       ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------

Ornithorhynchus_anatinus|6525      CTGTGCTACCAGCTGCCGGCCGTCTGTTCCCCC---Gcctctgacaccgtcgaccgtccc
Fugu_rubripes|46645                ------------------------------------GTGTACAAGATGGTGGTTGGACCA
Fugu_rubripes|46726                CTCTGTTACCAGctgcctgctctctgctctAAA---GGTCTCACGCTGGTGGTGACGCCG
Branchiostoma_floridae|33431       ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------GGTTTCACCCTTGTGATCTGCCCT
Macropus_eugenii|9309              ---------------------------------------TTCACACTTGTGATCTGCCCT
Procavia_capensis|16727            ---------------------------------------TTTACTCTCGTGATTTGTCCA
Xenopus_tropicalis|15685           ------------------------------------GGATTCACGCTGGTTATCTGCCCC

Ornithorhynchus_anatinus|6525      ctcctc------------------ctccatacctcatctcgcctcggcttcacggactcc
Fugu_rubripes|46645                GTGTCTGGTTTA------------------------------------------------
Oryzias_latipes|13656              CTGGTGTCCCTGATGGAggaccagctgctgctcctgcgcTCGCTGCAAGTGCCGGCAGCC
Branchiostoma_floridae|33431       ------------------------------------------------------------

Ornithorhynchus_anatinus|6525      gtcctctcccggttctcctctcgcctctccggccggtcgttctcggtctccttcgccggc
Fugu_rubripes|46645                ------------------------------------------------------------
Branchiostoma_floridae|33431       ------------------------------------------------------------
Felis_catus|36592                  ATGTTAAATGTTTCT---------------------------------------------

Tribolium_castaneum|12529          AAA---------------------------------------------------------
Ornithorhynchus_anatinus|6525      gcc---------------------------------------------------------
Culex_quinquefasciatus|8590        GGG---------------------------------------------------------
Caenorhabditis_elegans|9599        AAA---------------------------------------------------------
Pediculus_humanus|9206             TCA---------------------------------------------------------
Nasonia_vitripennis|10339          AAT---------------------------------------------------------
Apis_mellifera|29709               AAA---------------------------------------------------------
Linepithema_humile|1088            AAA---------------------------------------------------------
Pogonomyrmex_barbatus|4791         AAA---------------------------------------------------------
Ixodes_scapularis|18877            AAG---------------------------------------------------------
Bombyx_mori|7387                   AAA---------------------------------------------------------
Danio_rerio|22894                  AAA---------------------------------------------------------
Fugu_rubripes|46645                ------------------------------------------------------------
Tetraodon_nigroviridis|17973       CCA---------------------------------------------------------
Fugu_rubripes|46726                CCC---------------------------------------------------------
Gasterosteus_aculeatus|8508        CCC---------------------------------------------------------
Oryzias_latipes|13656              CCA---------------------------------------------------------
Branchiostoma_floridae|33431       ------------------------------------------------------------
Nematostella_vectensis|3863        AAG---------------------------------------------------------
Ornithorhynchus_anatinus|6616      GAG---------------------------------------------------------
Sorex_araneus|4441                 NNN---------------------------------------------------------
Echinops_telfairi|18862            AAA---------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            AAA---------------------------------------------------------
Myotis_lucifugus|5822              NNN---------------------------------------------------------
Otolemur_garnettii|4925            NNN---------------------------------------------------------
Macropus_eugenii|9309              AAG---------------------------------------------------------
Procavia_capensis|16727            AAA---------------------------------------------------------
Anolis_carolinensis|3998           TCC---------------------------------------------------------
Dipodomys_ordii|16649              AAG---------------------------------------------------------
Gallus_gallus|1176                 AGA---------------------------------------------------------
Xenopus_tropicalis|15685           AAG---------------------------------------------------------
Dasypus_novemcinctus|7738          AAA---------------------------------------------------------
Tursiops_truncatus|8298            NNN---------------------------------------------------------
Choloepus_hoffmanni|2463           NNN---------------------------------------------------------
Erinaceus_europaeus|12349          NNN---------------------------------------------------------
Tupaia_belangeri|4654              AAA---------------------------------------------------------
Pteropus_vampyrus|17753            AAA---------------------------------------------------------
Vicugna_pacos|5884                 AAA---------------------------------------------------------
Rattus_norvegicus|26410            AAA---------------------------------------------------------
Monodelphis_domestica|30602        AAA---------------------------------------------------------
Echinops_telfairi|19173            AAA---------------------------------------------------------
Mus_musculus|37053                 AAA---------------------------------------------------------
Equus_caballus|23003               AAA---------------------------------------------------------
Tarsius_syrichta|6032              AAG---------------------------------------------------------
Canis_familiaris|15952             AAG---------------------------------------------------------
Loxodonta_africana|9089            AAA---------------------------------------------------------
Sus_scrofa|14768                   AAA---------------------------------------------------------
Bos_taurus|22032                   AAA---------------------------------------------------------
Ochotona_princeps|8552             AAA---------------------------------------------------------
Callithrix_jacchus|7966            AAA---------------------------------------------------------
Gorilla_gorilla|11787              AAA---------------------------------------------------------
Homo_sapiens|20815                 AAA---------------------------------------------------------
Pan_troglodytes|9474               AAA---------------------------------------------------------
Pongo_abelii|6151                  AAA---------------------------------------------------------
Rhesus_macaque|7159                AAA---------------------------------------------------------
Cavia_porcellus|12012              AAA---------------------------------------------------------
Spermophilus_tridecemlineatus|6326 AAA---------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Fugu_rubripes|46645                ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Branchiostoma_floridae|33431       ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Fugu_rubripes|46645                ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Branchiostoma_floridae|33431       ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Fugu_rubripes|46645                ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Branchiostoma_floridae|33431       ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------AAATCGGCATTGAAATTGCTCTAC
Ornithorhynchus_anatinus|6525      ------------------------------------tcctccccctcccatcctttaacc
Culex_quinquefasciatus|8590        ---------------------------------GACACGGAACAGCTGAAGATTGTTTAC
Caenorhabditis_elegans|9599        ------------------------------------GATTCAAAGTTTCGACTTCTCTAT
Pediculus_humanus|9206             ------------------------------------TGTCCTAAACACAAATTAATTTAT
Nasonia_vitripennis|10339          ------------------------------------AAATCAGATCTAAAACTGGTTTAT
Apis_mellifera|29709               ------------------------------------AAATCTGATCTTAAATTAATTTAT
Linepithema_humile|1088            ------------------------------------AACTCCAATCTTAAATTGATTTAC
Pogonomyrmex_barbatus|4791         ------------------------------------AATTCATCTCTCAAATTGATTTAT
Ixodes_scapularis|18877            ------------------------------------AAGTCCCCCATTAAGCTCATCTAT
Bombyx_mori|7387                   ------------------------------------TCTGCCACTGTAAAACTATTATAT
Danio_rerio|22894                  ------------------------------------AATAGCCCCTTCAAATTGCTCTAT
Fugu_rubripes|46645                ------------------------------------GAGACGGAGACGCAGCTG------
Tetraodon_nigroviridis|17973       ------------------------------------AAGACCCCCTTCAGACTGGTGTAT
Fugu_rubripes|46726                ------------------------------------ACGGTGCCCTTCAGACTGGTGTAC
Gasterosteus_aculeatus|8508        ------------------------------------AATGGTCCCTTCAAGCTGCTTTAC
Oryzias_latipes|13656              ------------------------------------AAGGCCCCCTTCAAGCTGGTCTAT
Branchiostoma_floridae|33431       ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------------------------AAATCTGATCTCAAAATGCTGTAT
Ornithorhynchus_anatinus|6616      ------------------------------------ACGTCGGCGCTGAATCTCCTCAAC
Sorex_araneus|4441                 ------------------------------------NNNNNNNNNNNNNNNNNNNNNNNN
Echinops_telfairi|18862            ------------------------------------AACTCCAAGTTAAAGCTCATATAT
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------AACTCCGAATTAAAGCTAATTTAC
Myotis_lucifugus|5822              ------------------------------------NNNNNNNNNNNNNNNNNNNNNNNN
Otolemur_garnettii|4925            ------------------------------------NNNNNNNNNNNNNNNNNNNNNNNN
Macropus_eugenii|9309              ------------------------------------AACTCTAAGCTAAAGCTCATTTAT
Procavia_capensis|16727            ------------------------------------AATTCTGATTTAAAGCTAATTTAT
Anolis_carolinensis|3998           ------------------------------------AGCTCACAGCTAAAACTCATTTAT
Dipodomys_ordii|16649              ------------------------------------AACTCCGAGCTGAAGCTGATTTAC
Gallus_gallus|1176                 ------------------------------------AACTCACAACTGAAGCTCCTTTAT
Xenopus_tropicalis|15685           ------------------------------------AATTCTCGGCTGAAGCTGCTGTAC
Dasypus_novemcinctus|7738          ------------------------------------AACTCCAAGGTAAAACTAATTTAT
Tursiops_truncatus|8298            ------------------------------------NNNNNNNNNNNNNNNNNNNNNNNN
Choloepus_hoffmanni|2463           ------------------------------------NNNNNNNNNNNNNNNNNNNNNNNN
Erinaceus_europaeus|12349          ------------------------------------NNNNNNNNNNNNNNNNNNNNNNNN
Tupaia_belangeri|4654              ------------------------------------AACTCCAACCTAAAGCTAATTTAT
Pteropus_vampyrus|17753            ------------------------------------AACTCCAAGCTAAAGTTAATTTAC
Vicugna_pacos|5884                 ------------------------------------AGCTCCAAGCTGAAGCTAATTTAT
Rattus_norvegicus|26410            ------------------------------------AACTCCCACTTAAAGCTGATTTAT
Monodelphis_domestica|30602        ------------------------------------AACTCTAAGCTGAAGCTCATTTAT
Echinops_telfairi|19173            ------------------------------------AACTCCAAGTTAAAGCTCATACAT
Mus_musculus|37053                 ------------------------------------AACTCCCAGTTAAAGCTGATTTAT
Equus_caballus|23003               ------------------------------------AATTCCAAGCTCAAGCTAATTTAC
Tarsius_syrichta|6032              ------------------------------------AACTCTGAGTTAAAGCTAATTTAT
Canis_familiaris|15952             ------------------------------------AACTCCAAGCTAAAGCTAATTTAT
Loxodonta_africana|9089            ------------------------------------AATTCCAAGTTAAAGCTAATTTAT
Sus_scrofa|14768                   ------------------------------------AACTCCAAGCTGAAGCTAATTTAT
Bos_taurus|22032                   ------------------------------------AACTCCAAGCTAAAGCTAATTTAT
Ochotona_princeps|8552             ------------------------------------AACTCCAAGTTAAAGCTGATTTAT
Callithrix_jacchus|7966            ------------------------------------AACTCCGAGTTAAAGCTGATTTAT
Gorilla_gorilla|11787              ------------------------------------AACTCCGAGTTAAAGCTGATTTAT
Homo_sapiens|20815                 ------------------------------------AACTCCGAGTTAAAGCTGATTTAT
Pan_troglodytes|9474               ------------------------------------AACTCCGAGTTAAAGCTGATTTAT
Pongo_abelii|6151                  ------------------------------------AACTCCGAGTTAAAGCTGATTTAT
Rhesus_macaque|7159                ------------------------------------AACTCCGAGTTAAAGCTGATTTAT
Cavia_porcellus|12012              ------------------------------------AACTCCACGTTAAAGCTAATTTAC
Spermophilus_tridecemlineatus|6326 ------------------------------------AACTCCAAGTTAAAGCTAATTTAT

Ornithorhynchus_anatinus|6525      gtcggggtccctcgaggaatgacgacgacgacggtattcgtgaagcgctca---tcacgt
Fugu_rubripes|46645                ------GAGGGGGAAGAGACGAAGACGTGGAGGTTCTTTAAGAAT---------GAACGA
Branchiostoma_floridae|33431       ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------

Ornithorhynchus_anatinus|6525      gccgagtacctttctgagcgccggggGTGTTCactatgtcccaagcactgttctaagcac
Fugu_rubripes|46645                GGATGGAGAGGATCAGAAAGGAGCAGA---------------------TGTGAGGGACAG
Branchiostoma_floridae|33431       ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------

Ornithorhynchus_anatinus|6525      tggggtacaggactgcgtgaccgtgggcgagtcgcttcgcttctctgggcctcggttacc
Fugu_rubripes|46645                ------------------------------------------------------------
Branchiostoma_floridae|33431       ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------

Ornithorhynchus_anatinus|6525      tcctctgtaaaatggggattaactgggagcctcacgggggacgacccgatgaccccggat
Fugu_rubripes|46645                ------------------------------------------------------------
Branchiostoma_floridae|33431       ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Tarsius_syrichta|6032              TCAACA---------------AAAAAAAAAAAAGGAAAGTGGATTGTAAAAGCAGTTCTT

Ornithorhynchus_anatinus|6525      ---ctcccccggcgcttagaa---cggtgctcggcacagaggaggcgcttaacggatacc
Fugu_rubripes|46645                ---CACATGTTAGATGTTGTG------------------GAGACAAAGCCAGAGAGGCCA
Branchiostoma_floridae|33431       ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------

Tribolium_castaneum|12529          AATTTGTTTTACCAA---------------GTTTTGCCGAAACCGGCTACTAAAGACGGG
Ornithorhynchus_anatinus|6525      gacctt------------------------atcactaCGTTCAAGTCATCTCTGTCCGCC
Culex_quinquefasciatus|8590        AATCTGTACTATCAC---------------GTGCTGGAGAAGCCCTCGGACAAGGAGGAA
Caenorhabditis_elegans|9599        AATTTGAAGTATAAA---------------GTGGTTCAAAAACCAGGATCCGAAGACGAG
Pediculus_humanus|9206             AACTTATATTACGAG---------------GTAGTATTGAAACCTTCGTCTCAAAGCGAA
Nasonia_vitripennis|10339          AATCTCTTTTATGAG---------------GTTCGAAGAAAGCCATCGGACAAAGAGGCA
Apis_mellifera|29709               AACTTATTTTATGAA---------------GTTCGAAGAAAACCAACAGACAAAGATACA
Linepithema_humile|1088            AATCTATATTACGAG---------------GTTCGTCGCAAACCGGCGGATAAGAAGCTC
Pogonomyrmex_barbatus|4791         AATTTGTACTACGAG---------------GTTCGTCGCAAGCCAGCGGACAAGGAAACA
Ixodes_scapularis|18877            AACCTACGGTACGAG---------------GTCTGCAGCAAGCCATCCGGACAGGCGGAG
Bombyx_mori|7387                   AATTTGTATTACAAA---------------ATTCTAGAGAAACCAACATCCCAAGATGAT
Danio_rerio|22894                  AACCTTTACTATGAG---------------GTTCGTTTTAAG------GATAACGAAGAC
Fugu_rubripes|46645                GGGTTGGATGTGTCC---------------------------------------------
Tetraodon_nigroviridis|17973       AATCTCTACTATGAG---------------GTTCGTGTTAAAAATTCAGACAACGACGCG
Fugu_rubripes|46726                AATCTCTACTATGAG---------------GTTCGCGTTAAAAACTGTGACAGTGATGCG
Gasterosteus_aculeatus|8508        AATCTCTACTACGAG---------------GTTCGTATTAAAGATTCTAACTATGATGCA
Oryzias_latipes|13656              AACCTCTACTATGAG---------------GTTCGTGTCAAAGACTCGGACAGCGACTTG
Branchiostoma_floridae|38285       AACCTGTACTATGAG---------------GTTCTGAGGAAACCATCTTCTCATGAAAAC
Branchiostoma_floridae|33431       ------------------------------------------------------------
Nematostella_vectensis|3863        AACCTTTTCTATGAG---------------GTTCAGTCAAAGCCCACCACAAACAGTGCA
Ornithorhynchus_anatinus|6616      CAG---------------------------GTTCGGCGGAAGCCCCCCAGCCCCGAGGAT
Sorex_araneus|4441                 NNNNNNNNNNNNNNN---------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Echinops_telfairi|18862            AATCTTTATTATGAG---------------GTCCGGCAGAAGCCCTCAAACACTGAAGAT
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            AATCTTTATTATGAG---------------GTTCGGCAGAAGCCCTCAAACATGGAAGAT
Myotis_lucifugus|5822              AATCTTTATTATGAG---------------GTTCGTCAAAAGCCTTCAAACACTGAAGAT
Otolemur_garnettii|4925            AATCTTTATTACGAG---------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Macropus_eugenii|9309              NNNNNNNNNNNNNNN---------------GTTCGTCAGAAGCCCTCAAACACTGAGGAT
Procavia_capensis|16727            NNNNNNNNNNNNNNN---------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Anolis_carolinensis|3998           AACCTATATTATGAG---------------GTTCGGCAAAAGTCACCAGTTGCTCAGAAT
Dipodomys_ordii|16649              AATCTGTATTACGAG---------------GTTCGTCAGAAACCCTCGAATGCAGAGGAT
Gallus_gallus|1176                 AATCTTTACTATGAG---------------GTTCGGCATAAACCTTCAAATAATGAAGAT
Xenopus_tropicalis|15685           AACCTCTTCTACGAG---------------GTCCGGCTGAAACCTTCCAGCTCTCAGGAC
Dasypus_novemcinctus|7738          NNNNNNNNNNNNNNN---------------NNNNNNNNNNNNNNNNNNAACACAGAAGAT
Tursiops_truncatus|8298            AATCTCTATTATGAG---------------GTTCGGCAGAAGCCTTCAAACACTGAAGAT
Choloepus_hoffmanni|2463           AATCTTTGTTATGAG---------------GTTCGGCAGAAGCCCTCAAACACTGAAGAT
Erinaceus_europaeus|12349          AATTTGTTTTATGAG---------------GTTCGGCAGAAGCCCTCCAACACAGAAGAC
Tupaia_belangeri|4654              AATCTTTATTATGAG---------------GTCCGGCAGAAGCCCTCAAACACTGAAGAT
Pteropus_vampyrus|17753            AATCTTTATTATGAG---------------GTTCGACAGAAGCCCTCAAACACTGAAGAT
Vicugna_pacos|5884                 AATCTCTATTACGAG---------------GTTCGGCAGAAGCCCTCAAACACTGAAGAT
Rattus_norvegicus|26410            AATCTCTACTATGAG---------------GTTCGGCAGAAGCCCTCGAGTGCTGAAGAC
Echinops_telfairi|19173            AATCTTTATTATGAG---------------------------------------------
Mus_musculus|37053                 AATCTTTTTTATGAG---------------GTTCGGCAAAAGCCCTCAAGTGCTGAAGAC
Equus_caballus|23003               AATCTTTATTATGAG---------------GTTCGACAGAAGCCCTCCAACACTGAAGAT
Tarsius_syrichta|6032              AATCTTTATTATGAG---------------GTTCGGCAGAAGCCCTCAAACACTGAAGAT
Canis_familiaris|15952             AATCTTTATTATGAG---------------ATTCGGCAGAAGCCCTCCAACACGGAAGAT
Loxodonta_africana|9089            AATCTTTATTATGAG---------------GTTCGGCAGAAGCCCTCAAACACCGAAGAT
Sus_scrofa|14768                   AATCTCTATTATGAG---------------GTTCGGCAGAAGCCCTCAAATACTGAAGAT
Bos_taurus|22032                   AATCTCTATTATGAG---------------GTTCGGCAGAAGCCCTCAAACACTGAAGAT
Ochotona_princeps|8552             AATCTTTATTATGAG---------------GTTCGGCAGAAGCCCTCAAACACTGAAGAT
Callithrix_jacchus|7966            AATCTTTATTATGAG---------------GTTCGGCAGAAGCCCCCAAACACTGAAGAT
Gorilla_gorilla|11787              AATCTATATTATGAG---------------GTTCGGCAGAAGCCCTCAAACACTGAAGAT
Homo_sapiens|20815                 AATCTATATTATGAG---------------GTTCGGCAGAAGCCCTCAAACACTGAAGAT
Pan_troglodytes|9474               AATCTATATTATGAG---------------GTTCGGCAGAAGCCCTCAAACACTGAAGAT
Pongo_abelii|6151                  AATCTATATTATGAG---------------GTGCGGCAGAAGCCCTCAAACACTGAAGAT
Rhesus_macaque|7159                AATCTATATTATGAG---------------GTTCGGCAGAAGCCCTCAAACACTGAAGAT
Cavia_porcellus|12012              AATCTTTATTATGAG---------------GTTCGACAAAAGCCTTCAAATACGGAAGAT
Spermophilus_tridecemlineatus|6326 AATCTTTACTATGAG---------------GTTCGGCAAAAGCCTTCAAACACTGAAGAT

Ornithorhynchus_anatinus|6525      TCCCCCGGCCCCTCACCGCGTCtcccgaccgcttcgtacagagctccgcacctaGCGGCA
Fugu_rubripes|46645                ---------------------------------------AGAGGTGGG------------
Branchiostoma_floridae|33431       ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------

Fugu_rubripes|46645                ------------------------------------------ACAGTTCAGCTG------
Branchiostoma_floridae|33431       ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------

Fugu_rubripes|46645                ------------------------------------------------------------
Branchiostoma_floridae|33431       ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------

Culex_quinquefasciatus|8590        CACCAGAGGTGGatgagcaacgaggtgcaggcggtggtggccacggtcgcgttcgggatg
Fugu_rubripes|46645                ------------------------------GTGGTCGTCGCTACAGTGGCGTTCGGGATG
Branchiostoma_floridae|33431       ------------------------------------------------------------
Felis_catus|36592                  ---------------------------AAGATAGTAGTGGCCACGGTTGCATTTGATACG

Culex_quinquefasciatus|8590        ggcatcgacaaggcggacgtgcggttcgtgattcatcacacgattagcaaaagtatggag
Branchiostoma_floridae|33431       ------------------------------------------------------------

Culex_quinquefasciatus|8590        aatttctaccaggaaagtggccga---gctgggagggatggACGGAGGGCGGATTGCATT
Branchiostoma_floridae|38285       AACTTCTACCAGGAGAGCGGGAGG------------------------------------
Branchiostoma_floridae|33431       ---------------------------------AGAGATGACCAGCCAGCGTACTGTATC
Felis_catus|36592                  ---TATTACCAA------GGATGT---GCAGGC---GATGACATGAAA---GACTGTATT
Xenopus_tropicalis|15685           AATTATTACCAGGAGAGCGGCCGG------------------------------------

Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Branchiostoma_floridae|38285       ------------------------------------------------GCAGAGCAGACC
Xenopus_tropicalis|15685           ------------------------------------TCCATGGTTGTGATGGAGAACGTG

Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Oryzias_latipes|13656              GGTCag---aagaagctgctgcagatggTGGACTTCTGCCAGAATGTGGACCGG------

Ornithorhynchus_anatinus|6525      ------CCGCGGCGC---------------------------------------------
Felis_catus|36592                  ------TGTCACTGTGTATTGATAGCTCAACATTTTGATGAA---------------GCA

Tribolium_castaneum|12529          TGTAACAAAATGTGCGATATTTGCAAACGCGAC---------------------------
Ornithorhynchus_anatinus|6525      ------------TGC---------------------------------------------
Culex_quinquefasciatus|8590        TGCAACCGGATGTGCGACCGGTGCTACCACCGG---------------------------
Caenorhabditis_elegans|9599        TGTCAAAAGCAGTGTGACACTTGTGAAAATGGA---------------------------
Pediculus_humanus|9206             TGTAATAAAATGTGTGATCACTGCAAAGAAGAG---------------------------
Nasonia_vitripennis|10339          TGCAAGGAGATGTGCGATCACTGCAAGAAAGCT---------------------------
Apis_mellifera|29709               TGTGCAGAAATGTGTGATCATTGTCGGAAACTT---------------------------
Linepithema_humile|1088            TGCGTTCAAATGTGCGATCATTGCAGGAAGCCG---------------------------
Pogonomyrmex_barbatus|4791         TGCGCCAAGATGTGCGATCATTGCAGAAAGCCT---------------------------
Ixodes_scapularis|18877            TGCAACGGTATGTGCGACAACTGCGACTCCACA---------------------------
Bombyx_mori|7387                   TGCAATAAGATGTGTGACGTTTGCAGTACCAGT---------------------------
Danio_rerio|22894                  TGCAATGAAATGTGTGATGTCTGTCGGCATGGC---------------------------
Tetraodon_nigroviridis|17973       TGCCAGCAGATGTGCGACACCTGCCGCCACGCC---------------------------
Fugu_rubripes|46726                TGCCAGCAGATGTGCGATACCTGTCGCCACCCT---------------------------
Gasterosteus_aculeatus|8508        TGCAACCAGATGTGTGATACTTGCCGCCGTGTA---------------------------
Oryzias_latipes|13656              TGTAACCAGATGTGTGACACCTGCCGACACCCA---------------------------
Branchiostoma_floridae|38285       TGCAGCGGCATGTGCGACGTCTGTGACCCTACA---------------------------
Branchiostoma_floridae|33431       TGCAGCGGCATGTGCGATGTCTGTGACCCGACA---------------------------
Nematostella_vectensis|3863        TGCAAGCAGATGTGCGATAACTGCTCAAGGAGA---------------------------
Ornithorhynchus_anatinus|6616      TGCAACGGCATGTGCGACAACTGCCGACGGGAA---------------------------
Sorex_araneus|4441                 TGCGACGGGATGTGCGACAACTGCTGCAAGGAC---------------------------
Echinops_telfairi|18862            NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---------------------------
Felis_catus|36592                  TGCAAGAAAATGTGTGATAACTGTAAAGGCATT---------------------------
Microcebus_murinus|2859            TGTAACAAAATGTGTGATAACTGCTGTAAAGAT---------------------------
Myotis_lucifugus|5822              TGCAACAAAATGTGTGATAATTGCTGCAAAGAC---------------------------
Otolemur_garnettii|4925            NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---------------------------
Macropus_eugenii|9309              TGCAACAAAATGTGTGATAACTGCCGTAAAGAC---------------------------
Procavia_capensis|16727            TGTAACAAAATGTGTGATAACTGCTGTAAAGAC---------------------------
Anolis_carolinensis|3998           TGTAACAAAATGTGTGACAACTGCTGCCGAGAG---------------------------
Dipodomys_ordii|16649              TGTGACAGGATGTGTGACAACTGCTGTACAGAC---------------------------
Gallus_gallus|1176                 TGCAACAGAATGTGTGATAACTGCTGTAGAGAG---------------------------
Xenopus_tropicalis|15685           TGCAACAAGATGTGCGATAACTGCAACAGCGAG---------------------------
Dasypus_novemcinctus|7738          TGTAACAAAATGTGTGATAATTGCTGTAAAGAC---------------------------
Tursiops_truncatus|8298            TGCAACAAAATGTGTGATAATTGCTGTAAAGAG---------------------------
Choloepus_hoffmanni|2463           TGTAACAAAATGTGTGATAATTGTTCTAAAGGC---------------------------
Erinaceus_europaeus|12349          TGTAGCAAGATGTGTGATAACTGCTGTAGAGAC---------------------------
Tupaia_belangeri|4654              TGTAACAAAATGTGTGATAACTGCTGTAAAAAC---------------------------
Pteropus_vampyrus|17753            TGTAACAAAATGTGTGATAATTGCTGTAAAGAC---------------------------
Vicugna_pacos|5884                 TGTAACAAAATGTGTGATAACTGCTGTAAAGAC---------------------------
Rattus_norvegicus|26410            TGTAACAAAATGTGTGACAACTGCTGTAAAGAC---------------------------
Monodelphis_domestica|30602        TGCAACAAAATGTGTGATAACTGCTGTAAAGAT---------------------------
Echinops_telfairi|19173            GGTAACAAAATGTGTGCCCACTGCTGTAAAGAC---------------------------
Mus_musculus|37053                 TGTAACAAAATGTGTGACAACTGCTGTAAAGAC---------------------------
Equus_caballus|23003               TGTAACAAAATGTGTGATAACTGCTGTAAAGAA---------------------------
Tarsius_syrichta|6032              TGTAACAAAATGTGTGATAACTGCTGTAAAGAT---------------------------
Canis_familiaris|15952             TGCAACAGAATGTGTGATAATTGTTGTAAAGAC---------------------------
Loxodonta_africana|9089            TGTAACAAAATGTGTGATAACTGCTGTAAAGAC---------------------------
Sus_scrofa|14768                   TGTAACAAAATGTGTGATAATTGCTGTAAAGAT---------------------------
Bos_taurus|22032                   TGTAACAAAATGTGTGATAACTGCTGTAAAGAG---------------------------
Ochotona_princeps|8552             TGTAACAAAATGTGTGATAACTGCTGCAAAGAC---------------------------
Callithrix_jacchus|7966            TGTAACAAAATGTGTGATAATTGCTGTAAAGAC---------------------------
Gorilla_gorilla|11787              TGTAACAAAATGTGCGATAATTGCTGTAAAGAC---------------------------
Homo_sapiens|20815                 TGTAACAAAATGTGCGATAACTGCTGTAAAGAC---------------------------
Pan_troglodytes|9474               TGTAACAAAATGTGCGATAACTGCTGTAAAGAC---------------------------
Pongo_abelii|6151                  TGTAACAAAATGTGCGATAACTGCTGTAAAGAC---------------------------
Rhesus_macaque|7159                TGTAACAAAATGTGTGATAACTGCTGTAAAGAC---------------------------
Cavia_porcellus|12012              TGTAACAAAATGTGTGATAACTGCTGTAAAGAC---------------------------
Spermophilus_tridecemlineatus|6326 TGTAATAAAATGTGTGATAACTGCTGTAAAGAC---------------------------

Tribolium_castaneum|12529          ------------------GTA------AAA---------ATTCCCGCCTATTATGACCTA
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------GAC------AAG------GTCACGCTGCCCGAGCAGGACATC
Caenorhabditis_elegans|9599        ------------------AATGGATTCGTTGGGACTTCTTCAAAAGAATCTACAGATGTC
Pediculus_humanus|9206             ------------------CCA------AAT------------TTTAAGGAAATAGACATA
Nasonia_vitripennis|10339          ------------------AAG------AAG------------AAGAAGGAAATGGACATA
Apis_mellifera|29709               ------------------AAA------GAC------------AATAAACAAATAAATATA
Linepithema_humile|1088            ------------------GAA------GTC------------AAGAAGGAAGTTGACGTA
Pogonomyrmex_barbatus|4791         ------------------AGT------GTT------------AAAAAAGAAATTGACATA
Ixodes_scapularis|18877            ------------------GTG------TCA---------TCCACAAAGGAGGTCGACGTT
Bombyx_mori|7387                   ------------------CAA------TCA------GATTCACCCAAAGATTTGGATCTT
Danio_rerio|22894                  ------------------AAC------GAC------------TACATCACAATGGACATC
Tetraodon_nigroviridis|17973       ------------------AAA------GAG------------GTCGTCGCGACTGACATC
Fugu_rubripes|46726                ------------------AAA------GAC------------GTCTCCACAGTGGATATC
Gasterosteus_aculeatus|8508        ------------------AAA------GAC------------TACACCACTGTGGACATT
Oryzias_latipes|13656              ------------------GCA------GGC------------TACAACACCCTGGATGTA
Branchiostoma_floridae|38285       ------------------TTA------GTC------ACCGTAACAAATGAAGAAGACGTG
Branchiostoma_floridae|33431       ------------------TTA------GTC------ACTGTAACAGATGAAGAAGACGTG
Nematostella_vectensis|3863        ------------------GAC------GATGAGAGAGGTCTTAATGAGCTACACGACATC
Ornithorhynchus_anatinus|6616      ---------------------------ACG------------------------------
Sorex_araneus|4441                 ------------------ACG------GCA------------CCTGAAAGGAAGGACATC
Echinops_telfairi|18862            ------------------NNN------NNN------------NNNNNNNNNNNNNNNNNN
Felis_catus|36592                  ---------------------------GCG------------TGTGAAGTAAAGAATGTA
Microcebus_murinus|2859            ------------------ATT------TCA------------TGTGAAAGAAAAAATGTA
Myotis_lucifugus|5822              ------------------ATT------TCA------------TTTGAAAGAAAGAATGTA
Otolemur_garnettii|4925            ------------------NNN------NCA------------TTTGAAAGAAAAAATGTA
Macropus_eugenii|9309              ------------------ATT------TTA------------TTTGAAAAGAAGAATGTA
Procavia_capensis|16727            ------------------ATT------TCA------------TTTGACAGAAAGAATGTA
Anolis_carolinensis|3998           ------------------GAG------CCG------------TTTGAAAAAATAGATGTG
Dipodomys_ordii|16649              ------------------GCG------GCA------------GTGGAGGAGAAGAACGTC
Gallus_gallus|1176                 ------------------AAC------TCA------------CTTGAGAAAAAGGATATC
Xenopus_tropicalis|15685           ------------------GGG------GGC------------TGGGAAAAAGCCGACATC
Dasypus_novemcinctus|7738          ------------------ATT---------------------------------------
Tursiops_truncatus|8298            ------------------ATT------TCA------------TCTGAAAGAAAGAACATA
Choloepus_hoffmanni|2463           ------------------ATT------TCA------------TTTGAAAGAAAGAATGTA
Erinaceus_europaeus|12349          ------------------ATC------TCA------------TTTGAAAGGAAGAATGTG
Tupaia_belangeri|4654              ------------------ATC------TCA------------TTTGAAAGAAAGAATGTA
Pteropus_vampyrus|17753            ------------------ATT------TCA------------TTTGAAAGAAAGAATGTA
Vicugna_pacos|5884                 ------------------ATT------TCA------------TTTGAAAGGAAGAACATA
Rattus_norvegicus|26410            ------------------GAC------TCG------------TTTGAGAAAAAGAATATA
Monodelphis_domestica|30602        ------------------ATT------TCA------------TTTGAAAAGAAGAATGTA
Echinops_telfairi|19173            ------------------ATT------TCA------------TGGGGAAAAAAGAATGTA
Mus_musculus|37053                 ------------------GTT------TCG------------TTTGAGAAAAAGAATGTG
Equus_caballus|23003               ------------------ATT------TCA------------TTTGAAAGAAAGGATGTA
Tarsius_syrichta|6032              ------------------ATT------TCA------------TTTGAAAGAAAGAATATA
Canis_familiaris|15952             ------------------ATT------TCA------------TGTGAAAGAAAGAATGTC
Loxodonta_africana|9089            ------------------ATT------TCA------------TTTGACAGAAAGAATGTA
Sus_scrofa|14768                   ------------------ACT------TCA------------TTTGAGAGAAAGAACATA
Bos_taurus|22032                   ------------------ATT------TCA------------TTTGAAAGAAAGAATGTA
Ochotona_princeps|8552             ------------------ATT------TCA------------TACGAAAAACAAAATGTC
Callithrix_jacchus|7966            ------------------ATT------TCA------------TTTGAAAGAAAGAATGTA
Gorilla_gorilla|11787              ------------------AGT------GCA------------TTTGAAAGAAAGAATATA
Homo_sapiens|20815                 ------------------AGT------GCA------------TTTGAAAGAAAGAACATA
Pan_troglodytes|9474               ------------------AGT------GCG------------TTTGAAAGAAAGAATATA
Pongo_abelii|6151                  ------------------AGT------GCA------------TTTGAAAGAAAGAATATA
Rhesus_macaque|7159                ------------------AGT------GCA------------TTTGAAAGAAAGAATATA
Cavia_porcellus|12012              ------------------GTT------TCA------------TTTGAAAAAAAGAACGTA
Spermophilus_tridecemlineatus|6326 ------------------ATT------TCA------------TTTGAAAAAAAGAATATA

Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ---------------------------------------------------CGTGAGNGG
Felis_catus|36592                  ACAGCATACTGCAGAGATCTACAG------ATTAAGCAG------------GCAGAGGAC
Procavia_capensis|16727            ACCGAGTACTGCAGGGATCTAGTCAAGATC---AAGCAG------------GCAGAGGAG
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Echinops_telfairi|19173            ACGGAG---------GATCTCATCAAGATCCTGAAGCAG------------GCAGAGGAC

Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Tetraodon_nigroviridis|17973       CTGGACGAGAAGATGACTCCTctgaagctggtggaggcctgGACCGGGAGA------GGC
Ornithorhynchus_anatinus|6616      GCAAGTCAGCCTCCTACG------------------GTCTGGGCCTATTCCTCCTCCGGA
Dasypus_novemcinctus|7738          ------------------------------------------------------------

Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Caenorhabditis_elegans|9599        TCGAGAAAT------------------------------------CGAGAGTTTTGTGAA
Ornithorhynchus_anatinus|6616      AAATGGGGCTGGAGA------------------CCGGGAGCCCCACGGGGGATTACATCA
Dasypus_novemcinctus|7738          ------------------------------------------------------------

Tribolium_castaneum|12529          CTCGTTATCGCCTTCCTTTTGCTAGAAAAATACCTAGCAATT------------------
Ornithorhynchus_anatinus|6525      ---------------------ttaagcgcttac---------------------------
Culex_quinquefasciatus|8590        CAGTTGGTGGCGTTTTTGATCGTGAACGACTACCTGAAGGAG------------------
Caenorhabditis_elegans|9599        AAGCTGATTGTCAATCTTTTGCTAGAAGGCTATCTTCAAGAA------------------
Pediculus_humanus|9206             AAAATTATCGGGTATTTGTTAAGCATGAGATATTTGAAAGAA------------------
Nasonia_vitripennis|10339          GCCGTCGTCGGGTACCTGCTGGTCAACGGGTACTTGCAAGAG------------------
Apis_mellifera|29709               GCTATAATAGGACATTTACTTGTGAATGGTTATTTACAAGAA------------------
Linepithema_humile|1088            GCTATTATAGGACACTTGCTGGTGAACGGTTACTTACAAGAG------------------
Pogonomyrmex_barbatus|4791         GCTATCATAGGACATCTGCTAATAAACGGATATCTGCAAGAG------------------
Ixodes_scapularis|18877            GCCATTGTCACCTTCTGCCTGCTGGAGGGTTACCTAAGCGAA------------------
Bombyx_mori|7387                   GATGTTATAGCATTTTTATTAATAAACGGTTATTTAGTAGAA------------------
Danio_rerio|22894                  TCTGTTATCATCCACCTTTTGTTGCATGGCTACTTCAGTGAG------------------
Fugu_rubripes|46645                GCTGTGGTcgtacagctgctgctgaaggattATCTCAGAAGGACGGACATCAGGAAAGAT
Tetraodon_nigroviridis|17973       GCCGTGGtggtgcggctgctgctgaaggattATCTCAGCGGG------------------
Fugu_rubripes|46726                GCTGTGGTcgtacagctgctgctgaaggattATCTCAGTGGG------------------
Gasterosteus_aculeatus|8508        GCTATGGTTGTGACGATGCTGCTGCAGGGATACCTCAGAGAC------------------
Oryzias_latipes|13656              GCAGTGATCgtcttcctgctgctgcagggaTACCTGAGAGAG------------------
Branchiostoma_floridae|38285       AGGGTGATCACCCACATGTTACTGGAAGGGTACCTGAGGGAG------------------
Branchiostoma_floridae|33431       AGAGTGATCACCCACATGTTACTGGAGGGGTACCTGAGGGAG------------------
Nematostella_vectensis|3863        AGGGTGGTGGTGCACCTAGTGGTAGAGGGTGTCTTGAGGGAG------------------
Ornithorhynchus_anatinus|6616      GTACTACTAGCGTTGGCATTGTTTCCGCGGGGCTGCAGGGAG------------------
Sorex_araneus|4441                 AGAGTGGTCGTCCACGGCCTCCTCCAGCAGTACCTCAGGGAA------------------
Echinops_telfairi|18862            NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAG------------------
Felis_catus|36592                  AAAATTATTGCACACTTTCTTCTACAGCAGTATCTTAAAGAA------------------
Microcebus_murinus|2859            AAAATTGTTGCACACTTTCTTCTACAGCAGTATCTTAAAGAA------------------
Myotis_lucifugus|5822              AAAATTATTGCGCACTTTCTTCTACAGCAGTATCTTAAAGAA------------------
Otolemur_garnettii|4925            AAAATCATTGCACACTTTCTTCTACAGCAGTATCTTAAAGAA------------------
Macropus_eugenii|9309              AAAATTATTGCTCACTTCCTCCTACAACAGTATCTTAAAGAA------------------
Procavia_capensis|16727            AGAATCATCGCGCACTTGCTTCTGCAGCAGTATCTGAAAGAA------------------
Anolis_carolinensis|3998           AGAATCATTGCCCATTTGATACTGCAGCAGTACCTGAAGGAA------------------
Dipodomys_ordii|16649              AAAATCATCGCGCACCTGCTCCTGCAGCAGTACCTCAGNNNN------------------
Gallus_gallus|1176                 AGAATTATTGCCCATTTACTGCTGCAGCAGTATCTGAGGGAA------------------
Xenopus_tropicalis|15685           CGAATTATTGCCCACCTTCTGCTGCAGCAGTTCCTCAGG---------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            AAAATTATTGCGCACTTTCTTATACGGCAGTATCTCAAAGAA------------------
Choloepus_hoffmanni|2463           AAAATTATTGCGCACTGTCTTCTACAGCAGTATCTTAAAGAA------------------
Erinaceus_europaeus|12349          AAAATCATTGCACACTTTCTTCTACAGCAGTACCTT------------------------
Tupaia_belangeri|4654              AAAGTCATTGCACACTTTCTTCTACAGCAGTATCTCAAAGAA------------------
Pteropus_vampyrus|17753            AAAATTATTGCACACTTTCTTCTGCAGCAGTATCTTAAAGAA------------------
Vicugna_pacos|5884                 AAGATCATCGCGCACGTCCTCATACAGCAGTATCTCAGAGAA------------------
Rattus_norvegicus|26410            AAAATCATCGTACATGCTCTCCTGCAGCAGTATCTCAAGGAA------------------
Monodelphis_domestica|30602        AAAATTATTGCTCACTTCATCCTACAACAGTATCTTAAAGAA------------------
Echinops_telfairi|19173            AAGATCATTGCGCGCTTCCTTCTACAGCAGTATCGTGCAGAG------------------
Mus_musculus|37053                 AGAATCGTCGCCCACGCCCTCCTGCAGCAATATCTCAAAGAA------------------
Equus_caballus|23003               AAAATGATCGCGCACTTCCTTCTACAGCAGTATCTTAAAGAA------------------
Tarsius_syrichta|6032              AAAATTATTGCTCACTTTCTTCTACAGCAGTATCTTAAAGAA------------------
Canis_familiaris|15952             AAAATTATTGCACACCTTCTTCTACAGCAGTATCTTAAAGAA------------------
Loxodonta_africana|9089            AAAATCATCGCGCACTTCCTTCTACAGCAGTATCTTAAAGAA------------------
Sus_scrofa|14768                   AAAATTATTGCCCACTTTCTCATACAGCAGTATCTCAAAGAA------------------
Bos_taurus|22032                   AAAATCATTGCACACTTTCTCATACAGCAGTATCTCAAAGAA------------------
Ochotona_princeps|8552             AAGATGGTCGCACACTTCCTTCTGCAGCAGTATCTCAGGGAA------------------
Callithrix_jacchus|7966            AAAATTATTGCACACTTCCTAATACAGCAGTATCTTAAAGAA------------------
Gorilla_gorilla|11787              AAGATTATTGCACACTTTCTAATACAGCAGTATCTTAAAGAA------------------
Homo_sapiens|20815                 AAGATTATTGCACACTTTCTAATACAGCAGTATCTTAAAGAA------------------
Pan_troglodytes|9474               AAGATTATTGCACACTTTCTAATACAGCAGTATCTTAAAGAA------------------
Pongo_abelii|6151                  AAGATTATTGCACACTTTCTAATACAGCAGTATCTTAAAGAA------------------
Rhesus_macaque|7159                AAGATTATTGCACACTTTCTAATACAGCAGTATCTTAAAGAA------------------
Cavia_porcellus|12012              AAAATGATAGCGCACTTTCTTCTACAGCAGTATCTGAAAGAA------------------
Spermophilus_tridecemlineatus|6326 AAAATCATTGCACACTTTCTTCTACAGCAGTATCTTAAAGAA------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Branchiostoma_floridae|38285       ------------------------------------------------------------
Branchiostoma_floridae|33431       ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------GATAAGGGGTACACCATG
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------GAGTTCCAGTACAACGCG
Caenorhabditis_elegans|9599        ------------------------------------------GATTTCCATTATACCGTA
Pediculus_humanus|9206             ------------------------------------------GATTTTCATTACACAGCT
Nasonia_vitripennis|10339          ------------------------------------------GATTTCCACTTCTCGGCT
Apis_mellifera|29709               ------------------------------------------GACTTTCATTTCTCTGCA
Linepithema_humile|1088            ------------------------------------------GATTTTCACTTCTCCTCG
Pogonomyrmex_barbatus|4791         ------------------------------------------GACTTTCATTATTCGGCA
Ixodes_scapularis|18877            ------------------------------------------CGGTTCCACACGACACCC
Bombyx_mori|7387                   ------------------------------------------GATTTTCATTTCACTGCT
Danio_rerio|22894                  ------------------------------------------GACTTCAGCTTCACTCCC
Tetraodon_nigroviridis|17973       ------------------------------------------GACTTCAGCTTCACTCCA
Fugu_rubripes|46726                ------------------------------------------GACTTCAGCTTCACTCCA
Gasterosteus_aculeatus|8508        ------------------------------------------GATTTCAGCTTCACACCA
Oryzias_latipes|13656              ------------------------------------------GACTTCAGCTTTACTCCG
Branchiostoma_floridae|38285       ------------------------------------------GACTATCACTTCACTCCC
Branchiostoma_floridae|33431       ------------------------------------------GACTATCACTTCACTCCC
Nematostella_vectensis|3863        ------------------------------------------GAGTTTCACTTTACACCC
Ornithorhynchus_anatinus|6616      ------------------------------------------GACTTCAGCTTCACGGCT
Sorex_araneus|4441                 ------------------------------------------GATTACAGTTTCACGGCC
Echinops_telfairi|18862            ------------------------------------------GACTACAGCTTTACAGCA
Felis_catus|36592                  ------------------------------------------GACTACAGTTTTACAGCT
Microcebus_murinus|2859            ------------------------------------------GACTACAGTTTTACAGCT
Myotis_lucifugus|5822              ------------------------------------------GACTACAGTTTTACAGCT
Otolemur_garnettii|4925            ------------------------------------------GACTACAGTTTTACAGCG
Macropus_eugenii|9309              ------------------------------------------GACTTCAGTTTTACAGCA
Procavia_capensis|16727            ------------------------------------------GACTACAGTTTTACAGCT
Anolis_carolinensis|3998           ------------------------------------------GACTTTAGTTTTACATCA
Dipodomys_ordii|16649              ------------------------------------------NNNNNNNNNNNNNNNNNN
Gallus_gallus|1176                 ------------------------------------------GACTTCAGCTTCACTGCA
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------GACTACAGTTTTACAGCT
Choloepus_hoffmanni|2463           ------------------------------------------GACTACAGTTTTACAGCT
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------GACTACAGTTTTACTGCA
Pteropus_vampyrus|17753            ------------------------------------------GACTACAGTTTTACAGCC
Vicugna_pacos|5884                 ------------------------------------------GACTACAGCTTTACAGCT
Rattus_norvegicus|26410            ------------------------------------------GACTACAGCTTCACGGCT
Monodelphis_domestica|30602        ------------------------------------------GACTTCAGTTTTACAGCA
Echinops_telfairi|19173            ------------------------------------------GACTACAGCTTTACAGCA
Mus_musculus|37053                 ------------------------------------------GACTACAGCTTCACGGCT
Equus_caballus|23003               ------------------------------------------GACTACAGTTTCACAGCT
Tarsius_syrichta|6032              ------------------------------------------GACTACAGTTTTACAGCT
Canis_familiaris|15952             ------------------------------------------GACTACAGTTTCACAGCT
Loxodonta_africana|9089            ------------------------------------------GACTACAGTTTTACAGCT
Sus_scrofa|14768                   ------------------------------------------GACTACAGTTTTACGGCT
Bos_taurus|22032                   ------------------------------------------GACTACAGTTTTACAGCT
Ochotona_princeps|8552             ------------------------------------------GACTACAGTTTCACAGCG
Callithrix_jacchus|7966            ------------------------------------------GACTACAGTTTTACAGCT
Gorilla_gorilla|11787              ------------------------------------------GACTACAGTTTTACAGCT
Homo_sapiens|20815                 ------------------------------------------GACTACAGTTTTACAGCT
Pan_troglodytes|9474               ------------------------------------------GACTACAGTTTTACAGCT
Pongo_abelii|6151                  ------------------------------------------GACTACAGTTTTACAGCT
Rhesus_macaque|7159                ------------------------------------------GACTACAGTTTTACAGCT
Cavia_porcellus|12012              ------------------------------------------GACTACAGTTTCACAGCT
Spermophilus_tridecemlineatus|6326 ------------------------------------------GACTATAGTTTTACAGCT

Tribolium_castaneum|12529          TATTCCACGGTTTCCTACATCGTCAAAGGG------------------------------
Ornithorhynchus_anatinus|6525      ---------------------------ggt------------------------------
Caenorhabditis_elegans|9599        TATTCAGTTATCAGCTATGTGGTAATCGGA------------------------------
Pediculus_humanus|9206             TACAGCACAATAAGTTACATCAACAAGGGC------------------------------
Nasonia_vitripennis|10339          TACTCTACGATTACGTATATCAAGAGGGGA------------------------------
Apis_mellifera|29709               TATTCCACAATATCATATATAAAACGTGGA------------------------------
Linepithema_humile|1088            TATTCTACGATATCGTACCTCAAACGTGGA------------------------------
Pogonomyrmex_barbatus|4791         TATTCCACGATATCACGATTAAAA------------------------------------
Ixodes_scapularis|18877            TATGCCTACATCAGCTACCTCGAGGCAGGT------------------------------
Bombyx_mori|7387                   TATTCGACTATAAGCTACCTAAAAATAGGT------------------------------
Danio_rerio|22894                  TACACAACACACTTCTACCTGAAGCTGGGT------------------------------
Fugu_rubripes|46645                TACACCACCTACTTCTACATAAAGCTGGGC------------------------------
Tetraodon_nigroviridis|17973       TACACCACCTACTTCTACATCAAGCCGGGC------------------------------
Fugu_rubripes|46726                TACACCACCTACTTCTACATAAAGCTGGGC------------------------------
Gasterosteus_aculeatus|8508        TACACCACCTACTTCTACGTGAGGCTGGGC------------------------------
Oryzias_latipes|13656              TACACCACGTACTTCTACGTGAAGCTCGGC------------------------------
Branchiostoma_floridae|38285       TACAGTACCATCAGCTATTTAGTACCAGGA------------------------------
Branchiostoma_floridae|33431       TACAGTACCATCAGCTATCTGGTCCCAGGC------------------------------
Nematostella_vectensis|3863        TACTCGACCATCAGTTACATTGTTAAGGGT------------------------------
Ornithorhynchus_anatinus|6616      TTCGCTACCATTTCCTATCTGAAAAAAGGA------------------------------
Sorex_araneus|4441                 TACGCTACCATTTCCTATTTGAAAACCGGA------------------------------
Echinops_telfairi|18862            TATGCGACCATTTCATATCTGAAAATAGGA------------------------------
Felis_catus|36592                  TACGCTACCATTTCATATTTGAAAATAGGA------------------------------
Microcebus_murinus|2859            TATGCTACCATTTCGTATTTGAAAATAGGA------------------------------
Myotis_lucifugus|5822              TACGCTACCATTTCCTATTTGAAAACAGGA------------------------------
Otolemur_garnettii|4925            TATGCCACCATTTCGTATCTGAAAATAGGA------------------------------
Macropus_eugenii|9309              TATGCTACTATTTCATACTTGAAAATAGGC------------------------------
Procavia_capensis|16727            TATGCCACCATTTCATACTTGAAGATAGGA------------------------------
Anolis_carolinensis|3998           TTTACTACAATTTCCTATGTGAAGATAGGT------------------------------
Dipodomys_ordii|16649              NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------------------------------
Gallus_gallus|1176                 TTTGCCACAATATCCTACCTGAAGATAGGA------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            TATGCGACCATCTCATATCTGAAAATAGGA------------------------------
Choloepus_hoffmanni|2463           TATGCTACCATTTCATATTTGAAAATAGGA------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              TACGCTACCATTTCATATTTGAAGATAGGA------------------------------
Pteropus_vampyrus|17753            TATGCCACCATTTCATATTTGAAAATAGGA------------------------------
Vicugna_pacos|5884                 TATGCTACCATTTCATATTTGAAAATAGGA------------------------------
Rattus_norvegicus|26410            TATGCTACCATCTCGTATCTGAAGGTGGGA------------------------------
Monodelphis_domestica|30602        TATGCTACTATTTCATATTTGAAAGTAGGC------------------------------
Echinops_telfairi|19173            TATGCGACCATTTCATATCTGAAA---GGG------------------------------
Mus_musculus|37053                 TACGCCACCATCTCCTATCTGAAGGTGGGA------------------------------
Equus_caballus|23003               TTTGCTACCATTTCATATTTGAAAACAGGA------------------------------
Tarsius_syrichta|6032              TATGCTACTATTTCATATTTGAAAATAGGA------------------------------
Canis_familiaris|15952             TATGCTACCATTTCATATTTGAAAATAGGA------------------------------
Loxodonta_africana|9089            TATGCTACCATTTCCTATTTGAAAATAGGA------------------------------
Sus_scrofa|14768                   TATGCTACCATCTCCTACTTGAAAATAGGA------------------------------
Bos_taurus|22032                   TACGCTACCATTTCATATTTGAAAGTAGGA------------------------------
Ochotona_princeps|8552             TATGCTACCATTTCTTATTTGAAGATAGGA------------------------------
Callithrix_jacchus|7966            TATGCTACCATTTCATATTTGAAAATAGGA------------------------------
Gorilla_gorilla|11787              TATGCTACCATTTCGTATTTGAAAATAGGA------------------------------
Homo_sapiens|20815                 TATGCTACCATTTCGTATTTGAAAATAGGA------------------------------
Pan_troglodytes|9474               TATGCTACCATTTCGTATTTGAAAATAGGA------------------------------
Pongo_abelii|6151                  TATGCTACCATTTCGTATTTGAAAATAGGA------------------------------
Rhesus_macaque|7159                TATGCTACCATTTCATATTTGAAAATAGGA------------------------------
Cavia_porcellus|12012              TATGCTACTATTTCATATCTGAAAGTTGGA------------------------------
Spermophilus_tridecemlineatus|6326 TATGCTACCATATCGTACTTGAAAATAGGA------------------------------

Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Caenorhabditis_elegans|9599        ---------------------------TCGAAATGGCGGGTTTATAATGGAAAAGATGCG
Pediculus_humanus|9206             ---------------------------CCCATGTGGATTCACGTGACCGATTCGGATCAT
Nasonia_vitripennis|10339          ---------------------------CCGAAGTCGGGGATGGCCCTGGCGAACGATCAC
Apis_mellifera|29709               ---------------------------CCCAAAGCAGTATTAGCACTTGATACTACTCAT
Linepithema_humile|1088            ---------------------------CCTAAGTCGGGACTAGCTCTCAGCAACGATCAT
Pogonomyrmex_barbatus|4791         ---------------------------------------TTCATTGACAATTCCACAATT
Ixodes_scapularis|18877            ---------------------------CCGATGAAAGAGGCAGTGAAAAAAGGGGCCAAG
Bombyx_mori|7387                   ---------------------------CCTGAAATGTCAGGAGTAAATAATGATGGCTTT
Danio_rerio|22894                  ---------------------------CGTAAGGCAGCCCTCCTGAAGAACAGCGGTCAC
Fugu_rubripes|46645                ---------------------------ACGAGAGCCTCCCTGCTGAGAAACCAGAGTCAC
Tetraodon_nigroviridis|17973       ---------------------------AGCAGAGCCCCCCTGCTGAGAAACCAGAGTCAC
Fugu_rubripes|46726                ---------------------------ACGAGAGCCTCCCTGCTGAGAAACCAGAGTCAC
Gasterosteus_aculeatus|8508        ---------------------------CGCAAAGCTCCTCTGCTGAAGAGCCAGACTCAC
Oryzias_latipes|13656              ---------------------------CGCAGAGCTCCTCTGCTGAAGAACCAGGCTCAC
Branchiostoma_floridae|38285       ---------------------------CCCAAGAGCCACCGCCTGACGAGCGGAGGGGTG
Branchiostoma_floridae|33431       ---------------------------CCCAAGAGCCATCGCCTGACAAGTGGAGGAGTG
Nematostella_vectensis|3863        ---------------------------GCTAATGCTGGTATGCTG---------------
Ornithorhynchus_anatinus|6616      ---------------------------TCCAGGGCTCACCTCCTGACAGACGACAGTCAC
Sorex_araneus|4441                 ---------------------------CCCAAAGCTCATCTGCTCCAGAACACGGCGCAT
Echinops_telfairi|18862            ---------------------------CCTAAAGCCAATCTTCTGAACAATGAGGCACAC
Felis_catus|36592                  ---------------------------CCTAAAGCTCATCTTCTGAATAATGAGGCGCAT
Microcebus_murinus|2859            ---------------------------CCTAAAGCTAATCTTCTGAACAATGAGGCCCAT
Myotis_lucifugus|5822              ---------------------------CCTAAAGCTCATCTTCTGAACAACGAGGCGCAT
Otolemur_garnettii|4925            ---------------------------CCTAAAGCCAATCTTCTGAACAGTGAGGCCCAT
Macropus_eugenii|9309              ---------------------------CCTAAAGCTCATCTTCTGAATAATGAGGAATAT
Procavia_capensis|16727            ---------------------------CCTAAAGCTAATCTTCTGAACAATGAGGCACAT
Anolis_carolinensis|3998           ---------------------------CCCAAAGCTGATCTTCTGAAAAATAAGGGACAT
Dipodomys_ordii|16649              ---------------------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Gallus_gallus|1176                 ---------------------------CCAAAAGCAGGTCTGCTGAGAAACGAGGCACAC
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ---------------------------CCTAAAGCTAATCTTCTGAACAATGAGGAACAT
Choloepus_hoffmanni|2463           ---------------------------CCCAAAGCTAATCTTCTCAACAGTGAAGCACAT
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ---------------------------CCCAAAGCCAATCTGCTGAACAGTGAAGCACAT
Pteropus_vampyrus|17753            ---------------------------CCTAAAGCCAATCTTCTGAACAATGAGGCACAT
Vicugna_pacos|5884                 ---------------------------CCTAAAGCTAATCTTCTGAACAACGAGGCGCAT
Rattus_norvegicus|26410            ---------------------------CCCAGAGCTAGTCTTCTTAGCAACGAAGGCCAT
Monodelphis_domestica|30602        ---------------------------CCTAAAGCTCATCTTCTGAACAACGAGGAACAT
Echinops_telfairi|19173            ---------------------------CCTAATGCCAAT---CTGAACAATGAGGCCCAT
Mus_musculus|37053                 ---------------------------CCCAGAGCTTGTCTTCTCAGCAACGAAGCCCAT
Equus_caballus|23003               ---------------------------CCTAAAGCTGATCTTCTGAACAATGAGGCACAT
Tarsius_syrichta|6032              ---------------------------CCTAAAGCTAATCTTCTGAACAGTGAGACACAT
Canis_familiaris|15952             ---------------------------CCTAAAGCTAATCTTCTAAACAATGAGGCACAT
Loxodonta_africana|9089            ---------------------------CCTAAAGCTAATCTTCTGAACAATGAGGCACAC
Sus_scrofa|14768                   ---------------------------CCTAAAGCTAATCTTTTGAACAATGAGGCACAT
Bos_taurus|22032                   ---------------------------CCTAAAGCTAACCTTCTGAACAACGAGGCACAC
Ochotona_princeps|8552             ---------------------------CCCAAAGCCAGTCTTCTTAACAGTGAGACCCAT
Callithrix_jacchus|7966            ---------------------------CCTAAAGCTAATCTTCTGAACAATGAGGCACAT
Gorilla_gorilla|11787              ---------------------------CCTAAAGCTAATCTTCTGAACAATGAGGCACAT
Homo_sapiens|20815                 ---------------------------CCTAAAGCTAATCTTCTGAACAATGAGGCACAT
Pan_troglodytes|9474               ---------------------------CCTAAAGCTAATCTTCTGAACAATGAGGCACAT
Pongo_abelii|6151                  ---------------------------CCTAAAGCTAATCTTCTGAACAATGAGGCACAT
Rhesus_macaque|7159                ---------------------------CCTAAAGCTAATCTTCTGAACAATGACGCACAT
Cavia_porcellus|12012              ---------------------------CCCAAAGCTAATCTTCTGAACAGTGAAGCACAT
Spermophilus_tridecemlineatus|6326 ---------------------------CCTAAAGCTAATCTTCTGAACAGTGAATCACAT

Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Nasonia_vitripennis|10339          AAGATCATGGTCGAAGTGGATGATCAC---------------------------------
Apis_mellifera|29709               GAAATATTTTTTAATTATGAATTGCAT---------------------------------
Linepithema_humile|1088            AAGATACTCTTTAACTACGAACTGCAC---------------------------------
Pogonomyrmex_barbatus|4791         GACGATTCGCTAGAT---------------------------------------------
Fugu_rubripes|46726                ACCGTCAGCATGAAGATG------------------------------------------
Gasterosteus_aculeatus|8508        ACACTCTGCATGAAGATGAGGTCAACTGGG------------------------------
Oryzias_latipes|13656              AGTCTGAccatgaagatgaagatgtcaGGAGCA---------GAGCCCGTGTCTGTGAGT
Nematostella_vectensis|3863        ------------------------------------------------------------
Felis_catus|36592                  GTTATTACCATGCAAGTAAAGAAGCCCACACAG---------AGTTGTTTCAAG------
Macropus_eugenii|9309              GTAATTACTATGAAAGTAAAGAAAGACATGAAG---------GGTTCTTTGAAG------
Anolis_carolinensis|3998           GTTATCACCATGCAAGTGATAGCAAGCAAAAGC---------AGTATT------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Ochotona_princeps|8552             GCAATCACCATGCAGGTGAAGAAGCCCAACAAG---------AACTGCTTCCGG------
Spermophilus_tridecemlineatus|6326 GTTATTACTATGCAAGTAAAGAAGCGCACACAG---------AGCAATTTCAAG------

Tribolium_castaneum|12529          AAACCAAGAACTGAC---------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Caenorhabditis_elegans|9599        AGTTCAGTTGAAGAAGAAGATGTTATGGTTCTGGAT------------------------
Pediculus_humanus|9206             TCCGACGACAATTTTTTCAGTAGTGTA---------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            CCGCAGCCAAACAAGAAA------------------------------------------
Bombyx_mori|7387                   GCACCTACTGAATTGTTTGAAGAAACA---------------------------------
Danio_rerio|22894                  AAAGTTTCAGAAAGTTCTGGGGAGAAA---------------------------------
Fugu_rubripes|46645                AGAAATGCTGGTAAGGTGGTTGAAGAG---------------------------------
Tetraodon_nigroviridis|17973       AAAGCCCCAGAGGGAAACACCTCACTT---------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              AAACCCCACCGCTCAGGAGAGAAG------------------------------------
Branchiostoma_floridae|38285       GCAGCAGCTGCGTGTGGAACTGCAGCA---------------------------------
Branchiostoma_floridae|33431       GCAGCAGCTACGTGTGGTACTGCAGCA---------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      CCGTTGCCGTGTTCTCATGCCGTGATCGTGCTGTGC------------------------
Sorex_araneus|4441                 CCGTCCCATGCGGGTCACCCCGAAGGG---------------------------------
Echinops_telfairi|18862            TCCTGTGACACTTATAATTCCAAACAA---------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            CCATCCCAAACTTGTCGTTCTGAACGA---------------------------------
Myotis_lucifugus|5822              TCATCTCAAACCTGTCATTCTGAAGGA---------------------------------
Otolemur_garnettii|4925            GCATCTCAAACCAGTCACTCTGAACAA---------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            GCAAACCAAACTTGTCATTTGGAACAG---------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              TCATCCAACACGTCTCGGTCGGATCGA---------------------------------
Gallus_gallus|1176                 CCATCTGAATCTTCAAACTCAGAAGGA---------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            TCACCTCAAAGTTGTCATTCCGAAGGA---------------------------------
Choloepus_hoffmanni|2463           TCATCTCCAACTTGTCATTCTGAACAA---------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              TCATCTCAAACTTGTCCTTCTAAACAA---------------------------------
Pteropus_vampyrus|17753            TCATCTCAAATTTGTCATTCTGAAGAA---------------------------------
Vicugna_pacos|5884                 TCACCTGAAAGCTGTCATTCTGAAGGA---------------------------------
Rattus_norvegicus|26410            TCACCTGAAGCTTGTGAAGTGGATTCA---------------------------------
Monodelphis_domestica|30602        TCATCGCAGGTTTCGAATTCTGAAGCA---------------------------------
Echinops_telfairi|19173            TCCTGTGAAACTTATAATTCCGAACAA---------------------------------
Mus_musculus|37053                 CTGTCTGAAGCTCGTCAGGTGGAACAA---------------------------------
Equus_caballus|23003               CCACCTCAAACTTGTCATCCTGAAGGA---------------------------------
Tarsius_syrichta|6032              TCATCTCAAAGTTGTCATTCTGAACAA---------------------------------
Canis_familiaris|15952             TCATCTCAAACTTGTCATTCTGAAGGA---------------------------------
Loxodonta_africana|9089            TCACCTCAAACTTGTCATTCTGAACAA---------------------------------
Sus_scrofa|14768                   TCACCTCAAAGTTGTCATTCTGAAGGA---------------------------------
Bos_taurus|22032                   TCACCTCAAACCTGTCATTCTGAAGGA---------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            TCATCTCAAACTTGTCATTCTGAACAA---------------------------------
Gorilla_gorilla|11787              TCGTCTCAAACTTGTCATTCTGAACAA---------------------------------
Homo_sapiens|20815                 TCGTCTCAAACTTGTCATTCTGAACAA---------------------------------
Pan_troglodytes|9474               TCGTCTCAAACTTGTCATTCTGAACAA---------------------------------
Pongo_abelii|6151                  TCATCTCAAACTTGTCATTCTGAACAA---------------------------------
Rhesus_macaque|7159                TCATCTCAAACTTGTCATTCTGAACAA---------------------------------
Cavia_porcellus|12012              TCATCTGAGACTTGT---TCTGAACGA---------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ---------------------------AAATCTAAAAAGGAAAAACAAACATCTGATGGA
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ---------------------AGTAGATCCAAAGTAGAAGGAAAAAGACCGGCTGAAAGT
Fugu_rubripes|46645                ---------------------CAGACTGATGTGACCTTAGAGTCTCCACAACTCCAACAC
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Branchiostoma_floridae|38285       ---------------TCTGGGAGTGGCAAGGAGGTGTCTCACAGTACAGAAGCTACCGGC
Branchiostoma_floridae|33431       ---------------TCGGGGAGCAGCAGGGAGGTCTCTCTAAGTGCGGAAGCTACCAGC
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------GCTGACAGGAAGAGAGAAGGACACTCGGGAAACTCC
Echinops_telfairi|18862            ---------------------GCTGATAAAAAGGAGCAAGAAAAAAAATCAAGTAACTTT
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------CCTGATAAAAAGGAAGAAAAAAATTCAGGTAACTTC
Myotis_lucifugus|5822              ---------------------TCTGATAAAAAGAAGGAAGGAAAAAATTCGGGCAACTTC
Otolemur_garnettii|4925            ------------------------CCTGATAAAAAGGAAGAAAAAAATTCAGGTAACTTC
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ---------------------CATGATAGAAAG---------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ---------------------GCTGGTGAAGTGGGGGAAAGGAACGCTTCGGGAAAGTTC
Gallus_gallus|1176                 ------------------AGTACTGAAAATGCTCAGACTGTTTCAAAACCTACCCCGGAT
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ---------------------GCTGATAAAAAGAGGGGAGAAAAATCTCCAAGTAACTTC
Choloepus_hoffmanni|2463           ---------------------GCTGACAGAAAGAAGGAAGAAAAAAATTCAGGTGACTTC
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------GCTGCTGATAAAAACAAAGAAGACAGAAGTTCAGGTAACTTC
Pteropus_vampyrus|17753            ---------------------GCTAATAAAAAGAGGGAAGAAAAAAATTCAGGTAACTTC
Vicugna_pacos|5884                 ---------------------GCTGATAAAAAGATGGAAGAAAAAGGTCCGAGTAACTTC
Rattus_norvegicus|26410            ---------------------AAGGGGAAAGAAAAGAGCTCAGACATACCAGATGAGAGC
Monodelphis_domestica|30602        ------------------------GAGAGAAAGATGGAAGAAAAATATTTGGGCAACTTC
Echinops_telfairi|19173            ---------------------GCAGATAAAAAGGAGCAAGAAAAGAAACCAAGTAACTTC
Mus_musculus|37053                 ---------------------GTGGATTCGAAGGGGGAAGAGCAAAGCTCAGGTAACTCC
Equus_caballus|23003               ---------------------GCTGATAGAAAGAGGGAAGGAAAAAATTCAGGTAACTTC
Tarsius_syrichta|6032              ---------------------GCTGATAAAAAGAGGGAAGAAAAAAGCTCAGGTAACTTC
Canis_familiaris|15952             ---------------------GCTGATAAAAAGAGGGAAGAAAAAAATTCAGCAGTGTTA
Loxodonta_africana|9089            ---------------------GCTGAGAGAAAGAGGCCAGAAAAAAAATCAGGTAACTTC
Sus_scrofa|14768                   ---------------------GCTGATAAAAAGAGGGAAGAAAAAAATTCAAGTAACTAC
Bos_taurus|22032                   ---------------------ACTAATAAAAAGAGGGAAGAAAAAACTCCAAGGAATTTC
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ---------------------GGTGATAAAAAGATGGAGAAAAAACATTCAGGTAACTTC
Gorilla_gorilla|11787              ---------------------GGTGATAAAAAGATGGAGGAAAAAAATTCAGGCAACTTC
Homo_sapiens|20815                 ---------------------GGTGATAAAAAGATGGAGGAAAAAAATTCAGGCAACTTC
Pan_troglodytes|9474               ---------------------GGTGATAAAAAGATGGAGGAAAAAAATTCAGGCAACTTC
Pongo_abelii|6151                  ---------------------GGTGATAAAAAGATGGAGGAAAAAAATTCAGGCAACTTC
Rhesus_macaque|7159                ---------------------GGTGATAAAAAGATGGAGGAAAAAAATTCAGGCAACTTC
Cavia_porcellus|12012              ---------------------GTAGATAAAATGAGGGGAGAAAAAAATTCAGGTAACTTC
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ---------------CGGAAGACCAGCAGTGCTGGTAGCCAAGCTTCTTCCCAGAGAAAG
Danio_rerio|22894                  GGCGACCAAAAATCAGCCAAGAAAGTCAAGCCTCTTCCC---------------------
Fugu_rubripes|46645                AAACTGTCCaaagagcagaggaaccagTCCAGAAAACAGAAAGTGAAATCACGCTTGGAC
Tetraodon_nigroviridis|17973       ------------------------------------------CCAGATTGCGGAGATGCC
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 CAG------------AAGAGAGCCGCAGACCCGGCCCCGCCCCCTAAGCAGACA------
Felis_catus|36592                  ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              CAG---------------AAGCCGGCACGCACGCCGCAGCACTCT---------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Pteropus_vampyrus|17753            CAG------------AAGAAGTCCGCAAACATGCCTCAGCAA------TCTAAGAATACA
Rattus_norvegicus|26410            ATC---------------------------------------------------------
Mus_musculus|37053                 CAG---------------AAGTCTAAAAGCAGGCTTCAGCCATCTGGCTCTAAGAACGCA
Canis_familiaris|15952             TTT---------------------------------------------------------
Loxodonta_africana|9089            CAG---------------AAGTCTGCAAACATGCTTCAGCAATCCGATTCTAAGACTACA
Sus_scrofa|14768                   CAG---------------AAGTCTGCACACATGCTTCAGCAATCTAACTGTAATAAGACT
Ochotona_princeps|8552             ------------------------------------------------------------
Cavia_porcellus|12012              CAG---------------AATTCTGCAAACATGTTTCAACAACCTGGTTCTAAGAATCCA
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            AACAGGGCAGAA------------------------------------------------
Bombyx_mori|7387                   GTTAAGAGAAGATTGGTTGAAATTGATGAT------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Fugu_rubripes|46645                AGCGggataaaggaggaggagaagggttCCACCTTCACTCATCATTCCATCGATGTTAAT
Tetraodon_nigroviridis|17973       CCCAAGTCCAAGAAAGCCAAGGCAGGCCCGCAC---------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ---GGAGCCAAGAAGAGGAAAACTGTCAGTGCG---------------------------
Echinops_telfairi|18862            ---GGAGCTAAGAAAAGAAAAATTGAAGATGTC---------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ---GGGGCTAAGAAAAGAAAAACTGATGATGTC---------------------------
Myotis_lucifugus|5822              ---GGGGCTAAGAAAAGAAAAATTGATGATGCA---------------------------
Otolemur_garnettii|4925            ---GGGGCTAAGAAAAGAAAAATCGATGATGCC---------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ---GGGGCCAAGAAGAGGAAAGTGGAGGTTGATGGC------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ---GGGGCTAAGAAAAGAAAAATTGATAATGCA---------------------------
Choloepus_hoffmanni|2463           ---GGGGCTAAGAAAAGAAAAATGGATGATGCCCAG------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ---GGGGCTAAAAAAAGAAAAATTAATGATGCC---------------------------
Pteropus_vampyrus|17753            ---GGGGCTAAGAAAAGAAAAATTGATGATGCA---------------------------
Vicugna_pacos|5884                 ---GGGGCTAAGAAAAGAAAAATTGATGAT------------------------------
Rattus_norvegicus|26410            ---AGATTCCATTACAGATGGTTG------------------------------------
Monodelphis_domestica|30602        ---AAGGCAAAGAAAAGGAAATTGGATAACTTA---------------------------
Echinops_telfairi|19173            ---GGAGCTAAGAAAAGAAAAATTGAAGATGTC---------------------------
Mus_musculus|37053                 ---GGCGCTAAGAAAAGAAAACTTGATGATGCT---------------------------
Equus_caballus|23003               ---GGGGCTAAGAAAAGAAAAATTGATGATGCA---------------------------
Tarsius_syrichta|6032              ---GGAGCTAAGAAAAGAAAAATTGATGATGCC---------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ---GGAGCTAAGAAAAGGAAACTTGATGATGTC---------------------------
Sus_scrofa|14768                   ATAGGGGCTAAGAAAAGAAAAATTGATAATGCA---------------------------
Bos_taurus|22032                   ---GGGGCTAAGAAAAGAAAAATTGATAATGCA---------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ---GGAGCTAAGAAAAGAAAAATGGATGATGCC---------------------------
Gorilla_gorilla|11787              ---GGAGCTAAGAAAAGAAAAATCGATGATGCC---------------------------
Homo_sapiens|20815                 ---GGAGCTAAGAAAAGAAAAATCGATGATGCC---------------------------
Pan_troglodytes|9474               ---GGAGCTAAGAAAAGAAAAATCGATGATGCC---------------------------
Pongo_abelii|6151                  ---GGAGCTAAGAAAAGAAAAATCGATGATGCC---------------------------
Rhesus_macaque|7159                ---GGAGCTAAGAAAAGAAAAATTGATGATGCC---------------------------
Cavia_porcellus|12012              ---AGGGGCAAGAAAAGAAAACTTGATGATGCC---------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ATTGAAATCGACGAAACG------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Branchiostoma_floridae|38285       GGACAGCAACACAGGAAAAAACAG------------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Fugu_rubripes|46645                GGGCCACCTCTGGTGATAGGG---------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Branchiostoma_floridae|38285       ---------------------------------AACCAAATCGGGTCT------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Fugu_rubripes|46645                ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Branchiostoma_floridae|38285       ---------------------------------CAACTGTGTGACACAAATTGTACT---
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Fugu_rubripes|46645                ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Branchiostoma_floridae|38285       ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Fugu_rubripes|46645                ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Branchiostoma_floridae|38285       ------------------------------------------------------------
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------------------
Ornithorhynchus_anatinus|6525      ------------------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------------------
Caenorhabditis_elegans|9599        ------------------------------------------------------------
Pediculus_humanus|9206             ------------------------------------------------------------
Nasonia_vitripennis|10339          ------------------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------------------
Linepithema_humile|1088            ------------------------------------------------------------
Pogonomyrmex_barbatus|4791         ------------------------------------------------------------
Ixodes_scapularis|18877            ------------------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------------------
Danio_rerio|22894                  ------------------------------------------------------------
Fugu_rubripes|46645                ------------------------------------------------------------
Tetraodon_nigroviridis|17973       ------------------------------------------------------------
Fugu_rubripes|46726                ------------------------------------------------------------
Gasterosteus_aculeatus|8508        ------------------------------------------------------------
Oryzias_latipes|13656              ------------------------------------------------------------
Branchiostoma_floridae|38285       ---------------TGGAAAACGGAGTTGTCTATCAAGATCTACTGCCATCTCCCATTC
Nematostella_vectensis|3863        ------------------------------------------------------------
Ornithorhynchus_anatinus|6616      ------------------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------------------
Echinops_telfairi|18862            ------------------------------------------------------------
Felis_catus|36592                  ------------------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------------------
Myotis_lucifugus|5822              ------------------------------------------------------------
Otolemur_garnettii|4925            ------------------------------------------------------------
Macropus_eugenii|9309              ------------------------------------------------------------
Procavia_capensis|16727            ------------------------------------------------------------
Anolis_carolinensis|3998           ------------------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------------------
Gallus_gallus|1176                 ------------------------------------------------------------
Xenopus_tropicalis|15685           ------------------------------------------------------------
Dasypus_novemcinctus|7738          ------------------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------------------
Choloepus_hoffmanni|2463           ------------------------------------------------------------
Erinaceus_europaeus|12349          ------------------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------------------
Pteropus_vampyrus|17753            ------------------------------------------------------------
Vicugna_pacos|5884                 ------------------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------------------
Monodelphis_domestica|30602        ------------------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------------------
Mus_musculus|37053                 ------------------------------------------------------------
Equus_caballus|23003               ------------------------------------------------------------
Tarsius_syrichta|6032              ------------------------------------------------------------
Canis_familiaris|15952             ------------------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------------------
Sus_scrofa|14768                   ------------------------------------------------------------
Bos_taurus|22032                   ------------------------------------------------------------
Ochotona_princeps|8552             ------------------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------------------
Gorilla_gorilla|11787              ------------------------------------------------------------
Homo_sapiens|20815                 ------------------------------------------------------------
Pan_troglodytes|9474               ------------------------------------------------------------
Pongo_abelii|6151                  ------------------------------------------------------------
Rhesus_macaque|7159                ------------------------------------------------------------
Cavia_porcellus|12012              ------------------------------------------------------------
Spermophilus_tridecemlineatus|6326 ------------------------------------------------------------

Tribolium_castaneum|12529          ------------------------------------------------TAA
Ornithorhynchus_anatinus|6525      ---------------------------------------------------
Culex_quinquefasciatus|8590        ------------------------------------------------TGA
Caenorhabditis_elegans|9599        ------------------------------------------------TAA
Pediculus_humanus|9206             ------------------------------------------------TGA
Nasonia_vitripennis|10339          ---------------------------------------------------
Apis_mellifera|29709               ------------------------------------------------TAA
Linepithema_humile|1088            ------------------------------------------------TAA
Pogonomyrmex_barbatus|4791         ------------------------------------------------TAG
Ixodes_scapularis|18877            ---------------------------------------------------
Bombyx_mori|7387                   ------------------------------------------------TAA
Danio_rerio|22894                  ------------------------------------------------TAG
Fugu_rubripes|46645                ------------------------------------------------TAA
Tetraodon_nigroviridis|17973       ------------------------------------------------TGA
Fugu_rubripes|46726                ---------------------------------------------------
Gasterosteus_aculeatus|8508        ---------------------------------------------------
Oryzias_latipes|13656              ---------------------------------------------------
Branchiostoma_floridae|33431       CCTAACAACCCCTACTGGGGGATCACT---------------------TAG
Nematostella_vectensis|3863        ---------------------------------------------------
Ornithorhynchus_anatinus|6616      ---------------------------------------------------
Sorex_araneus|4441                 ------------------------------------------------TGA
Echinops_telfairi|18862            ------------------------------------------------TGA
Felis_catus|36592                  ---------------------------------------------------
Microcebus_murinus|2859            ------------------------------------------------TGA
Myotis_lucifugus|5822              ------------------------------------------------TGA
Otolemur_garnettii|4925            ------------------------------------------------TGA
Macropus_eugenii|9309              ---------------------------------------------------
Procavia_capensis|16727            ---------------------------------------------------
Anolis_carolinensis|3998           ---------------------------------------------------
Dipodomys_ordii|16649              ------------------------------------------------TGA
Gallus_gallus|1176                 ------------------------------------------------TGA
Xenopus_tropicalis|15685           ------------------------------------------------TGA
Dasypus_novemcinctus|7738          ---------------------------------------------------
Tursiops_truncatus|8298            ------------------------------------------------TGA
Choloepus_hoffmanni|2463           ---------------------------------------------------
Erinaceus_europaeus|12349          ---------------------------------------------------
Tupaia_belangeri|4654              ------------------------------------------------TGA
Pteropus_vampyrus|17753            ------------------------------------------------TGA
Vicugna_pacos|5884                 ---------------------------------------------------
Rattus_norvegicus|26410            ------------------------------------------------TGA
Monodelphis_domestica|30602        ---------------------------------------------------
Echinops_telfairi|19173            ------------------------------------------------TGA
Mus_musculus|37053                 ------------------------------------------------TGA
Equus_caballus|23003               ------------------------------------------------TGA
Tarsius_syrichta|6032              ------------------------------------------------TGA
Canis_familiaris|15952             ---------------------------------------------------
Loxodonta_africana|9089            ------------------------------------------------TGA
Sus_scrofa|14768                   ------------------------------------------------TGA
Bos_taurus|22032                   ------------------------------------------------TGA
Ochotona_princeps|8552             ---------------------------------------------------
Callithrix_jacchus|7966            ------------------------------------------------TGA
Gorilla_gorilla|11787              ------------------------------------------------TGA
Homo_sapiens|20815                 ------------------------------------------------TGA
Pan_troglodytes|9474               ------------------------------------------------TGA
Pongo_abelii|6151                  ------------------------------------------------TGA
Rhesus_macaque|7159                ------------------------------------------------TGA
Cavia_porcellus|12012              ---------------------------------------------------
Spermophilus_tridecemlineatus|6326 ---------------------------------------------------

multiple sequence alignment in CLUSTALW format

Ornithorhynchus_anatinus|6961      ------------------------------------------------------------
Fugu_rubripes|4547                 ------------------------------------------------------------
Branchiostoma_floridae|31798       ------------------------------------------------------------
Ornithorhynchus_anatinus|3591      ------------------------------------------------------------
Sorex_araneus|3963                 ------------------------------------------------------------
Macropus_eugenii|8480              ------------------------------------------------------------
Procavia_capensis|15649            ------------------------------------------------------------
Xenopus_tropicalis|58              ------------------------------------------------------------
Erinaceus_europaeus|10146          ------------------------------------------------------------
Echinops_telfairi|15123            -------------LTEELEPINNELHAVDIQIQELMERQ-ELLQKKAILTKKIKQSLEDS

Tribolium_castaneum|4546           -------DTLSD--------------WLE-EKFPWSAQLKSLLKEKFKFDHFRAKQLAAI
Ornithorhynchus_anatinus|6961      -------------------------------DFPWAGKVKEAMRDVFKLPRFRPLQLETI
Culex_quinquefasciatus|18286       -------SELAKQD------------WNA-EGHAWSGTVRQVLGEVFRMADFRSQQLPAI
Caenorhabditis_elegans|12506       -------DSDVVTDR-----------WDR-DGFPWSDEATKILKEQFHLEKFRPLQRAAI
Pediculus_humanus|9033             -------EKLASKN------------WSL-KTFPWSQKVDNLLKENFKISEFRPFQLEVI
Ixodes_scapularis|18871            -------EVNQTD-------------WHK-STYPWSAGVLDKLTSVFKMKGLRPTQLPAI
Bombyx_mori|5666                   -------ETLASVD------------WAG-TEYEWSEDVKNVLKEKFRLKTFRAKQMSAI
Fugu_rubripes|4547                 --------------------------MVE-------------------------------
Branchiostoma_floridae|29294       -------KAAVLREKD----------WSR-TDFEWSSKLQSLLGSVFKLSKFRPLQLQAM
Branchiostoma_floridae|31798       ------------------------------------------------------------
Ornithorhynchus_anatinus|3591      ------------------------------------------------------------
Sorex_araneus|3963                 --------------------------------FPWSGQVKDVLQNVFKLQKFRLLQLETI
Macropus_eugenii|8480              ------------------------------------------------------------
Procavia_capensis|15649            ------------------------------------------------------------
Xenopus_tropicalis|58              ------------------------------------------------------------
Erinaceus_europaeus|10146          --------------------------------FPWSGKVKDVLQNVFKLQKFRLLQLETI

Fugu_rubripes|4547                 --------------------------------VYKMVVGPVSGL----------------
Branchiostoma_floridae|31798       ------------------------------------------------------------
Ornithorhynchus_anatinus|3591      --------------------------------GFTLVICPLISLMEDQLMTLERLGISAA
Macropus_eugenii|8480              ---------------------------------FTLVICPLISLMEDQLMVLEQLGVSAT
Procavia_capensis|15649            ---------------------------------FTLVICPLISLMEDQLMVLKQLGVSAT
Xenopus_tropicalis|58              --------------------------------GFTLVICPLVSLMEDQLMVLDRLGVSAT

Tribolium_castaneum|4546           TIHASTSKSEIKEIYDSMTSK---------------------------------------
Ornithorhynchus_anatinus|6961      VLSRFSSRLSGRSFSVSFAGA---------------------------------------
Culex_quinquefasciatus|18286       YLSANIDKDVVNNVNKLLRDG---------------------------------------
Caenorhabditis_elegans|12506       SLNANTSKEEAKRVEDAITNK---------------------------------------
Pediculus_humanus|9033             MLSANSSKEDVKLVTAALQDS---------------------------------------
Nasonia_vitripennis|6518           MLSAKAPKEDVKAIMTGLVDN---------------------------------------
Apis_mellifera|6720                MLSAKCNKENVKIIMNALIDK---------------------------------------
Linepithema_humile|14186           MLCAKTDKEIVKMTMDALINK---------------------------------------
Pogonomyrmex_barbatus|10899        ILCAKADKESVKSVMTTLVDK---------------------------------------
Ixodes_scapularis|18871            MLSATTPQKKTSAITNAMDDK---------------------------------------
Bombyx_mori|5666                   LITSTSPKEETSAVLNMLKDK---------------------------------------
Danio_rerio|9163                   TLNASSSKEDSKRILAGMTDK---------------------------------------
Fugu_rubripes|4547                 ------------------------------------------------------------
Tetraodon_nigroviridis|16936       MLNASSSKEHAKTVLAGLTDP---------------------------------------
Fugu_rubripes|1259                 MLNASSSKEHAKSVMAGMTDP---------------------------------------
Gasterosteus_aculeatus|1254        MLNASSTKEHAKNVMAGMTDP---------------------------------------
Oryzias_latipes|15233              ALNASSGKEHTKTVLAALTDP---------------------------------------
Branchiostoma_floridae|31798       ------------------------------------------------------------
Nematostella_vectensis|15216       LLNASSTREEVNSVHASIVDK---------------------------------------
Ornithorhynchus_anatinus|3591      SLNASSSKEEVRRIHAEMARE---------------------------------------
Sorex_araneus|3963                 XXXXXXXXXXXXXXXXXXXXX---------------------------------------
Echinops_telfairi|14874            MLNASSSKEHVKWVHAEMVNK---------------------------------------
Felis_catus|2050                   MLNVS-------------------------------------------------------
Microcebus_murinus|2425            MLNASSSKEHVKWVHAEMVNK---------------------------------------
Myotis_lucifugus|5248              MLNASSSKXXXXXXXXXXXXX---------------------------------------
Otolemur_garnettii|4251            MLNASSSKXXXXXXXXXXXXX---------------------------------------
Macropus_eugenii|8480              LLNASXXXEHVKWVHAEMVNK---------------------------------------
Procavia_capensis|15649            MLNASSSKEHVKWVHAEMVNK---------------------------------------
Anolis_carolinensis|16826          LLNASSSKEHVKWVYTEMLSS---------------------------------------
Dipodomys_ordii|15659              MLNASSSKEHVKWVHAEMVNK---------------------------------------
Gallus_gallus|15565                LLNASSSKEHVKWVHAQMLDR---------------------------------------
Xenopus_tropicalis|58              SLNASSSKEHVKWVHGEMTNK---------------------------------------
Dasypus_novemcinctus|6828          MLNASSSKEHVKWVHAEMVNK---------------------------------------
Tursiops_truncatus|7832            MLNASSSKXXXXXXXXXXXXX---------------------------------------
Choloepus_hoffmanni|2173           TLNASSSKXXXXXXXXXXXXX---------------------------------------
Erinaceus_europaeus|10146          MLNASSSKEHXXXXXXXXXXX---------------------------------------
Tupaia_belangeri|4011              MLNASSSKEHVKWVHAEMVNK---------------------------------------
Pteropus_vampyrus|16733            MLNASSSKEHVKWVHAEMVNK---------------------------------------
Vicugna_pacos|5471                 MLNASSSKEHVKWVHAEMVNK---------------------------------------
Rattus_norvegicus|9438             MLNSSSSKEHVKCVHTEMMNK---------------------------------------
Monodelphis_domestica|6914         LLNASSTKEHVKWVHAEMVNK---------------------------------------
Echinops_telfairi|15123            MLNASSSKEHVKWVHAEIVNK---------------------------------------
Mus_musculus|14913                 MLNASSSKEHVKWVHAEMVNK---------------------------------------
Equus_caballus|22224               MLNASSSKEHVKWVHAEMVNK---------------------------------------
Tarsius_syrichta|5523              M--NASSSEHVKWVHAEMINK---------------------------------------
Canis_familiaris|5711              MLNASSSKEHVKWVHAEMINK---------------------------------------
Loxodonta_africana|6793            MLNASSSKEHVKWVHAEMVNK---------------------------------------
Sus_scrofa|610                     MLNASSSKEHVKWVHAEMVNK---------------------------------------
Bos_taurus|24424                   MLNASSPKEHVKWVHAEMVNK---------------------------------------
Ochotona_princeps|7452             MLNASSSKEHVKWVHAEMINK---------------------------------------
Callithrix_jacchus|214             MLNASSSKEHVKWVHAEMVNK---------------------------------------
Gorilla_gorilla|9778               MLNASSSKEHVKWVHAEMVNK---------------------------------------
Homo_sapiens|42290                 MLNASSSKEHVKWVHAEMVNK---------------------------------------
Pan_troglodytes|25424              MLNASSSKEHVKWVHAEMVNK---------------------------------------
Pongo_abelii|9221                  MLNASSSKEHVKWVHAEMVNK---------------------------------------
Rhesus_macaque|4430                MLNASSSKEHVKWVHAEMVNK---------------------------------------
Cavia_porcellus|9408               MLNASSSKEHVKWVHAEMVNK---------------------------------------
Spermophilus_tridecemlineatus|5661 MLNASSSKEHVKWVHAEMVNK---------------------------------------

Tribolium_castaneum|4546           ----------------------------------------------------KSALKLLY
Ornithorhynchus_anatinus|6961      ----------------------------------------------------SSPSHPLT
Culex_quinquefasciatus|18286       ---------------------------------------------------DTEQLKIVY
Caenorhabditis_elegans|12506       ----------------------------------------------------DSKFRLLY
Pediculus_humanus|9033             ----------------------------------------------------CPKHKLIY
Nasonia_vitripennis|6518           ----------------------------------------------------KSDLKLVY
Apis_mellifera|6720                ----------------------------------------------------KSDLKLIY
Linepithema_humile|14186           ----------------------------------------------------NSNLKLIY
Pogonomyrmex_barbatus|10899        ----------------------------------------------------NSSLKLIY
Ixodes_scapularis|18871            ----------------------------------------------------KSPIKLIY
Bombyx_mori|5666                   ----------------------------------------------------SATVKLLY
Danio_rerio|9163                   ----------------------------------------------------NSPFKLLY
Fugu_rubripes|4547                 ----------------------------------------------------ETETQL--
Tetraodon_nigroviridis|16936       ----------------------------------------------------KTPFRLVY
Fugu_rubripes|1259                 ----------------------------------------------------TVPFRLVY
Gasterosteus_aculeatus|1254        ----------------------------------------------------NGPFKLLY
Oryzias_latipes|15233              ----------------------------------------------------KAPFKLVY
Branchiostoma_floridae|31798       ------------------------------------------------------------
Nematostella_vectensis|15216       ----------------------------------------------------KSDLKMLY
Ornithorhynchus_anatinus|3591      ----------------------------------------------------TSALNLLN
Sorex_araneus|3963                 ----------------------------------------------------XXXXXXXX
Echinops_telfairi|14874            ----------------------------------------------------NSKLKLIY
Felis_catus|2050                   ------------------------------------------------------------
Microcebus_murinus|2425            ----------------------------------------------------NSELKLIY
Myotis_lucifugus|5248              ----------------------------------------------------XXXXXXXX
Otolemur_garnettii|4251            ----------------------------------------------------XXXXXXXX
Macropus_eugenii|8480              ----------------------------------------------------NSKLKLIY
Procavia_capensis|15649            ----------------------------------------------------NSDLKLIY
Anolis_carolinensis|16826          ----------------------------------------------------SSQLKLIY
Dipodomys_ordii|15659              ----------------------------------------------------NSELKLIY
Gallus_gallus|15565                ----------------------------------------------------NSQLKLLY
Xenopus_tropicalis|58              ----------------------------------------------------NSRLKLLY
Dasypus_novemcinctus|6828          ----------------------------------------------------NSKVKLIY
Tursiops_truncatus|7832            ----------------------------------------------------XXXXXXXX
Choloepus_hoffmanni|2173           ----------------------------------------------------XXXXXXXX
Erinaceus_europaeus|10146          ----------------------------------------------------XXXXXXXX
Tupaia_belangeri|4011              ----------------------------------------------------NSNLKLIY
Pteropus_vampyrus|16733            ----------------------------------------------------NSKLKLIY
Vicugna_pacos|5471                 ----------------------------------------------------SSKLKLIY
Rattus_norvegicus|9438             ----------------------------------------------------NSHLKLIY
Monodelphis_domestica|6914         ----------------------------------------------------NSKLKLIY
Echinops_telfairi|15123            ----------------------------------------------------NSKLKLIH
Mus_musculus|14913                 ----------------------------------------------------NSQLKLIY
Equus_caballus|22224               ----------------------------------------------------NSKLKLIY
Tarsius_syrichta|5523              ----------------------------------------------------NSELKLIY
Canis_familiaris|5711              ----------------------------------------------------NSKLKLIY
Loxodonta_africana|6793            ----------------------------------------------------NSKLKLIY
Sus_scrofa|610                     ----------------------------------------------------NSKLKLIY
Bos_taurus|24424                   ----------------------------------------------------NSKLKLIY
Ochotona_princeps|7452             ----------------------------------------------------NSKLKLIY
Callithrix_jacchus|214             ----------------------------------------------------NSELKLIY
Gorilla_gorilla|9778               ----------------------------------------------------NSELKLIY
Homo_sapiens|42290                 ----------------------------------------------------NSELKLIY
Pan_troglodytes|25424              ----------------------------------------------------NSELKLIY
Pongo_abelii|9221                  ----------------------------------------------------NSELKLIY
Rhesus_macaque|4430                ----------------------------------------------------NSELKLIY
Cavia_porcellus|9408               ----------------------------------------------------NSTLKLIY
Spermophilus_tridecemlineatus|5661 ----------------------------------------------------NSKLKLIY

Fugu_rubripes|4547                 --EGEETKTWRFFKN---ERGWRGSERSR-------CEGQ--------------------
Branchiostoma_floridae|31798       ------------------------------------------------------------
Felis_catus|2050                   ------------------------------------------------------------

Fugu_rubripes|4547                 ---------------------HMLDVV------ETKPERPGLDVS---------------
Branchiostoma_floridae|31798       ------------------------------------------------------------
Ornithorhynchus_anatinus|3591      NNSTIIMTPHNNNHLL------IIIIR-VVVVMMTMMPPPQ---------VRRKPPSPED
Felis_catus|2050                   ------------------------------------------------------------
Echinops_telfairi|15123            --TLIGLTATATNHVLKDAQ-KILCVE-KCFTFTASFNRPNLYYE---------------

Fugu_rubripes|4547                 -------------RGG------------------TVQL----------------------
Branchiostoma_floridae|31798       ------------------------------------------------------------
Felis_catus|2050                   ------------------------------------------------------------
Echinops_telfairi|15123            ---------------------IIYCFSQKDSEHVTMSLQNLGIHAGAYHANMEPEDKTKV

Branchiostoma_floridae|31798       ---------------------------------------------------RDDQPAYCI
Felis_catus|2050                   ---------KIVVATVAFDTGINITG-RFVIH--VSKSIE-YYQ--GC-AG-DDMK-DCI

Ornithorhynchus_anatinus|6961      ------------------------------------------PRR---------------
Branchiostoma_floridae|29294       ----------------AEQTGQ-QKLYGMVKYCHDVNR----CRRAIIADHFDEGWDSTK
Xenopus_tropicalis|58              ------------SMVVMENVGQ-KKLYEMVGYCQSPDR----CRRVLIAQHFDEVWDSAK

Tribolium_castaneum|4546           CNKMCDICKRD---------------V--K---IPAYYDLTQICKDLHSLIDQ----AKG
Ornithorhynchus_anatinus|6961      ----C-------------------------------------------------------
Culex_quinquefasciatus|18286       CNRMCDRCYHR---------------D--K--VTLPEQDITTHYNTLLAILRR----AET
Caenorhabditis_elegans|12506       CQKQCDTCENG---------------NGFVGTSSKESTDVSEAAKTTVRIIEEHLNSAKD
Pediculus_humanus|9033             CNKMCDHCKEE---------------P--N----FKEIDITSACRDIYKIIER----ALE
Nasonia_vitripennis|6518           CKEMCDHCKKA---------------K--K----KKEMDIGPSCRHLYQIMQK----AVQ
Apis_mellifera|6720                CAEMCDHCRKL---------------K--D----NKQINIAPYCRQLYQIMTK----AVQ
Linepithema_humile|14186           CVQMCDHCRKP---------------E--V----KKEVDVTQYCRQLYQIMTK----AVQ
Pogonomyrmex_barbatus|10899        CAKMCDHCRKP---------------S--V----KKEIDITRYCRQLYQIMTK----AVQ
Ixodes_scapularis|18871            CNGMCDNCDST---------------V--S---STKEVDVTRHVQDIYKILKA----AIA
Bombyx_mori|5666                   CNKMCDVCSTS---------------Q--S--DSPKDLDLRAHCRIIAHILEN----AEK
Danio_rerio|9163                   CNEMCDVCRHG---------------N--D----YITMDITQHARDVLHIVEL----ASS
Tetraodon_nigroviridis|16936       CQQMCDTCRHA---------------K--E----VVATDISQHARQLVHILEL----AAS
Fugu_rubripes|1259                 CQQMCDTCRHP---------------K--D----VSTVDITQHARQVVQILEL----AAS
Gasterosteus_aculeatus|1254        CNQMCDTCRRV---------------K--D----YTTVDITEHAKQVVKIVEL----AAS
Oryzias_latipes|15233              CNQMCDTCRHP---------------A--G----YNTLDVTQHARQVVQIVEL----ATS
Branchiostoma_floridae|29294       CSGMCDVCDPT---------------L--V--TVTNEEDVTSLCQEVVRVIQS----ATA
Branchiostoma_floridae|31798       CSGMCDVCDPT---------------L--V--TVTDEEDVTSLCQEVVRVIQS----ATA
Nematostella_vectensis|15216       CKQMCDNCSRR---------------D--DERGLNELHDITQYASDLLKILEQ----AKA
Ornithorhynchus_anatinus|3591      CNGMCDNCRRE------------------T---------------------------REX
Sorex_araneus|3963                 CDGMCDNCCKD---------------T--A----PERKDITEHCRDLIKILQQ----AEG
Echinops_telfairi|14874            XXXXXXXXXXX---------------X--X----XXXXXXXXXXXXXXXXXXX----XXX
Felis_catus|2050                   CKKMCDNCKGI------------------A----CEVKNVTAYCRDLQ--IKQ----AED
Microcebus_murinus|2425            CNKMCDNCCKD---------------I--S----CERKNVTEYCRDLIKILKQ----AEE
Myotis_lucifugus|5248              CNKMCDNCCKD---------------I--S----FERKNVTAYCRDLIKILQQ----AEE
Otolemur_garnettii|4251            XXXXXXXXXXX---------------X--X----FERKNVTQYCRDLIKILKQ----AEE
Macropus_eugenii|8480              CNKMCDNCRKD---------------I--L----FEKKNVTEYCRDLIKILKQ----AEK
Procavia_capensis|15649            CNKMCDNCCKD---------------I--S----FDRKNVTEYCRDLVKI-KQ----AEE
Anolis_carolinensis|16826          CNKMCDNCCRE---------------E--P----FEKIDVTGHCLDIIKILKQ----VDC
Dipodomys_ordii|15659              CDRMCDNCCTD---------------A--A----VEEKNVVEHCRELVQILRQ----AEG
Gallus_gallus|15565                CNRMCDNCCRE---------------N--S----LEKKDITGYYRDLIKILEQ----ADN
Xenopus_tropicalis|58              CNKMCDNCNSE---------------G--G----WEKADITPYCRDIVKILEQ----ANQ
Dasypus_novemcinctus|6828          CNKMCDNCCKD---------------I---------------------------------
Tursiops_truncatus|7832            CNKMCDNCCKE---------------I--S----SERKNITAYCRDLIKILKQ----AEE
Choloepus_hoffmanni|2173           CNKMCDNCSKG---------------I--S----FERKNVAEYCRDLIKILKQ----AEE
Erinaceus_europaeus|10146          CSKMCDNCCRD---------------I--S----FERKNVTEYCRDLIKILKQ----ADE
Tupaia_belangeri|4011              CNKMCDNCCKN---------------I--S----FERKNVTEYCRDLIKILKQ----AEE
Pteropus_vampyrus|16733            CNKMCDNCCKD---------------I--S----FERKNVTAYCRDLIKILQQ----AEE
Vicugna_pacos|5471                 CNKMCDNCCKD---------------I--S----FERKNITAYCRDLIKILKQ----AEE
Rattus_norvegicus|9438             CNKMCDNCCKD---------------D--S----FEKKNITEHCQALIKILKQ----AEG
Monodelphis_domestica|6914         CNKMCDNCCKD---------------I--S----FEKKNVTDHCQDLIKILKQ----AEK
Echinops_telfairi|15123            GNKMCAHCCKD---------------I--S----WGKKNVTE---DLIKILKQ----AED
Mus_musculus|14913                 CNKMCDNCCKD---------------V--S----FEKKNVTQHCRDLIKILKQ----AEG
Equus_caballus|22224               CNKMCDNCCKE---------------I--S----FERKDVTAYCRDLIKILKQ----AEN
Tarsius_syrichta|5523              CNKMCDNCCKD---------------I--S----FERKNITQYCRDLIKILKQ----AEE
Canis_familiaris|5711              CNRMCDNCCKD---------------I--S----CERKNVTAHCRDLVKILKQ----AED
Loxodonta_africana|6793            CNKMCDNCCKD---------------I--S----FDRKNVTEYCRDLIKILKQ----AEE
Sus_scrofa|610                     CNKMCDNCCKD---------------T--S----FERKNITAYCRDLVKILKQ----AEE
Bos_taurus|24424                   CNKMCDNCCKE---------------I--S----FERKNVTAYCRDLIKILKQ----AED
Ochotona_princeps|7452             CNKMCDNCCKD---------------I--S----YEKQNVTEHCRDLIKILKQ----AEE
Callithrix_jacchus|214             CNKMCDNCCKD---------------I--S----FERKNVTEYCRDLIKILRQ----AEE
Gorilla_gorilla|9778               CNKMCDNCCKD---------------S--A----FERKNITEYCRDLVKILKQ----AEE
Homo_sapiens|42290                 CNKMCDNCCKD---------------S--A----FERKNITEYCRDLIKILKQ----AEE
Pan_troglodytes|25424              CNKMCDNCCKD---------------S--A----FERKNITEYCRDLVKILKQ----AEE
Pongo_abelii|9221                  CNKMCDNCCKD---------------S--A----FERKNITEYCRDLIKILKQ----AEE
Rhesus_macaque|4430                CNKMCDNCCKD---------------S--A----FERKNITEYCRDLIKILKQ----AEE
Cavia_porcellus|9408               CNKMCDNCCKD---------------V--S----FEKKNVTVYCRDLIKILKQ----AEE
Spermophilus_tridecemlineatus|5661 CNKMCDNCCKD---------------I--S----FEKKNITEYCRDLIKILKQ----AEE

Ornithorhynchus_anatinus|6961      -----------------------------------------------LSAY---------
Caenorhabditis_elegans|12506       GSGRITGNKLVELLTKKLKGSRN------------REFCEKLIVNLLLEGYLQE------
Ornithorhynchus_anatinus|3591      ASQPPT------VWAYSSSGKWGWR------PGAPRGITSVLLALALFPRGCRE------
Dasypus_novemcinctus|6828          ------------------------------------------------------------

Tribolium_castaneum|4546           ----------------------------------DKGYTMYSTVSYIVKG----------
Ornithorhynchus_anatinus|6961      -------------------------------------------------G----------
Culex_quinquefasciatus|18286       ----------------------------------EFQYNAYTTLSYIAKGDAYVGEEGIR
Caenorhabditis_elegans|12506       ----------------------------------DFHYTVYSVISYVVIG----------
Pediculus_humanus|9033             ----------------------------------DFHYTAYSTISYINKG----------
Nasonia_vitripennis|6518           ----------------------------------DFHFSAYSTITYIKRG----------
Apis_mellifera|6720                ----------------------------------DFHFSAYSTISYIKRG----------
Linepithema_humile|14186           ----------------------------------DFHFSSYSTISYLKRG----------
Pogonomyrmex_barbatus|10899        ----------------------------------DFHYSAYSTISRLK------------
Ixodes_scapularis|18871            ----------------------------------RFHTTPYAYISYLEAG----------
Bombyx_mori|5666                   ----------------------------------DFHFTAYSTISYLKIG----------
Danio_rerio|9163                   ----------------------------------DFSFTPYTTHFYLKLG----------
Tetraodon_nigroviridis|16936       ----------------------------------DFSFTPYTTYFYIKPG----------
Fugu_rubripes|1259                 ----------------------------------DFSFTPYTTYFYIKLG----------
Gasterosteus_aculeatus|1254        ----------------------------------DFSFTPYTTYFYVRLG----------
Oryzias_latipes|15233              ----------------------------------DFSFTPYTTYFYVKLG----------
Branchiostoma_floridae|29294       ----------------------------------DYHFTPYSTISYLVPG----------
Branchiostoma_floridae|31798       ----------------------------------DYHFTPYSTISYLVPG----------
Nematostella_vectensis|15216       ----------------------------------EFHFTPYSTISYIVKG----------
Ornithorhynchus_anatinus|3591      ----------------------------------DFSFTAFATISYLKKG----------
Sorex_araneus|3963                 ----------------------------------DYSFTAYATISYLKTG----------
Echinops_telfairi|14874            ----------------------------------DYSFTAYATISYLKIG----------
Felis_catus|2050                   ----------------------------------DYSFTAYATISYLKIG----------
Microcebus_murinus|2425            ----------------------------------DYSFTAYATISYLKIG----------
Myotis_lucifugus|5248              ----------------------------------DYSFTAYATISYLKTG----------
Otolemur_garnettii|4251            ----------------------------------DYSFTAYATISYLKIG----------
Macropus_eugenii|8480              ----------------------------------DFSFTAYATISYLKIG----------
Procavia_capensis|15649            ----------------------------------DYSFTAYATISYLKIG----------
Anolis_carolinensis|16826          ----------------------------------DFSFTSFTTISYVKIG----------
Dipodomys_ordii|15659              ----------------------------------XXXXXXXXXXXXXXXX----------
Gallus_gallus|15565                ----------------------------------DFSFTAFATISYLKIG----------
Xenopus_tropicalis|58              ------------------------------------------------------------
Dasypus_novemcinctus|6828          ------------------------------------------------------------
Tursiops_truncatus|7832            ----------------------------------DYSFTAYATISYLKIG----------
Choloepus_hoffmanni|2173           ----------------------------------DYSFTAYATISYLKIG----------
Erinaceus_europaeus|10146          ------------------------------------------------------------
Tupaia_belangeri|4011              ----------------------------------DYSFTAYATISYLKIG----------
Pteropus_vampyrus|16733            ----------------------------------DYSFTAYATISYLKIG----------
Vicugna_pacos|5471                 ----------------------------------DYSFTAYATISYLKIG----------
Rattus_norvegicus|9438             ----------------------------------DYSFTAYATISYLKVG----------
Monodelphis_domestica|6914         ----------------------------------DFSFTAYATISYLKVG----------
Echinops_telfairi|15123            ----------------------------------DYSFTAYATISYLK-G----------
Mus_musculus|14913                 ----------------------------------DYSFTAYATISYLKVG----------
Equus_caballus|22224               ----------------------------------DYSFTAFATISYLKTG----------
Tarsius_syrichta|5523              ----------------------------------DYSFTAYATISYLKIG----------
Canis_familiaris|5711              ----------------------------------DYSFTAYATISYLKIG----------
Loxodonta_africana|6793            ----------------------------------DYSFTAYATISYLKIG----------
Sus_scrofa|610                     ----------------------------------DYSFTAYATISYLKIG----------
Bos_taurus|24424                   ----------------------------------DYSFTAYATISYLKVG----------
Ochotona_princeps|7452             ----------------------------------DYSFTAYATISYLKIG----------
Callithrix_jacchus|214             ----------------------------------DYSFTAYATISYLKIG----------
Gorilla_gorilla|9778               ----------------------------------DYSFTAYATISYLKIG----------
Homo_sapiens|42290                 ----------------------------------DYSFTAYATISYLKIG----------
Pan_troglodytes|25424              ----------------------------------DYSFTAYATISYLKIG----------
Pongo_abelii|9221                  ----------------------------------DYSFTAYATISYLKIG----------
Rhesus_macaque|4430                ----------------------------------DYSFTAYATISYLKIG----------
Cavia_porcellus|9408               ----------------------------------DYSFTAYATISYLKVG----------
Spermophilus_tridecemlineatus|5661 ----------------------------------DYSFTAYATISYLKIG----------

Tribolium_castaneum|4546           ----RAVGDEKVEMLASDGMKIPKRLKEEGD---GSPAKKKPRTD---------------
Ornithorhynchus_anatinus|6961      ------------------------------------------------------------
Caenorhabditis_elegans|12506       ---------SKWRVYNGKDAIKMRHVEESKS---RKRKASSSVEEEDVMVLD--------
Pediculus_humanus|9033             ---------PMWIHVTDSDHQINIKINSKTKVDKNLIKTKSDDNFFSSV-----------
Nasonia_vitripennis|6518           ---------PKSGMALANDHKIMVEVDDH-------------------------------
Apis_mellifera|6720                ---------PKAVLALDTTHEIFFNYELH-------------------------------
Linepithema_humile|14186           ---------PKSGLALSNDHKILFNYELH-------------------------------
Pogonomyrmex_barbatus|10899        -------------FIDNSTIDDSLD-----------------------------------
Ixodes_scapularis|18871            ---------PMKEAVKKGAKVVFPFSTRKQM---SADKELPQPNKK--------------
Bombyx_mori|5666                   ---------PEMSGVNNDGFKLKMRVRVYSH---FELSKLAPTELFEET-----------
Danio_rerio|9163                   ---------RKAALLKNSGHSITMKMRRRGT---SQSTVKKVSESSGEK-----------
Fugu_rubripes|4547                 ---------TRASLLRNQSHTVSMKMCNSPG---RGPSEDRNAGKVVEE-----------
Tetraodon_nigroviridis|16936       ---------SRAPLLRNQSHTVSMKTCTSTG---TGSAGVKAPEGNTSL-----------
Fugu_rubripes|1259                 ---------TRASLLRNQSHTVSMKM----------------------------------
Gasterosteus_aculeatus|1254        ---------RKAPLLKSQTHTLCMKMRSTG------------------------------
Oryzias_latipes|15233              ---------RRAPLLKNQAHSLTMKMKMSGA---EPVSVSKPHRSGEK------------
Branchiostoma_floridae|29294       ---------PKSHRLTSGGVQVTLCI-PSKR---KKSRTSAAAACGTAA-----------
Branchiostoma_floridae|31798       ---------PKSHRLTSGGVQVTLCI-PSKR---KKSRTSAAATCGTAA-----------
Nematostella_vectensis|15216       ---------ANAGML---------------------------------------------
Ornithorhynchus_anatinus|3591      ---------SRAHLLTDDSHVVTMQVRKAGP---QTAEVPPLPCSHAVIVLC--------
Sorex_araneus|3963                 ---------PKAHLLQNTAHVITMQIRKPAQ---NCLRTEPSHAGHPEG-----------
Echinops_telfairi|14874            ---------PKANLLNNEAHTVTMQVKKPTQ---SCSRVQSCDTYNSKQ-----------
Felis_catus|2050                   ---------PKAHLLNNEAHVITMQVKKPTQ---SCFK----------------------
Microcebus_murinus|2425            ---------PKANLLNNEAHVITMQVKKPTQ---SCFRVEPSQTCRSER-----------
Myotis_lucifugus|5248              ---------PKAHLLNNEAHVITMQVKKSTQ---TYFRIESSQTCHSEG-----------
Otolemur_garnettii|4251            ---------PKANLLNSEAHVITMQV-KPTQ---NCFRVEASQTSHSEQ-----------
Macropus_eugenii|8480              ---------PKAHLLNNEEYVITMKVKKDMK---GSLK----------------------
Procavia_capensis|15649            ---------PKANLLNNEAHVITMQVKKPTQ---SCFRVEANQTCHLEQ-----------
Anolis_carolinensis|16826          ---------PKADLLKNKGHVITMQVIASKS---SI------------------------
Dipodomys_ordii|15659              ---------XXXXXXXXXXXXXXXXXXXXXX---XXXXVESSNTSRSDR-----------
Gallus_gallus|15565                ---------PKAGLLRNEAHIITIQGTTNKK---SIHRNKPSESSNSEG-----------
Xenopus_tropicalis|58              ------------------------------------------------------------
Dasypus_novemcinctus|6828          ------------------------------------------------------------
Tursiops_truncatus|7832            ---------PKANLLNNEEHVITMQVKKPMQ---SCFRAESPQSCHSEG-----------
Choloepus_hoffmanni|2173           ---------PKANLLNSEAHVITMQVMKPTQ---SCFRIESSPTCHSEQ-----------
Erinaceus_europaeus|10146          ------------------------------------------------------------
Tupaia_belangeri|4011              ---------PKANLLNSEAHVITIQVKKPTQ---SWCGVDSSQTCPSKQ-----------
Pteropus_vampyrus|16733            ---------PKANLLNNEAHVITMQVKKSTQ---SYFRIESSQICHSEE-----------
Vicugna_pacos|5471                 ---------PKANLLNNEAHVITMQVKKATQ---NCFGIESPESCHSEG-----------
Rattus_norvegicus|9438             ---------PRASLLSNEGHAVTMQVKRSTQSSVRTGPAASPEACEVDS-----------
Monodelphis_domestica|6914         ---------PKAHLLNNEEHIITMKVKKNTK---GSSKVESSQVSNSEA-----------
Echinops_telfairi|15123            ---------PNAN-LNNEAHTVTMQVKKPTQ---SCSRVQSCETYNSEQ-----------
Mus_musculus|14913                 ---------PRACLLSNEAHAVTMQVKKSAQ---SSVRGALSEARQVEQ-----------
Equus_caballus|22224               ---------PKADLLNNEAHVISMQVKKPTQ---SCFRTEPPQTCHPEG-----------
Tarsius_syrichta|5523              ---------PKANLLNSETHTITMQVKKPMQ---NCFKAESSQSCHSEQ-----------
Canis_familiaris|5711              ---------PKANLLNNEAHVITMQMKKPTQ---SCFRIESSQTCHSEG-----------
Loxodonta_africana|6793            ---------PKANLLNNEAHVITMQVKKPTQ---SCFRVESPQTCHSEQ-----------
Sus_scrofa|610                     ---------PKANLLNNEAHVITMQVKRPTQ---SCFRIESPQSCHSEG-----------
Bos_taurus|24424                   ---------PKANLLNNEAHVITMRVKKPTQ---NCFRTESPQTCHSEG-----------
Ochotona_princeps|7452             ---------PKASLLNSETHAITMQVKKPNK---NCFR----------------------
Callithrix_jacchus|214             ---------PKANLLNNEAHAITMQVTKSTQ---NSFRVESSQTCHSEQ-----------
Gorilla_gorilla|9778               ---------PKANLLNNEAHAITMQVTKSMQ---NSFRAESSQTCHSEQ-----------
Homo_sapiens|42290                 ---------PKANLLNNEAHAITMQVTKSTQ---NSFRAESSQTCHSEQ-----------
Pan_troglodytes|25424              ---------PKANLLNNEAHAITMQVTKSTQ---NSFRAESSQTCHSEQ-----------
Pongo_abelii|9221                  ---------PKANLLNNEAHAITMQVTKSTQ---NSFRVESSQTCHSEQ-----------
Rhesus_macaque|4430                ---------PKANLLNNDAHAITMQVTKSTQ---NSFRAESSQTCHSEQ-----------
Cavia_porcellus|9408               ---------PKANLLNSEAHVISMQVKKPTQ---SSFKAESSETC-SER-----------
Spermophilus_tridecemlineatus|5661 ---------PKANLLNSESHVITMQVKKRTQ---SNFK----------------------

Tribolium_castaneum|4546           ------------------------------------------------------------
Ornithorhynchus_anatinus|6961      ------------------------------------------------------------
Caenorhabditis_elegans|12506       ------------------------------------------------------------
Nasonia_vitripennis|6518           ------------------------------------------------------------
Apis_mellifera|6720                ------------------------------------------------------------
Linepithema_humile|14186           ------------------------------------------------------------
Pogonomyrmex_barbatus|10899        ------------------------------------------------------------
Ixodes_scapularis|18871            -------------------------RKTSSAGSQASSQRKNRAE----------------
Bombyx_mori|5666                   ------------------------DNKSVKRKTEPPPQVKVKRRLVEIDD----------
Danio_rerio|9163                   -------SRSKVEGKRPAESGDQKSAKKVKPLP---------------------------
Tetraodon_nigroviridis|16936       ----------------------------------PDCGDAPKSKKAKAGPH---------
Fugu_rubripes|1259                 ------------------------------------------------------------
Gasterosteus_aculeatus|1254        ------------------------------------------------------------
Oryzias_latipes|15233              ------------------------------------------------------------
Nematostella_vectensis|15216       ------------------------------------------------------------
Ornithorhynchus_anatinus|3591      ------------------------------------------------------------
Sorex_araneus|3963                 --------ADRKREGHSGNSQ----KRAADPAPPPKQT---GAKKRKTVSA---------
Echinops_telfairi|14874            -------ADKKEQEKKSSNFQ----RKSANMLQQSDFKNT-GAKKRKIEDV---------
Felis_catus|2050                   ------------------------------------------------------------
Microcebus_murinus|2425            --------PDKKEEKNSGNFQ----KKSANMLQQSGSKNT-GAKKRKTDDV---------
Myotis_lucifugus|5248              -------SDKKKEGKNSGNFQ----KKSANILQQSDTKNT-GAKKRKIDDA---------
Otolemur_garnettii|4251            --------PDKKEEKNSGNFQ----KKAANMLQHSGSKNT-GAKKRKIDDA---------
Macropus_eugenii|8480              ------------------------------------------------------------
Procavia_capensis|15649            -------HDRK-------------------------------------------------
Anolis_carolinensis|16826          ------------------------------------------------------------
Dipodomys_ordii|15659              -------AGEVGERNASGKFQ-----KPARTPQHS------GAKKRKVEVDG--------
Xenopus_tropicalis|58              ------------------------------------------------------------
Dasypus_novemcinctus|6828          ------------------------------------------------------------
Tursiops_truncatus|7832            -------ADKKRGEKSPSNFQ----KKSENMLQQPDCKIT-GAKKRKIDNA---------
Choloepus_hoffmanni|2173           -------ADRKKEEKNSGDFQ----KKSANKIHQSEAKNT-GAKKRKMDDAQ--------
Erinaceus_europaeus|10146          ------------------------------------------------------------
Tupaia_belangeri|4011              ------AADKNKEDRSSGNFQ----KKSANVGQQSGTKNT-GAKKRKINDA---------
Pteropus_vampyrus|16733            -------ANKKREEKNSGNFQ----KKSANMPQQ--SKNT-GAKKRKIDDA---------
Vicugna_pacos|5471                 -------ADKKMEEKGPSNFQ----KKSTNVFQQPDCKKT-GAKKRKIDD----------
Rattus_norvegicus|9438             -------KGKEKSSDIPDESI--------------------RFHYRWL------------
Monodelphis_domestica|6914         --------ERKMEEKYLGNFQNTNVKKHGNQLKELHSETT-KAKKRKLDNL---------
Echinops_telfairi|15123            -------ADKKEQEKKPSNFQ----RKSANMLQQSDFKNT-GAKKRKIEDV---------
Mus_musculus|14913                 -------VDSKGEEQSSGNSQ-----KSKSRLQPSGSKNA-GAKKRKLDDA---------
Equus_caballus|22224               -------ADRKREGKNSGNFQ----KKSANMLQQSEAKNT-GAKKRKIDDA---------
Tarsius_syrichta|5523              -------ADKKREEKSSGNFQ----KKSTGMLQQSGSRNT-GAKKRKIDDA---------
Canis_familiaris|5711              -------ADKKREEKNSAVLF---------------------------------------
Loxodonta_africana|6793            -------AERKRPEKKSGNFQ-----KSANMLQQSDSKTT-GAKKRKLDDV---------
Sus_scrofa|610                     -------ADKKREEKNSSNYQ-----KSAHMLQQSNCNKTIGAKKRKIDNA---------
Bos_taurus|24424                   -------TNKKREEKTPRNFL----KRSANMLQQPDCKNT-GAKKRKIDNA---------
Ochotona_princeps|7452             ------------------------------------------------------------
Callithrix_jacchus|214             -------GDKKMEKKHSGNFQ----KKPANMLQQSGSKHT-GAKKRKMDDA---------
Gorilla_gorilla|9778               -------GDKKMEEKNSGNFQ----KKAANMLQQSGSKNT-GAKKRKIDDA---------
Homo_sapiens|42290                 -------GDKKMEEKNSGNFQ----KKAANMLQQSGSKNT-GAKKRKIDDA---------
Pan_troglodytes|25424              -------GDKKMEEKNSGNFQ----KKAANMLQQSGSKNT-GAKKRKIDDA---------
Pongo_abelii|9221                  -------GDKKMEEKNSGNFQ----KKAANMLQQSGSKNT-GAKKRKIDDA---------
Rhesus_macaque|4430                -------GDKKMEEKNSGNFQ----KKAANMLQQSGSKNT-GAKKRKIDDA---------
Cavia_porcellus|9408               -------VDKMRGEKNSGNFQ-----NSANMFQQPGSKNP-RGKKRKLDDA---------
Spermophilus_tridecemlineatus|5661 ------------------------------------------------------------

Tribolium_castaneum|4546           ------------------------------------------------------------
Ornithorhynchus_anatinus|6961      ------------------------------------------------------------
Culex_quinquefasciatus|18286       IEIDET------------------------------------------------------
Caenorhabditis_elegans|12506       ------------------------------------------------------------
Pediculus_humanus|9033             ------------------------------------------------------------
Nasonia_vitripennis|6518           ------------------------------------------------------------
Apis_mellifera|6720                ------------------------------------------------------------
Linepithema_humile|14186           ------------------------------------------------------------
Pogonomyrmex_barbatus|10899        ------------------------------------------------------------
Ixodes_scapularis|18871            ------------------------------------------------------------
Bombyx_mori|5666                   ------------------------------------------------------------
Danio_rerio|9163                   ------------------------------------------------------------
Tetraodon_nigroviridis|16936       ------------------------------------------------------------
Fugu_rubripes|1259                 ------------------------------------------------------------
Gasterosteus_aculeatus|1254        ------------------------------------------------------------
Oryzias_latipes|15233              ------------------------------------------------------------
Nematostella_vectensis|15216       ------------------------------------------------------------
Ornithorhynchus_anatinus|3591      ------------------------------------------------------------
Sorex_araneus|3963                 ------------------------------------------------------------
Echinops_telfairi|14874            ------------------------------------------------------------
Felis_catus|2050                   ------------------------------------------------------------
Microcebus_murinus|2425            ------------------------------------------------------------
Myotis_lucifugus|5248              ------------------------------------------------------------
Otolemur_garnettii|4251            ------------------------------------------------------------
Macropus_eugenii|8480              ------------------------------------------------------------
Procavia_capensis|15649            ------------------------------------------------------------
Anolis_carolinensis|16826          ------------------------------------------------------------
Dipodomys_ordii|15659              ------------------------------------------------------------
Gallus_gallus|15565                ------------------------------------------------------------
Xenopus_tropicalis|58              ------------------------------------------------------------
Dasypus_novemcinctus|6828          ------------------------------------------------------------
Tursiops_truncatus|7832            ------------------------------------------------------------
Choloepus_hoffmanni|2173           ------------------------------------------------------------
Erinaceus_europaeus|10146          ------------------------------------------------------------
Tupaia_belangeri|4011              ------------------------------------------------------------
Pteropus_vampyrus|16733            ------------------------------------------------------------
Vicugna_pacos|5471                 ------------------------------------------------------------
Rattus_norvegicus|9438             ------------------------------------------------------------
Monodelphis_domestica|6914         ------------------------------------------------------------
Echinops_telfairi|15123            ------------------------------------------------------------
Mus_musculus|14913                 ------------------------------------------------------------
Equus_caballus|22224               ------------------------------------------------------------
Tarsius_syrichta|5523              ------------------------------------------------------------
Canis_familiaris|5711              ------------------------------------------------------------
Loxodonta_africana|6793            ------------------------------------------------------------
Sus_scrofa|610                     ------------------------------------------------------------
Bos_taurus|24424                   ------------------------------------------------------------
Ochotona_princeps|7452             ------------------------------------------------------------
Callithrix_jacchus|214             ------------------------------------------------------------
Gorilla_gorilla|9778               ------------------------------------------------------------
Homo_sapiens|42290                 ------------------------------------------------------------
Pan_troglodytes|25424              ------------------------------------------------------------
Pongo_abelii|9221                  ------------------------------------------------------------
Rhesus_macaque|4430                ------------------------------------------------------------
Cavia_porcellus|9408               ------------------------------------------------------------
Spermophilus_tridecemlineatus|5661 ------------------------------------------------------------

Tribolium_castaneum|4546           ------------------------------------------------------------
Ornithorhynchus_anatinus|6961      ------------------------------------------------------------
Culex_quinquefasciatus|18286       ------------------------------------------------------------
Caenorhabditis_elegans|12506       ------------------------------------------------------------
Pediculus_humanus|9033             ------------------------------------------------------------
Nasonia_vitripennis|6518           ------------------------------------------------------------
Apis_mellifera|6720                ------------------------------------------------------------
Linepithema_humile|14186           ------------------------------------------------------------
Pogonomyrmex_barbatus|10899        ------------------------------------------------------------
Ixodes_scapularis|18871            ------------------------------------------------------------
Bombyx_mori|5666                   ------------------------------------------------------------
Danio_rerio|9163                   ------------------------------------------------------------
Tetraodon_nigroviridis|16936       ------------------------------------------------------------
Fugu_rubripes|1259                 ------------------------------------------------------------
Gasterosteus_aculeatus|1254        ------------------------------------------------------------
Oryzias_latipes|15233              ------------------------------------------------------------
Branchiostoma_floridae|29294       VSKADTGRKRKRKERKSVSSGQQHRKKQ-----------------------NQIGS----
Nematostella_vectensis|15216       ------------------------------------------------------------
Ornithorhynchus_anatinus|3591      ------------------------------------------------------------
Sorex_araneus|3963                 ------------------------------------------------------------
Echinops_telfairi|14874            ------------------------------------------------------------
Felis_catus|2050                   ------------------------------------------------------------
Microcebus_murinus|2425            ------------------------------------------------------------
Myotis_lucifugus|5248              ------------------------------------------------------------
Otolemur_garnettii|4251            ------------------------------------------------------------
Macropus_eugenii|8480              ------------------------------------------------------------
Procavia_capensis|15649            ------------------------------------------------------------
Anolis_carolinensis|16826          ------------------------------------------------------------
Dipodomys_ordii|15659              ------------------------------------------------------------
Gallus_gallus|15565                ------------------------------------------------------------
Xenopus_tropicalis|58              ------------------------------------------------------------
Dasypus_novemcinctus|6828          ------------------------------------------------------------
Tursiops_truncatus|7832            ------------------------------------------------------------
Choloepus_hoffmanni|2173           ------------------------------------------------------------
Erinaceus_europaeus|10146          ------------------------------------------------------------
Tupaia_belangeri|4011              ------------------------------------------------------------
Pteropus_vampyrus|16733            ------------------------------------------------------------
Vicugna_pacos|5471                 ------------------------------------------------------------
Rattus_norvegicus|9438             ------------------------------------------------------------
Monodelphis_domestica|6914         ------------------------------------------------------------
Echinops_telfairi|15123            ------------------------------------------------------------
Mus_musculus|14913                 ------------------------------------------------------------
Equus_caballus|22224               ------------------------------------------------------------
Tarsius_syrichta|5523              ------------------------------------------------------------
Canis_familiaris|5711              ------------------------------------------------------------
Loxodonta_africana|6793            ------------------------------------------------------------
Sus_scrofa|610                     ------------------------------------------------------------
Bos_taurus|24424                   ------------------------------------------------------------
Ochotona_princeps|7452             ------------------------------------------------------------
Callithrix_jacchus|214             ------------------------------------------------------------
Gorilla_gorilla|9778               ------------------------------------------------------------
Homo_sapiens|42290                 ------------------------------------------------------------
Pan_troglodytes|25424              ------------------------------------------------------------
Pongo_abelii|9221                  ------------------------------------------------------------
Rhesus_macaque|4430                ------------------------------------------------------------
Cavia_porcellus|9408               ------------------------------------------------------------
Spermophilus_tridecemlineatus|5661 ------------------------------------------------------------

Tribolium_castaneum|4546           ------------------------------------------------------------
Ornithorhynchus_anatinus|6961      ------------------------------------------------------------
Culex_quinquefasciatus|18286       ------------------------------------------------------------
Caenorhabditis_elegans|12506       ------------------------------------------------------------
Pediculus_humanus|9033             ------------------------------------------------------------
Nasonia_vitripennis|6518           ------------------------------------------------------------
Apis_mellifera|6720                ------------------------------------------------------------
Linepithema_humile|14186           ------------------------------------------------------------
Pogonomyrmex_barbatus|10899        ------------------------------------------------------------
Ixodes_scapularis|18871            ------------------------------------------------------------
Bombyx_mori|5666                   ------------------------------------------------------------
Danio_rerio|9163                   ------------------------------------------------------------
Fugu_rubripes|4547                 ------------------------------------------------------------
Tetraodon_nigroviridis|16936       ------------------------------------------------------------
Fugu_rubripes|1259                 ------------------------------------------------------------
Gasterosteus_aculeatus|1254        ------------------------------------------------------------
Oryzias_latipes|15233              ------------------------------------------------------------
Branchiostoma_floridae|29294       -----------QLCDTNCT-----------------------------------------
Nematostella_vectensis|15216       ------------------------------------------------------------
Ornithorhynchus_anatinus|3591      ------------------------------------------------------------
Sorex_araneus|3963                 ------------------------------------------------------------
Echinops_telfairi|14874            ------------------------------------------------------------
Felis_catus|2050                   ------------------------------------------------------------
Microcebus_murinus|2425            ------------------------------------------------------------
Myotis_lucifugus|5248              ------------------------------------------------------------
Otolemur_garnettii|4251            ------------------------------------------------------------
Macropus_eugenii|8480              ------------------------------------------------------------
Procavia_capensis|15649            ------------------------------------------------------------
Anolis_carolinensis|16826          ------------------------------------------------------------
Dipodomys_ordii|15659              ------------------------------------------------------------
Gallus_gallus|15565                ------------------------------------------------------------
Xenopus_tropicalis|58              ------------------------------------------------------------
Dasypus_novemcinctus|6828          ------------------------------------------------------------
Tursiops_truncatus|7832            ------------------------------------------------------------
Choloepus_hoffmanni|2173           ------------------------------------------------------------
Erinaceus_europaeus|10146          ------------------------------------------------------------
Tupaia_belangeri|4011              ------------------------------------------------------------
Pteropus_vampyrus|16733            ------------------------------------------------------------
Vicugna_pacos|5471                 ------------------------------------------------------------
Rattus_norvegicus|9438             ------------------------------------------------------------
Monodelphis_domestica|6914         ------------------------------------------------------------
Echinops_telfairi|15123            ------------------------------------------------------------
Mus_musculus|14913                 ------------------------------------------------------------
Equus_caballus|22224               ------------------------------------------------------------
Tarsius_syrichta|5523              ------------------------------------------------------------
Canis_familiaris|5711              ------------------------------------------------------------
Loxodonta_africana|6793            ------------------------------------------------------------
Sus_scrofa|610                     ------------------------------------------------------------
Bos_taurus|24424                   ------------------------------------------------------------
Ochotona_princeps|7452             ------------------------------------------------------------
Callithrix_jacchus|214             ------------------------------------------------------------
Gorilla_gorilla|9778               ------------------------------------------------------------
Homo_sapiens|42290                 ------------------------------------------------------------
Pan_troglodytes|25424              ------------------------------------------------------------
Pongo_abelii|9221                  ------------------------------------------------------------
Rhesus_macaque|4430                ------------------------------------------------------------
Cavia_porcellus|9408               ------------------------------------------------------------
Spermophilus_tridecemlineatus|5661 ------------------------------------------------------------

Tribolium_castaneum|4546           ------------------------------------
Ornithorhynchus_anatinus|6961      ------------------------------------
Culex_quinquefasciatus|18286       ------------------------------------
Caenorhabditis_elegans|12506       ------------------------------------
Pediculus_humanus|9033             ------------------------------------
Nasonia_vitripennis|6518           ------------------------------------
Apis_mellifera|6720                ------------------------------------
Linepithema_humile|14186           ------------------------------------
Pogonomyrmex_barbatus|10899        ------------------------------------
Ixodes_scapularis|18871            ------------------------------------
Bombyx_mori|5666                   ------------------------------------
Danio_rerio|9163                   ------------------------------------
Fugu_rubripes|4547                 ------------------------------------
Tetraodon_nigroviridis|16936       ------------------------------------
Fugu_rubripes|1259                 ------------------------------------
Gasterosteus_aculeatus|1254        ------------------------------------
Oryzias_latipes|15233              ------------------------------------
Branchiostoma_floridae|29294       -----WKTELSIKIYCHLPFPSTQWAAASVDVVAVC
Branchiostoma_floridae|31798       GQKRRRRSRLSNQLYFSFSPPNNPYWGIT-------
Nematostella_vectensis|15216       ------------------------------------
Ornithorhynchus_anatinus|3591      ------------------------------------
Sorex_araneus|3963                 ------------------------------------
Echinops_telfairi|14874            ------------------------------------
Felis_catus|2050                   ------------------------------------
Microcebus_murinus|2425            ------------------------------------
Myotis_lucifugus|5248              ------------------------------------
Otolemur_garnettii|4251            ------------------------------------
Macropus_eugenii|8480              ------------------------------------
Procavia_capensis|15649            ------------------------------------
Anolis_carolinensis|16826          ------------------------------------
Dipodomys_ordii|15659              ------------------------------------
Gallus_gallus|15565                ------------------------------------
Xenopus_tropicalis|58              ------------------------------------
Dasypus_novemcinctus|6828          ------------------------------------
Tursiops_truncatus|7832            ------------------------------------
Choloepus_hoffmanni|2173           ------------------------------------
Erinaceus_europaeus|10146          ------------------------------------
Tupaia_belangeri|4011              ------------------------------------
Pteropus_vampyrus|16733            ------------------------------------
Vicugna_pacos|5471                 ------------------------------------
Rattus_norvegicus|9438             ------------------------------------
Monodelphis_domestica|6914         ------------------------------------
Echinops_telfairi|15123            ------------------------------------
Mus_musculus|14913                 ------------------------------------
Equus_caballus|22224               ------------------------------------
Tarsius_syrichta|5523              ------------------------------------
Canis_familiaris|5711              ------------------------------------
Loxodonta_africana|6793            ------------------------------------
Sus_scrofa|610                     ------------------------------------
Bos_taurus|24424                   ------------------------------------
Ochotona_princeps|7452             ------------------------------------
Callithrix_jacchus|214             ------------------------------------
Gorilla_gorilla|9778               ------------------------------------
Homo_sapiens|42290                 ------------------------------------
Pan_troglodytes|25424              ------------------------------------
Pongo_abelii|9221                  ------------------------------------
Rhesus_macaque|4430                ------------------------------------
Cavia_porcellus|9408               ------------------------------------
Spermophilus_tridecemlineatus|5661 ------------------------------------