Orthologs Set ID: EOG4006BT


Orthology Database
OrthoDB4
Gene Symbol(s)
CHN1

Phylogenetic Tree:


Transcript Architecture:


Species Transcript ID Positions
Anolis carolinensis 11713 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Anolis carolinensis 6157 1867, 2011, 2149, 2264
Bombyx mori 1440 148, 419, 671, 1678, 2011, 2149, 2264
Bos taurus 11426 101, 148, 250, 266, 286, 317, 351, 356, 380, 403, 412, 750, 1593, 1678, 1867, 2011, 2149, 2264
Bos taurus 20383 103, 148, 246, 284, 419, 747, 1530, 1549, 1566, 1593, 1678, 1867, 2011, 2149, 2264
Branchiostoma floridae 1548 1678, 1867, 2011, 2149, 2264
Caenorhabditis elegans 9662 112, 312, 447, 617, 1662, 2043, 2195, 2265
Callithrix jacchus 16234 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Callithrix jacchus 17478 507, 1569, 1677, 1797
Callithrix jacchus 22501 103, 148, 250, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Canis familiaris 20431 750, 1593, 1678, 1867, 1999, 2149, 2264
Canis familiaris 5395 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Cavia porcellus 12568 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Cavia porcellus 16884 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Cavia porcellus 24636 650, 1650
Choloepus hoffmanni 11191 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Choloepus hoffmanni 3438 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Culex quinquefasciatus 8347 148, 1678, 2149
Danio rerio 31268 1678, 1867, 2011, 2149, 2264
Danio rerio 9306 246, 284, 419, 639, 670, 693, 701, 743, 753, 1593, 1678, 1867, 2011, 2149, 2264
Daphnia pulex 23786 1678, 2011, 2149, 2264
Dasypus novemcinctus 1164 284, 419, 750, 1593, 1678, 1867, 2014, 2067, 2079, 2149, 2264
Dasypus novemcinctus 12376 89, 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Dipodomys ordii 13518 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Dipodomys ordii 1968 416, 471, 516, 750, 1593, 1678, 1764, 1867, 2011, 2149, 2264
Drosophila melanogaster 20217 148, 1593, 2149, 2264
Drosophila persimilis 9372 148, 2061, 2264
Drosophila simulans 12658 148, 1593, 2153, 2264
Drosophila willistoni 6759 148, 2149, 2264
Echinops telfairi 12695 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2277, 2282
Echinops telfairi 2788 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Equus caballus 20466 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Erinaceus europaeus 11556 58, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2282, 2304, 2355, 2406, 2415
Erinaceus europaeus 7699 103, 148, 246, 284, 419, 1512, 1515, 1521, 1530, 1539, 1593, 1678, 1867, 2011, 2149, 2264
Felis catus 38196 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264, 2397, 2411
Felis catus 45196 284, 290, 419, 750, 1593, 1678, 1775, 1867, 2011, 2149, 2264
Fugu rubripes 12054 103, 148, 246, 284, 419, 561, 750, 1593, 1678, 1867, 2011, 2149, 2264
Fugu rubripes 14746 419, 727, 851, 1211, 1368, 1593, 1678, 1867, 2011, 2149, 2264
Gallus gallus 18740 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Gallus gallus 8478 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Gasterosteus aculeatus 1240 103, 142, 246, 284, 419, 561, 750, 1593, 1678, 1867, 2011, 2149, 2264
Gasterosteus aculeatus 27934 103, 148, 246, 284, 419, 714, 1593, 1678, 1867, 2011, 2149, 2264
Gorilla gorilla 11189 419, 750, 1593, 1678, 1867, 1999, 2149, 2264, 2449
Gorilla gorilla 27910 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Homo sapiens 48422 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Ixodes scapularis 17566 1836, 2011, 2149, 2264
Loxodonta africana 14241 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Loxodonta africana 20466 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Macropus eugenii 10045 148, 246, 284, 419, 518, 750, 1593, 1678, 1867, 2011, 2149
Macropus eugenii 8027 284, 419, 750, 1593, 1678, 1867, 1901, 2011, 2149, 2264
Microcebus murinus 15358 284, 419, 438, 750, 1593, 1678, 1867, 2011, 2149, 2282
Microcebus murinus 8758 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Monodelphis domestica 19121 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Monodelphis domestica 32218 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Mus musculus 22308 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Mus musculus 35474 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Myotis lucifugus 13996 103, 148, 246, 284, 419, 750, 1593, 1678, 1718, 1730, 1867, 2011, 2149, 2264
Myotis lucifugus 15927 148, 246, 284, 419, 657, 750, 1516, 1593, 1678, 1867, 2011
Nematostella vectensis 14687 148, 284, 419, 484, 687, 708, 1593, 1678, 1765, 1867, 1985, 2149, 2264
Ochotona princeps 13791 284, 419, 750, 1593, 1678, 1867, 2011, 2040, 2149, 2264
Ochotona princeps 1540 87, 103, 148, 246, 284, 354, 419, 750, 1593, 1678, 1867, 2011, 2149
Ornithorhynchus anatinus 18048 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Ornithorhynchus anatinus 23474 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Oryzias latipes 10889 148, 246, 284, 419, 561, 744, 1593, 1678, 1867, 1980, 2149, 2264
Oryzias latipes 7013 103, 148, 246, 284, 419, 714, 1593, 1678, 1867, 2011, 2149, 2264
Otolemur garnettii 5617 105, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Otolemur garnettii 929 148, 246, 284, 372, 419, 750, 1593, 1678, 1867, 2011, 2149, 2282
Pan troglodytes 24690 750, 1593, 1678, 1867, 2011, 2149, 2264
Pan troglodytes 33528 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Pediculus humanus 1518 148, 419, 1678, 2011, 2149
Pongo abelii 18313 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Pongo abelii 25321 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Procavia capensis 1128 148, 246, 284, 419, 498, 550, 552, 750, 1593, 1678, 1867, 2011, 2014
Procavia capensis 2688 246, 284, 419, 663, 750, 1593, 1678, 1867, 2011, 2149, 2264
Pteropus vampyrus 10445 284, 419, 750, 1536, 1593, 1659, 1678, 1867, 2011, 2149, 2264
Pteropus vampyrus 4823 1566, 1575, 1587, 1593, 1678, 1867, 2011, 2149, 2264
Rattus norvegicus 16671 403
Rattus norvegicus 22026 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2008, 2149, 2264
Rattus norvegicus 25044 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Rhesus macaque 26807 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Rhesus macaque 9284 103, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Sorex araneus 10550 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2282
Sorex araneus 13650 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Spermophilus tridecemlineatus 2344 103, 104, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2259, 2261
Spermophilus tridecemlineatus 4303 112, 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2282, 2377, 2394
Sus scrofa 7275 103, 148, 246, 284, 416, 440, 465, 527, 565, 620, 663, 712, 1510, 1585, 1593, 1678, 1724, 1768, 1824, 1867, 2011, 2149
Sus scrofa 9306 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Taeniopygia guttata 13478 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Tarsius syrichta 890 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2181, 2196, 2264, 2304, 2343, 2361, 2391
Tarsius syrichta 9123 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264, 2439
Tetraodon nigroviridis 12063 103, 148, 246, 284, 419, 561, 750, 1593, 1678, 1867, 2011, 2149, 2264
Tetraodon nigroviridis 16104 103, 148, 246, 284, 419, 711, 738, 1593, 1678, 1867, 2011, 2149, 2264
Tribolium castaneum 7722 148, 419, 674, 1705, 2011, 2149, 2264
Tupaia belangeri 12767 148, 246, 284, 419, 750, 1593, 1608, 1678, 1694, 1867, 2011, 2149, 2239, 2282
Tupaia belangeri 17337 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Tursiops truncatus 17458 246, 284, 419, 750, 1593, 1678, 1867, 1908, 2011, 2149, 2264
Tursiops truncatus 357 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Vicugna pacos 12004 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Vicugna pacos 6873 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264
Xenopus tropicalis 20641 1593, 1678, 1867, 2011, 2149, 2264
Xenopus tropicalis 6414 148, 246, 284, 419, 750, 1593, 1678, 1867, 2011, 2149, 2264

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Anolis carolinensis 6157 ENSACAT00000009238 ENSACAG00000009221 CHN1 anoCar1
Anolis carolinensis 11713 ENSACAT00000007071 100567151 ENSACAG00000007001 chn2 anoCar1
Bombyx mori 1440 BGIBMGA012914-TA v2.0
Bos taurus 11426 ENSBTAT00000010556 508266 ENSBTAG00000008028 CHN1 bosTau4
Bos taurus 20383 ENSBTAT00000018499 ENSBTAG00000020931 Q0VD41_BOVIN bosTau4
Branchiostoma floridae 1548 fgenesh2_pg.scaffold_144000081 braFlo1
Caenorhabditis elegans 9662 BE0003N10.2, NM_064922 175268 WBGene00015267 chin-1 ce6
Callithrix jacchus 16234 ENSCJAT00000016439 100392207 ENSCJAG00000008406 CHN2 calJac3
Callithrix jacchus 17478 ENSCJAT00000010778 ENSCJAG00000005588 calJac3
Callithrix jacchus 22501 ENSCJAT00000015744 103787230 ENSCJAG00000008041 CHN1 calJac3
Canis familiaris 20431 ENSCAFT00000021113 ENSCAFG00000013293 canFam2
Canis familiaris 5395 ENSCAFT00000004872 475267 ENSCAFG00000003023 CHN2 canFam2
Cavia porcellus 12568 ENSCPOT00000002824 ENSCPOG00000002789 cavPor3
Cavia porcellus 16884 ENSCPOT00000013668 ENSCPOG00000013533 CHN2 cavPor3
Cavia porcellus 24636 ENSCPOT00000001791 ENSCPOG00000001770 cavPor3
Choloepus hoffmanni 11191 ENSCHOT00000011195 ENSCHOG00000011162 CHN2 choHof1
Choloepus hoffmanni 3438 ENSCHOT00000003438 ENSCHOG00000003425 CHN1 choHof1
Culex quinquefasciatus 8347 CPIJ009450-RA 6042028 CPIJ009450 CpipJ1
Danio rerio 9306 ENSDART00000014769 570999 ENSDARG00000011845 chn2 danRer6
Danio rerio 31268 ENSDART00000044626 406273 ENSDARG00000032493 chn1 danRer6
Daphnia pulex 23786 e_gw1.7.380.1 1.1
Dasypus novemcinctus 12376 ENSDNOT00000000404 101437684 ENSDNOG00000000404 CHN2 dasNov2
Dasypus novemcinctus 1164 ENSDNOT00000008172 ENSDNOG00000008169 CHN1 dasNov2
Dipodomys ordii 1968 ENSDORT00000002183 ENSDORG00000002182 Chn1 dipOrd1
Dipodomys ordii 13518 ENSDORT00000003980 ENSDORG00000003980 Chn2 dipOrd1
Drosophila melanogaster 20217 FBtr0070784, NM_132007 31473 FBgn0029778 RhoGAP5A dm3
Drosophila persimilis 9372 FBtr0182086 6597827 FBgn0154075 GL16471 droPer1
Drosophila simulans 12658 FBtr0216164 6725174 FBgn0187881 GD16254 droSim1
Drosophila willistoni 6759 FBtr0255610 6648962 FBgn0226918 GK24959 r1.3
Echinops telfairi 2788 ENSETET00000002729 ENSETEG00000002730 CHN2 TENREC
Echinops telfairi 12695 ENSETET00000012366 ENSETEG00000012365 CHN1 TENREC
Equus caballus 20466 ENSECAT00000013716 ENSECAG00000012830 CHN2 equCab2
Erinaceus europaeus 11556 ENSEEUT00000010449 ENSEEUG00000010428 CHN1 eriEur1
Erinaceus europaeus 7699 ENSEEUT00000006954 ENSEEUG00000006940 CHN2 eriEur1
Felis catus 38196 ENSFCAT00000008417 101093762 ENSFCAG00000008416 CHN2 felCat3
Felis catus 45196 ENSFCAT00000014109 ENSFCAG00000014105 CHN1 felCat3
Fugu rubripes 12054 ENSTRUT00000032605 101065292 ENSTRUG00000012830 fr2
Fugu rubripes 14746 ENSTRUT00000039907 ENSTRUG00000015557 chn2 fr2
Gallus gallus 8478 ENSGALT00000018199 428437 ENSGALG00000011164 CHN2 galGal3
Gallus gallus 18740 ENSGALT00000015119 429021 ENSGALG00000009293 CHN1 galGal3
Gasterosteus aculeatus 27934 ENSGACT00000010821 ENSGACG00000008146 chn2 gasAcu1
Gasterosteus aculeatus 1240 ENSGACT00000018803 ENSGACG00000014203 gasAcu1
Gorilla gorilla 11189 ENSGGOT00000002191 101132626 ENSGGOG00000002177 CHN1 gorGor3
Gorilla gorilla 27910 ENSGGOT00000012762 101124605 ENSGGOG00000012719 CHN2 gorGor3
Homo sapiens 48422 ENST00000409900, NM_001822 1123 ENSG00000128656 CHN1 hg19,GRCh37
Ixodes scapularis 17566 ISCW021497-RA ISCW021497 IscaW1
Loxodonta africana 20466 ENSLAFT00000002595 ENSLAFG00000002595 CHN2 loxAfr3
Loxodonta africana 14241 ENSLAFT00000011073 ENSLAFG00000011074 CHN1 loxAfr3
Macropus eugenii 10045 ENSMEUT00000010050 ENSMEUG00000010017 CHN2 Meug_1.0
Macropus eugenii 8027 ENSMEUT00000008021 ENSMEUG00000008006 CHN1 Meug_1.0
Microcebus murinus 8758 ENSMICT00000008146 ENSMICG00000008142 CHN2 micMur1
Microcebus murinus 15358 ENSMICT00000014294 ENSMICG00000014292 CHN1 micMur1
Monodelphis domestica 19121 ENSMODT00000012046 100025894 ENSMODG00000009464 CHN1 monDom5
Monodelphis domestica 32218 ENSMODT00000019477 100032581 ENSMODG00000015321 CHN2 monDom5
Mus musculus 35474 ENSMUST00000046856 69993 ENSMUSG00000004633 mm9
Mus musculus 22308 ENSMUST00000112024 108699 ENSMUSG00000056486 Chn1 mm9
Myotis lucifugus 15927 ENSMLUT00000015714 102419555 ENSMLUG00000015709 CHN1 myoLuc1
Myotis lucifugus 13996 ENSMLUT00000013824 102439633 ENSMLUG00000013813 myoLuc1
Nematostella vectensis 14687 e_gw.61.42.1 Nemve1
Ochotona princeps 13791 ENSOPRT00000003823 ENSOPRG00000003821 CHN1 OchPri2.0
Ochotona princeps 1540 ENSOPRT00000015284 ENSOPRG00000015290 CHN2 OchPri2.0
Ornithorhynchus anatinus 23474 ENSOANT00000013723 100084420 ENSOANG00000008609 CHN1 ornAna1
Ornithorhynchus anatinus 18048 ENSOANT00000014616 ENSOANG00000009180 CHN2 ornAna1
Oryzias latipes 7013 ENSORLT00000009332 101156676 ENSORLG00000007444 chn2 oryLat2
Oryzias latipes 10889 ENSORLT00000008037 101159729 ENSORLG00000006397 oryLat2
Otolemur garnettii 5617 ENSOGAT00000005421 100953761 ENSOGAG00000005418 CHN2 otoGar1
Otolemur garnettii 929 ENSOGAT00000000894 100967201 ENSOGAG00000000894 CHN1 otoGar1
Pan troglodytes 24690 ENSPTRT00000065312 ENSPTRG00000012659 CHN1 panTro2
Pan troglodytes 33528 ENSPTRT00000043671 472333 ENSPTRG00000019030 CHN2 panTro2
Pediculus humanus 1518 PHUM104930-RA 8238146 PHUM104930 PhumU1
Pongo abelii 25321 ENSPPYT00000020606 100451463 ENSPPYG00000017686 CHN2 ponAbe2
Pongo abelii 18313 ENSPPYT00000015047 103888516 ENSPPYG00000012950 CHN1 ponAbe2
Procavia capensis 1128 ENSPCAT00000004519 ENSPCAG00000004516 CHN2 proCap1
Procavia capensis 2688 ENSPCAT00000002376 ENSPCAG00000002371 CHN1 proCap1
Pteropus vampyrus 4823 ENSPVAT00000003747 ENSPVAG00000003747 CHN2 pteVam1
Pteropus vampyrus 10445 ENSPVAT00000004165 ENSPVAG00000004165 CHN1 pteVam1
Rattus norvegicus 16671 ENSRNOT00000058177 ENSRNOG00000038211 Chn3 rn4
Rattus norvegicus 22026 ENSRNOT00000068745 84030 ENSRNOG00000017939 Chn1 rn4
Rattus norvegicus 25044 ENSRNOT00000064524 84031 ENSRNOG00000009411 Chn2 rn4
Rhesus macaque 26807 ENSMMUT00000011650 697231 ENSMMUG00000008329 rheMac2
Rhesus macaque 9284 ENSMMUT00000030674 698697 ENSMMUG00000021797 rheMac2
Sorex araneus 10550 ENSSART00000010373 ENSSARG00000010374 CHN1 sorAra1
Sorex araneus 13650 ENSSART00000013441 101553236 ENSSARG00000013437 CHN2 sorAra1
Spermophilus tridecemlineatus 4303 ENSSTOT00000004304 101959617 ENSSTOG00000004301 Chn1 speTri1
Spermophilus tridecemlineatus 2344 ENSSTOT00000002344 101960151 ENSSTOG00000002346 Chn2 speTri1
Sus scrofa 7275 ENSSSCT00000017390 susScr2
Sus scrofa 9306 ENSSSCT00000018168 100514933 ENSSSCG00000016687 CHN2 susScr2
Taeniopygia guttata 13478 ENSTGUT00000009235 ENSTGUG00000008848 CHN1 taeGut1
Tarsius syrichta 9123 ENSTSYT00000004838 ENSTSYG00000004837 CHN1 tarSyr1
Tarsius syrichta 890 ENSTSYT00000002138 ENSTSYG00000002138 CHN2 tarSyr1
Tetraodon nigroviridis 16104 ENSTNIT00000004013 ENSTNIG00000018433 chn2 tetNig2
Tetraodon nigroviridis 12063 ENSTNIT00000011315 ENSTNIG00000008303 tetNig2
Tribolium castaneum 7722 GLEAN_09490 Tcas3.0
Tupaia belangeri 12767 ENSTBET00000012768 ENSTBEG00000012750 CHN1 tupBel1
Tupaia belangeri 17337 ENSTBET00000017338 ENSTBEG00000017337 CHN2 tupBel1
Tursiops truncatus 17458 ENSTTRT00000004010 ENSTTRG00000003997 CHN2 turTru1
Tursiops truncatus 357 ENSTTRT00000000406 101321578 ENSTTRG00000000406 CHN1 turTru1
Vicugna pacos 6873 ENSVPAT00000002674 102541557 ENSVPAG00000002675 CHN1 vicPac1
Vicugna pacos 12004 ENSVPAT00000012539 ENSVPAG00000012539 CHN2 vicPac1
Xenopus tropicalis 6414 ENSXETT00000032814 ENSXETG00000015003 chn1 xenTro2
Xenopus tropicalis 20641 ENSXETT00000026307 100496459 ENSXETG00000012047 chn2 xenTro2

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Anolis carolinensis 6776 ENSACAP00000006920 100567151 ENSACAG00000007001 chn2 anoCar1
Anolis carolinensis 8915 ENSACAP00000009045 ENSACAG00000009221 CHN1 anoCar1
Bombyx mori 12914 BGIBMGA012914-PA v2.0
Bos taurus 11176 ENSBTAP00000010556 508266 ENSBTAG00000008028 CHN1 bosTau4
Bos taurus 12381 ENSBTAP00000018499 ENSBTAG00000020931 Q0VD41_BOVIN bosTau4
Branchiostoma floridae 2299 fgenesh2_pg.scaffold_144000081 braFlo1
Caenorhabditis elegans 10583 BE0003N10.2 175268 WBGene00015267 chin-1 ce6
Callithrix jacchus 10022 ENSCJAP00000010197 ENSCJAG00000005588 calJac3
Callithrix jacchus 8841 ENSCJAP00000015559 100392207 ENSCJAG00000008406 CHN2 calJac3
Callithrix jacchus 14804 ENSCJAP00000014921 103787230 ENSCJAG00000008041 CHN1 calJac3
Canis familiaris 10799 ENSCAFP00000004517 475267 ENSCAFG00000003023 CHN2 canFam2
Canis familiaris 4583 ENSCAFP00000019607 ENSCAFG00000013293 canFam2
Cavia porcellus 9841 ENSCPOP00000002534 ENSCPOG00000002789 cavPor3
Cavia porcellus 13308 ENSCPOP00000012185 ENSCPOG00000013533 CHN2 cavPor3
Cavia porcellus 19521 ENSCPOP00000001601 ENSCPOG00000001770 cavPor3
Choloepus hoffmanni 9879 ENSCHOP00000009882 ENSCHOG00000011162 CHN2 choHof1
Choloepus hoffmanni 3034 ENSCHOP00000003032 ENSCHOG00000003425 CHN1 choHof1
Culex quinquefasciatus 6985 CPIJ009450 CpipJ1
Danio rerio 3031 ENSDARP00000044625 406273 ENSDARG00000032493 chn1 danRer6
Danio rerio 23908 ENSDARP00000027417 570999 ENSDARG00000011845 chn2 danRer6
Daphnia pulex 7162 JGI_V11_44407 1.1
Dasypus novemcinctus 10926 ENSDNOP00000000305 101437684 ENSDNOG00000000404 CHN2 dasNov2
Dasypus novemcinctus 1027 ENSDNOP00000006328 ENSDNOG00000008169 CHN1 dasNov2
Dipodomys ordii 1848 ENSDORP00000002048 ENSDORG00000002182 Chn1 dipOrd1
Dipodomys ordii 12715 ENSDORP00000003715 ENSDORG00000003980 Chn2 dipOrd1
Drosophila melanogaster 18687 FBpp0070750 31473 FBgn0029778 RhoGAP5A dm3
Drosophila persimilis 6308 FBpp0180578 6597827 FBgn0154075 GL16471 droPer1
Drosophila simulans 6370 FBpp0214656 6725174 FBgn0187881 GD16254 droSim1
Drosophila willistoni 14615 FBpp0254102 6648962 FBgn0226918 GK24959 r1.3
Echinops telfairi 2227 ENSETEP00000002231 ENSETEG00000002730 CHN2 TENREC
Echinops telfairi 10016 ENSETEP00000010031 ENSETEG00000012365 CHN1 TENREC
Equus caballus 10649 ENSECAP00000010906 ENSECAG00000012830 CHN2 equCab2
Erinaceus europaeus 9515 ENSEEUP00000009526 ENSEEUG00000010428 CHN1 eriEur1
Erinaceus europaeus 6332 ENSEEUP00000006344 ENSEEUG00000006940 CHN2 eriEur1
Felis catus 3769 ENSFCAP00000007802 101093762 ENSFCAG00000008416 CHN2 felCat3
Felis catus 11247 ENSFCAP00000013082 ENSFCAG00000014105 CHN1 felCat3
Fugu rubripes 32481 ENSTRUP00000032481 101065292 ENSTRUG00000012830 fr2
Fugu rubripes 39766 ENSTRUP00000039766 ENSTRUG00000015557 chn2 fr2
Gallus gallus 13804 ENSGALP00000018177 428437 ENSGALG00000011164 CHN2 galGal3
Gallus gallus 10198 ENSGALP00000015103 429021 ENSGALG00000009293 CHN1 galGal3
Gasterosteus aculeatus 10362 ENSGACP00000010799 ENSGACG00000008146 chn2 gasAcu1
Gasterosteus aculeatus 18185 ENSGACP00000018765 ENSGACG00000014203 gasAcu1
Gorilla gorilla 21684 ENSGGOP00000012403 101124605 ENSGGOG00000012719 CHN2 gorGor3
Gorilla gorilla 9338 ENSGGOP00000002145 101132626 ENSGGOG00000002177 CHN1 gorGor3
Homo sapiens 812 ENSP00000386741 1123 ENSG00000128656 CHN1 hg19,GRCh37
Ixodes scapularis 17564 ISCW021497-PA ISCW021497 IscaW1
Loxodonta africana 18396 ENSLAFP00000009266 ENSLAFG00000011074 CHN1 loxAfr3
Loxodonta africana 4858 ENSLAFP00000002172 ENSLAFG00000002595 CHN2 loxAfr3
Macropus eugenii 9142 ENSMEUP00000009143 ENSMEUG00000010017 CHN2 Meug_1.0
Macropus eugenii 7312 ENSMEUP00000007303 ENSMEUG00000008006 CHN1 Meug_1.0
Microcebus murinus 7416 ENSMICP00000007422 ENSMICG00000008142 CHN2 micMur1
Microcebus murinus 13029 ENSMICP00000013031 ENSMICG00000014292 CHN1 micMur1
Monodelphis domestica 18912 ENSMODP00000019132 100032581 ENSMODG00000015321 CHN2 monDom5
Monodelphis domestica 10976 ENSMODP00000011823 100025894 ENSMODG00000009464 CHN1 monDom5
Mus musculus 3485 ENSMUSP00000107655 108699 ENSMUSG00000056486 Chn1 mm9
Mus musculus 43220 ENSMUSP00000035908 69993 ENSMUSG00000004633 mm9
Myotis lucifugus 12569 ENSMLUP00000012578 102439633 ENSMLUG00000013813 myoLuc1
Myotis lucifugus 14309 ENSMLUP00000014313 102419555 ENSMLUG00000015709 CHN1 myoLuc1
Nematostella vectensis 7878 e_gw.61.42.1 Nemve1
Ochotona princeps 12022 ENSOPRP00000003518 ENSOPRG00000003821 CHN1 OchPri2.0
Ochotona princeps 1341 ENSOPRP00000013963 ENSOPRG00000015290 CHN2 OchPri2.0
Ornithorhynchus anatinus 7023 ENSOANP00000013720 100084420 ENSOANG00000008609 CHN1 ornAna1
Ornithorhynchus anatinus 25379 ENSOANP00000014613 ENSOANG00000009180 CHN2 ornAna1
Oryzias latipes 8741 ENSORLP00000009331 101156676 ENSORLG00000007444 chn2 oryLat2
Oryzias latipes 7510 ENSORLP00000008036 101159729 ENSORLG00000006397 oryLat2
Otolemur garnettii 4847 ENSOGAP00000004848 100953761 ENSOGAG00000005418 CHN2 otoGar1
Otolemur garnettii 798 ENSOGAP00000000798 100967201 ENSOGAG00000000894 CHN1 otoGar1
Pan troglodytes 11825 ENSPTRP00000056881 ENSPTRG00000012659 CHN1 panTro2
Pan troglodytes 12137 ENSPTRP00000043836 472333 ENSPTRG00000019030 CHN2 panTro2
Pediculus humanus 1476 PHUM104930-PA 8238146 PHUM104930 PhumU1
Pongo abelii 1808 ENSPPYP00000019823 100451463 ENSPPYG00000017686 CHN2 ponAbe2
Pongo abelii 4503 ENSPPYP00000014460 103888516 ENSPPYG00000012950 CHN1 ponAbe2
Procavia capensis 1053 ENSPCAP00000004238 ENSPCAG00000004516 CHN2 proCap1
Procavia capensis 2533 ENSPCAP00000002236 ENSPCAG00000002371 CHN1 proCap1
Pteropus vampyrus 4545 ENSPVAP00000003546 ENSPVAG00000003747 CHN2 pteVam1
Pteropus vampyrus 9838 ENSPVAP00000003944 ENSPVAG00000004165 CHN1 pteVam1
Rattus norvegicus 12415 ENSRNOP00000060544 84030 ENSRNOG00000017939 Chn1 rn4
Rattus norvegicus 4160 ENSRNOP00000054980 rn4
Rattus norvegicus 5148 ENSRNOP00000061064 84031 ENSRNOG00000009411 Chn2 rn4
Rhesus macaque 11584 ENSMMUP00000028709 698697 ENSMMUG00000021797 rheMac2
Rhesus macaque 22346 ENSMMUP00000010923 697231 ENSMMUG00000008329 rheMac2
Sorex araneus 12130 ENSSARP00000012134 101553236 ENSSARG00000013437 CHN2 sorAra1
Sorex araneus 9381 ENSSARP00000009381 ENSSARG00000010374 CHN1 sorAra1
Spermophilus tridecemlineatus 3863 ENSSTOP00000003863 101959617 ENSSTOG00000004301 Chn1 speTri1
Spermophilus tridecemlineatus 2098 ENSSTOP00000002096 101960151 ENSSTOG00000002346 Chn2 speTri1
Sus scrofa 16865 ENSSSCP00000016923 susScr2
Sus scrofa 17619 ENSSSCP00000017677 100514933 ENSSSCG00000016687 CHN2 susScr2
Taeniopygia guttata 12601 ENSTGUP00000009136 ENSTGUG00000008848 CHN1 taeGut1
Tarsius syrichta 823 ENSTSYP00000001977 ENSTSYG00000002138 CHN2 tarSyr1
Tarsius syrichta 8356 ENSTSYP00000004428 ENSTSYG00000004837 CHN1 tarSyr1
Tetraodon nigroviridis 7337 ENSTNIP00000011133 ENSTNIG00000008303 tetNig2
Tetraodon nigroviridis 4399 ENSTNIP00000003044 ENSTNIG00000018433 chn2 tetNig2
Tribolium castaneum 9250 GLEAN_09490 Tcas3.0
Tupaia belangeri 11048 ENSTBEP00000011063 ENSTBEG00000012750 CHN1 tupBel1
Tupaia belangeri 15080 ENSTBEP00000015076 ENSTBEG00000017337 CHN2 tupBel1
Tursiops truncatus 16536 ENSTTRP00000003777 ENSTTRG00000003997 CHN2 turTru1
Tursiops truncatus 342 ENSTTRP00000000379 101321578 ENSTTRG00000000406 CHN1 turTru1
Vicugna pacos 6377 ENSVPAP00000002473 102541557 ENSVPAG00000002675 CHN1 vicPac1
Vicugna pacos 11152 ENSVPAP00000011658 ENSVPAG00000012539 CHN2 vicPac1
Xenopus tropicalis 3901 ENSXETP00000026307 100496459 ENSXETG00000012047 chn2 xenTro2
Xenopus tropicalis 27600 ENSXETP00000032814 ENSXETG00000015003 chn1 xenTro2

multiple sequence alignment in CLUSTALW format


Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------------------------------------------------------
Bombyx_mori|1440                   ------------------------------------------------------------
Culex_quinquefasciatus|8347        ------------------------------------------------------------
Drosophila_willistoni|6759         ------------------------------------------ATGCCCCGCAGTGGAGCA
Drosophila_persimilis|9372         ---------------------------------------------ATGTCCCGAAACGCT
Drosophila_melanogaster|20217      ------------------------------ATGCCCCGGAACACGGAGGCGGGCGCCGGA
Drosophila_simulans|12658          ------------------------------ATGCCCCGGAACACGGAGGCGGGCGCCGGA
Pediculus_humanus|1518             ATGACATATATTAATTTTAAAAATAATTTTTTTCCAGTAAAAACAATATTCATTCCTGAT
Nematostella_vectensis|14687       ------------------------------------------------------------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------------------------------------------
Tarsius_syrichta|890               ------------------------------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ------------------------------------------------------ATGGCT
Oryzias_latipes|7013               ------------------------------------------------------ATGGCA
Fugu_rubripes|14746                ------------------------------------------------------------
Tetraodon_nigroviridis|16104       ------------------------------------------------------ATGGCA
Spermophilus_tridecemlineatus|2344 ------------------------------------------------------ATGGCA
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ------------------------------------------------------------
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              ------------------------------------------------------ATGGCA
Echinops_telfairi|2788             ------------------------------------------------------------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------------------------------------------------------ATGGCC
Vicugna_pacos|12004                ------------------------------------------------------------
Dasypus_novemcinctus|12376         ------------------------------------------------------ATGGCA
Myotis_lucifugus|13996             ------------------------------------------------------ATGGCA
Ochotona_princeps|1540             ---------------------------------------------------------ATG
Anolis_carolinensis|11713          ------------------------------------------------------ATGGCC
Gallus_gallus|8478                 ------------------------------------------------------ATGGCA
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------------------------------------------
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   ------------------------------------------------------ATGGCA
Loxodonta_africana|20466           ------------------------------------------------------ATGGCA
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ------------------------------------------------------------
Microcebus_murinus|8758            ------------------------------------------------------ATGGCA
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ------------------------------------------------------------
Mus_musculus|35474                 ------------------------------------------------------ATGGCA
Rattus_norvegicus|25044            ------------------------------------------------------ATGGCA
Cavia_porcellus|16884              ------------------------------------------------------ATGGCT
Callithrix_jacchus|16234           ------------------------------------------------------ATGGCA
Gorilla_gorilla|27910              ------------------------------------------------------ATGGCA
Pongo_abelii|25321                 ------------------------------------------------------ATGGCA
Pan_troglodytes|33528              ------------------------------------------------------atggca
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ------------------------------------------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------------------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ------------------------------------------------------------
Erinaceus_europaeus|11556          ---------------------------------------ATGGCCCTGACCCTGTTTGAT
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ------------------------------------------------------------
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ------------------------------------------------------------
Oryzias_latipes|10889              ------------------------------------------------------------
Gasterosteus_aculeatus|1240        ------------------------------------------------------------
Tetraodon_nigroviridis|12063       ------------------------------------------------------------
Fugu_rubripes|12054                ------------------------------------------------------------
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------------------------------------------
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            ---------------------------------------------GCTGCGGGAGCTAGG
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------------------------------------------------------
Taeniopygia_guttata|13478          ------------------------------------------------------------
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------------------------------------------
Rattus_norvegicus|22026            ------------------------------------------------------------
Ornithorhynchus_anatinus|23474     ------------------------------------------------------------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------------------------------------
Echinops_telfairi|12695            ------------------------------------------------------------
Cavia_porcellus|12568              ------------------------------------------------------------
Bos_taurus|11426                   ------------------------------------------------------------
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------------------------------------------
Callithrix_jacchus|22501           ------------------------------------------------------------
Rhesus_macaque|9284                ------------------------------------------------------------
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------------------------------
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ---------------------ATGGAAGACGACGGGCCTCCTGGGAGCTCGGGAGCATCA
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ---------------------------------ATGGGTTTCGAGTCGGATTCCCCGATC
Bombyx_mori|1440                   ------------------------------------------------ATGGAGAACTTG
Culex_quinquefasciatus|8347        ---------------------------------ATGGCGATAGAGCTTCCGTTATCGTGT
Drosophila_willistoni|6759         GCCGTAGCCGCAGCAGGAACAGCAGCGGGAACGGGAGCGGGTGAACCCAGTTCCCCAGTT
Drosophila_persimilis|9372         GCCGCGGGCGTGGTCGCCACTCTGCCTGGCGGAGGCGGCGGCGAGCCCAGCTCTCCAGTG
Drosophila_melanogaster|20217      AATGCGAATACCGGTGGATCCGGCGGAGTAGGCGGTGCCCCCGAGCCCAGTTCTCCGGTT
Drosophila_simulans|12658          AATGCGAGTATCGGCGGATCCGGCGGTGTAGGCGGTGCCCCCGAGCCCAGTTCTCCGGTT
Pediculus_humanus|1518             AAATATTTCTTATTCATTTTTTTTTTTTTAGGGACCACCTTGTGTGACAATAATCTTTCC
Nematostella_vectensis|14687       ---------------------------------GTCTACGATACAGTCGAAGATGACAAG
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------TCCGGCTCCTCGGTGTCCTCCGCTGAAGAATACCAG
Tarsius_syrichta|890               ---------------------------------------------GCTGAAGAATACCAG
Macropus_eugenii|10045             ---------------------------------------------GCTGAAGAATACCAG
Gasterosteus_aculeatus|27934       GCTTCCAGCAACTCAAGCCTCTCGGGTTCATCACTGTCCTCAGACCCTGAGGATTACCAG
Oryzias_latipes|7013               GCATCCAGCAACTCCAGCCTCTCAGGTTCATCCATGTCCTCTGACCCTGATGATTATCAG
Fugu_rubripes|14746                ------------------------------------------------------------
Tetraodon_nigroviridis|16104       GCATCCAGCAACTCAAGCCTCTCAGGTTCATCTCTGTCCTCGGACCCTGAGGATTACCAG
Spermophilus_tridecemlineatus|2344 GCGTCCAGCAACTCTAGCCTGTCCGGCTCCTCGGTATCCTCCGATGCTGAAGAATACCAG
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ---------------------------------------------GCTGAAGAATACCAG
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              GCGTCCAGCAACTCCAGCCTGTCCGGCTCCTCCGTGTCCTCTGATGCTGAAGAATACCAG
Echinops_telfairi|2788             ---------------------------------------------GCTGAAGAGTACCAG
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           GCGTCCAGCAACTCCAGCCTGTCCGGCTCCTCCGTGTCCTCCGATGCTGAGGAATACCAG
Vicugna_pacos|12004                ---------------------------------------------GCTGAAGAATACCAG
Dasypus_novemcinctus|12376         GCGTCCAGCAACTCCAGCCTGTCCGGCTCGCTGGTCTCCTCCGATGCTGAAGAGTACCAG
Myotis_lucifugus|13996             GCGTCCAGCAACTCCAGTCTGTCCGGCTCCTCCGTGTCCTCCGATGCTGAAGAATACCAG
Ochotona_princeps|1540             GCAGCGTCCAGCAACTCCAGCCTGTCCTCTTCGGTGTCTTCCGATGCTGAGGAATACCAG
Anolis_carolinensis|11713          ACCTCCAGCAACTCCAGTCTATCCGGCTCCTCGGTTTCCTCGGATGCTGAAGACTATCAA
Gallus_gallus|8478                 GCATCCAGCAACTCCAGTCTGTCCGGCTCGTCGGTTTCCTCCGATGCTGAAGAATACCAG
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------TTATTGTTGTTTTTTCTAGATGCAGAAGAATACCAG
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   GCGTCCAGCAACTCCAGCCTGTCCGGCTCCTCGGTGTCCTCTGATGCTGAAGAATACCAG
Loxodonta_africana|20466           GCGTCCAGCAACTCCAGCCTGTCCGGCTCCTCGGTCTCCTCCGATGCTGAAGAATACCAG
Procavia_capensis|1128             ---------------------------------------------GCTGAAGAATACCAG
Sorex_araneus|13650                ---------------------------------------------GCTGAGGAATACCAG
Microcebus_murinus|8758            GCGTCCAGCAACTCCAGCCTGTCCGGCTCCTCGGTGTCCTCCGATGCTGAAGAATACCAG
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ---------------------------------------------GCTGAAGAATACCAG
Mus_musculus|35474                 GCATCCAGCAACTCTAGTCTGTCCGGCTCCTCCGTGTCCTCTGATGCTGAGGAATACCAG
Rattus_norvegicus|25044            GCGTCCAGCAACTCTAGTCTGTCCGGCTCCTCCGTGTCCTCTGATGCTGAGGAATACCAG
Cavia_porcellus|16884              GCGTCCAGCAACTCCAGCCTGTCCGGCTCCTCAGTGTCCTCCGATGCTGAAGAATACCAG
Callithrix_jacchus|16234           GCGTCCAGTAACTCCAGCCTGTCCGGCTCCTCGGTGTCCTCCGATGCTGAAGAATACCAG
Gorilla_gorilla|27910              GCGTCCAGCAACTCCAGCCTGTCCGGCTCGTCGGTGTCCTCCGATGCTGAAGAATACCAG
Pongo_abelii|25321                 GCGTCCAGCAACTCCAGCCTGTCCGGCTCCTCGGTGTCCTCCGATGCTGAAGAATACCAG
Pan_troglodytes|33528              gcgTCCAGCAACTCTAGCCTGTCCGGCTCGTCGGTGTCCTCCGATGCTGAAGAATACCAG
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ---------------------------------------------GCTGAAGAATACCAG
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------GATGCCGAAGAATACCAG
Sus_scrofa|7275                    ------------------------ATGGCCCTGACCCTGTTTGATACAGATGAATATAGA
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ---------------------------------------------ACAGATGAATATAGA
Erinaceus_europaeus|11556          ACA---------------------------------------------GATGAATATAGA
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ---------------------------------------------ACAGATGAATATAGA
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ---------------------------------------------ACAGATGAATATAGA
Oryzias_latipes|10889              ------------------------------------------GATCATGACGATTATCGG
Gasterosteus_aculeatus|1240        ------------------------ATGGCTCTGAATGTGTTTGATCATGATGAATACAGG
Tetraodon_nigroviridis|12063       ------------------------ATGGCTTTAAACGTCTTTGaTCATGATGAATACAGG
Fugu_rubripes|12054                ------------------------ATGGCCTTAAACGTCTTTGATCACGATGAATACAGG
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------ATTCTTGTTTCTCTTGTAGACAATGACGAATACCGG
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            AGCGCCGGGCAGCACGGCTCCACCATGGCCCTGACCCTGTTCGATACAGATGAATATAGA
Myotis_lucifugus|15927             ---------------------------------------------ACAGATGAATATAGA
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ---------------------------GCCATTGTTCTTTCAGATACTGATGAATACAGA
Taeniopygia_guttata|13478          ------------------------TTTTTTTGTTTTCTTTCAGATACTGATGAATACAGA
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------ATGGCTCTGACCCTGTTCGATACAGATGAATATAGA
Rattus_norvegicus|22026            ---------------------------AGGTTAACATTATGTAATACAGATGAATATAGA
Ornithorhynchus_anatinus|23474     ---------AATAGTAATTGGTATTTTCTGCTTTTATTTTCAGATACAGATGAATATAGA
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------TGTTTTCTTTCAGATACAGATGAATATAGA
Echinops_telfairi|12695            ---------------------------------------------ACGGATGAATATAGA
Cavia_porcellus|12568              ------------------------------TTTGTTCTTTCAGATGCTGATGAATATAGG
Bos_taurus|11426                   ------------------------TTAAGCTTGGTTCTCAAAGACACAGATGAATATAGA
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------ATGGCCCTGACCCTGTTTGATACAGATGAATATAGA
Callithrix_jacchus|22501           ------------------------ATGGCCCTGACCCTGTTTGATACAGATGAATATAGA
Rhesus_macaque|9284                ------------------------ATGGCCCTGACCCTGTTTGATACAGATGAATATAGA
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------CTTTCAGATACAGATGAATATAGA
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        AAAGGATACTGGAAGCAAAAT------TTGTACCTTTTACAAGAAAAAGCGCCGAAACCC
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           CACACAGTTTGGAAGAGTGAC------CTGTACCGTATGCAGCTGGCTGCTCCCGTCCCT
Bombyx_mori|1440                   AAAAATATTTGGAAACCAGAG------TTGTATCGTATTCAAATGGAAGCTCCTGTACCG
Culex_quinquefasciatus|8347        CAAAAAGTCTGGAAACCCGAA------CTATACAAAATTCAACTAGGGGCACCATCGCCT
Drosophila_willistoni|6759         CAAAAAGTCTGGAAGCCAGAA------TTATACAAAATCCAATTGGAGGCACCTACTCCC
Drosophila_persimilis|9372         CAAAAGGTGTGGAAGCCCGAG------CTGTACAAGATCCAGCTGGAGGCCCCGGCCCCG
Drosophila_melanogaster|20217      CAGAAGGTTTGGAAGCCGGAA------TTGTACAAACTGCAGCTGGAGGCACCGGCTCCA
Drosophila_simulans|12658          CAGAAGGTTTGGAAGCCGGAA------TTGTACAAACTGCAGCTGGAGGCACCGGCTCCA
Pediculus_humanus|1518             AAAAATGTTTGGAAGCCTGAC------TTGTACAAACTTCAACAAGAAGCTCCTCAGCCA
Nematostella_vectensis|14687       GAACCAGTTTGGAAGTCCTAT------CTTTATCAACTCCAGCAAAAGGCACCTCAACCC
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            CCTCCAATATGGAAATCGTAC------TTATATCAGTTACAGCAAGAGGCACCTCGTCCC
Tarsius_syrichta|890               CCTCCAATATGGAAATCGTAC------TTGTACCAGTTACAGCAAGAAGCGCCTCGTCCC
Macropus_eugenii|10045             CCTCCGATATGGAAATCATAC------TTGTATCAGTTACAGCAAGAAGCGCCAAGGCCC
Gasterosteus_aculeatus|27934       CCGCCCATATGGAAGTCCTAC------TTGTACCAACTACAGCAAGAAGCCCCGAGACCA
Oryzias_latipes|7013               CCCCCCATATGGAAGTCCTAC------TTATACCAGCTACAGCAAGAGGCCCCAAGACCA
Fugu_rubripes|14746                ------------------------------------------------------------
Tetraodon_nigroviridis|16104       CCGCCCATATGGAAATCCTAC------TTGTACCAGCTCCAGCAGGAATCACCCAGACCC
Spermophilus_tridecemlineatus|2344 CCTCAAATATGGAAATCATAC------TTGTATCAGTTACAGCAAGAGGCGCCTCGTCCC
Danio_rerio|9306                   ---------------TCACCA------GTGTACCAGCTACAGCAGGAAGCACCGAGACCA
Choloepus_hoffmanni|11191          CCCCCGATCTGGAAATCGTAT------TTGTATCAGCTACAGCAAGAGGCACCTCGTCCC
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              CCTCCAATATGGAAATCATAC------TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Echinops_telfairi|2788             CCTCCGATATGGAAATCATAC------TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Xenopus_tropicalis|20641           ---------------------------------ATGCTAGCTGATGAGCCATGGCTGGAC
Erinaceus_europaeus|7699           CCTCCAATATGGAAATCTTAC------TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Vicugna_pacos|12004                CCTCCAATATGGAAATCGTAC------TTGTATCAGTTACAGCAAGAGGCCCCTCGTCCC
Dasypus_novemcinctus|12376         CCTCCAATCTGGAAATCGTAC------CTGTATCAGTTACAGCAAGAGGCACCTCGTCCC
Myotis_lucifugus|13996             CCTCCGATATGGAAATCTTAC------TTGTATCAGTTGCAGCAAGAGGCCCCTCGCCCC
Ochotona_princeps|1540             CCGCCAATATGGAAATCTTAC------TTGTATCAGCTACAGCAAGAGGCACCGCGTCCC
Anolis_carolinensis|11713          CCCCCAATATGGAAATCATAC------TTATATCAGCTACAACAAGAAGCACCTCGTCCC
Gallus_gallus|8478                 CCTCCAATATGGAAATCGTAC------TTGTATCAGTTACAACAAGAGGCACCACGTCCC
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     CCTCCAATATGGAAATCCTAC------TTGTATCAGTTGCAGCAGGAGGCACCCCGCCCC
Tursiops_truncatus|17458           ------------------------------TATCAGTTACAGCAAGAGGCCCCTCGTCCC
Bos_taurus|20383                   CCTCCAATATGGAAATCATAC------TTGTATCAGTTACAGCAAGAGGCCCCTCGTCCC
Loxodonta_africana|20466           CCTCCAATATGGAAATCGTAC------TTGTATCAGTTACAGCAAGAGGCACCTCGTCCC
Procavia_capensis|1128             CCTCCAATATGGAAATCGTAC------TTGTATCAGTTGCAGCAAGAGGCGCCTCGTCCC
Sorex_araneus|13650                CCTCCAATATGGAAATCTTAC------TTGTATCAGTTACAGCAAGAGGCTCCTCGTCCC
Microcebus_murinus|8758            CCTCCGATATGGAAATCGTAC------TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             CCTCCGATATGGAAATCATAC------TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Mus_musculus|35474                 CCTCCAATATGGAAATCATAC------TTGTATCAGCTGCAGCAAGAGGCACCTCGTCCC
Rattus_norvegicus|25044            CCTCCAATATGGAAATCATAC------TTGTATCAGCTCCAGCAAGAGGCACCTCGTCCC
Cavia_porcellus|16884              CCTCCGATATGGAAATCATAC------TTATATCAGCTACAGCAAGAGGCACCTCGTCCC
Callithrix_jacchus|16234           CCTCCAATATGGAAATCATAC------CTATATCAGTTACAGCAAGAGGCACCTCGTCCC
Gorilla_gorilla|27910              CCTCCGATATGGAAATCATAC------TTATATCAGTTACAGCAAGAGGCACCTCGTCCC
Pongo_abelii|25321                 CCTCCAATATGGAAATCATAC------TTATATCAGTTACAGCAAGAGGCACCTCGTCCC
Pan_troglodytes|33528              CCTCCAATATGGAAATCATAC------TTATATCAGTTACAGCAAGAGGCACCTCGTCCC
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              CCTCCAATATGGAAATCATAC------TTGTATCAATTACAGCAAGAGGCCCCTCGTCCC
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               CCTCCGATATGGAAATCGTAC------TTGTATCAGTTACAGCAAGAGGCCCCTCGTCCC
Sus_scrofa|7275                    CCTCCTGTTTGGAAATCTTAC------TTATATCAACTGCAGCAGGAAGCCCCTCATCCT
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             CCTCCTGTTTGGAAATCTTAT------TTATATCAGCTGCAGCAGGAAGCCCCTCATCCG
Erinaceus_europaeus|11556          CCACCTGTTTGGAAATCATAC------TTATATCAGCTGCAACAGGAAGCTCCCCATCCT
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 CCTCCTGTTTGGAAATCTTAC------TTAGATCAGCTGCAACAGGAAGCTCCTCGTTCT
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             CCTCCTGTTTGGAAATCTTAC------TTGTATCAGCTGCAGCAGGAAGCTCCTCATCCT
Oryzias_latipes|10889              CCGCCGGTGTGGAAGTCCTAC------TTGTACCAGCTCCAGCAGGAGGCGCCACACCCC
Gasterosteus_aculeatus|1240        CCACCCGTGTGGAAGTCTTACTCCACAGTGTACCAGCTCCAGCAGGAGGCGCCTCACCCA
Tetraodon_nigroviridis|12063       CCTCCAGTGTGGAAGTCTTAC------CTGtaccagctccagcaggaggcacCTCACCCA
Fugu_rubripes|12054                CCTCCAGTATGGAAGTCTTAT------TTATATCAGCTCCAACAGGAAGCACCTCACCCA
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            CCTCCTGTATGGAAATCATAC------TTGTATCAGCTGCAGCAAGAGGCTCCTCACCCC
Cavia_porcellus|24636              ------GTTTGGAAATCCTAC------TTGTATCAGCTACAACAGGAAGCCCCTCATCCT
Rattus_norvegicus|16671            CCTCCTGTTCGGAAATCTTAC------TTATACCAGCTGCAGCAGGAAGCCCCTCACCCT
Myotis_lucifugus|15927             CCTCCTGTTTGGAAATCTTAC------TTGTACCAGCTGCAACAGGAAGCTCCCCATCCT
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                CCACCTGTTTGGAAATCTTAC------TTGTATCAGTTGCAACAGGAAGCTCCCCATCCT
Taeniopygia_guttata|13478          CCACCTGTTTGGAAATCTTAC------TTGTATCAGTTGCAACAGGAAGCTCCCCATCCT
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 CCTCCTGTTTGGAAATCTTAC------TTATACCAGCTGCAGCAGGAAGCCCCTCACCCT
Rattus_norvegicus|22026            CCTCCTGTTTGGAAATCTTAC------TTATACCAGCTGCAGCAGGAAGCCCCTCACCCT
Ornithorhynchus_anatinus|23474     CCTCCTGTATGGAAATCTTAT------TTGTATCAGTTACAGCAGGAGGCCCCCCATCCT
Pan_troglodytes|24690              ------------------------------------------GGGGAGCTACCTCATCCG
Monodelphis_domestica|19121        CCTCCTGTATGGAAATCTTAC------TTATATCAGCTACAACAGGAAGCCCCCCATCCT
Echinops_telfairi|12695            CCTCCAGTTTGGAAATCTTAC------TTGTACCAGCTGCAGCAGGAAGCTCCTCACCCT
Cavia_porcellus|12568              CCTCCTGTTTGGAAATCCTAC------TTGTATCAGCTACAACAGGAAGCCCCTCATCCT
Bos_taurus|11426                   CCTCCTGTTTGGAAATCTTAC------TTATATCAACTGCAACAAGAAGCCCCTCATCCT
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 CCTCCTGTTTGGAAATCTTAC------TTATATCAGCTACAACAGGAAGCCCCTCATCCT
Callithrix_jacchus|22501           CCTCCTGTTTGGAAATCTTAC------TTATATCAGCTACAACAGGAAGCCCCTCATCCT
Rhesus_macaque|9284                CCTCCTGTTTGGAAATCTTAC------TTATATCAGCTACAACAGGAAGCCCCTCATCCT
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           CCTCCTGTTTGGAAATCTTAC------TTGTACCAGCTGCAACAGGAAGCCCCTCATCCT
Sorex_araneus|10550                ------------------------------TATCAGCTGCAGCAGGAAGCCCCTCATCCT
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        AACGCAGTTTTGTGC------------------------------------------CGA
Daphnia_pulex|23786                ---------ATGTGT---------------------------------------------
Tribolium_castaneum|7722           ATTCCCATAATCAGT---------------------------------------------
Bombyx_mori|1440                   AAGCGGGTTCCTTGT---------------------------------------------
Culex_quinquefasciatus|8347        AAGCCAATTTATGTT------------------------------------------GAT
Drosophila_willistoni|6759         AAGCCGTTGTTATGC------------------CAACGCATTCAGCGGAATGCTGATCCT
Drosophila_persimilis|9372         TGTCCGATGCGGTGCCAGCGCACCCTGCCGCTGCCGCCGACAAAGAGCACCGCCGAGGAA
Drosophila_melanogaster|20217      TGTCCACTGCGCTGCCAGCGAACACTGCCCCTTCCGCCGGCGAAAAGCACGGCTGAGGCC
Drosophila_simulans|12658          TGTCCACTGCGCTGCCAGCGAACACTGCCCCTTCCGCCGGCGAAAAGCACGGCTGAGGCC
Pediculus_humanus|1518             TTAAAAATTGAACCT------------------------------------------CAA
Nematostella_vectensis|14687       ATTTGCGTCGTTTGT------------------------------------------AAT
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            AAGAGGATCATTTGT------------------------------------------CCT
Tarsius_syrichta|890               AAGAGGATCATTTGT------------------------------------------CCT
Macropus_eugenii|10045             AAGAGGATCATCTGT------------------------------------------CCT
Gasterosteus_aculeatus|27934       AAGAGGATCACGTGT------------------------------------------CCC
Oryzias_latipes|7013               AAGAGGGTCACGTGT------------------------------------------CCT
Fugu_rubripes|14746                ------------------------------------------------------------
Tetraodon_nigroviridis|16104       AAGAGGATTACATGT------------------------------------------CCC
Spermophilus_tridecemlineatus|2344 AAGAGGATCATTTGT------------------------------------------CCT
Danio_rerio|9306                   AAGAGGATCACATGT------------------------------------------CCT
Choloepus_hoffmanni|11191          AAGAGGATTATTTGT------------------------------------------CCT
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              NNNNNNNNNNNNNNN------------------------------------------NNN
Echinops_telfairi|2788             NNNNNNNNNNNNNNN------------------------------------------NNN
Xenopus_tropicalis|20641           ACTGACAAGACTTGT------------------------------------------AAT
Erinaceus_europaeus|7699           NNNNNNNNNNNNNNN------------------------------------------NNN
Vicugna_pacos|12004                AAGAGGATCATTTGT------------------------------------------CCG
Dasypus_novemcinctus|12376         AAGAGGATCATTTGT------------------------------------------CCT
Myotis_lucifugus|13996             AAGAGGATCATTTGT------------------------------------------CCT
Ochotona_princeps|1540             AAGAGGATCATTTGT------------------------------------------CCT
Anolis_carolinensis|11713          AAGAGGATAATTTGT------------------------------------------CCT
Gallus_gallus|8478                 AAGAGAATCATCTGT------------------------------------------CCT
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     AAGAGGATCATCTGT------------------------------------------CCA
Tursiops_truncatus|17458           AAGAGGATCATTTGC------------------------------------------CCT
Bos_taurus|20383                   AAGAGGATCATTTGT------------------------------------------CCT
Loxodonta_africana|20466           AAGAGGATCATTTGT------------------------------------------CCT
Procavia_capensis|1128             AAGAGGATCATTTGT------------------------------------------CCT
Sorex_araneus|13650                AAGAGGATCATTTGC------------------------------------------CCG
Microcebus_murinus|8758            NNNNNNNNNNNNNNN------------------------------------------NNN
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             NNNNNNNNNNNNNNN------------------------------------------NNN
Mus_musculus|35474                 AAGAGGATCATTTGT------------------------------------------CCC
Rattus_norvegicus|25044            AAGAGGATCATTTGT------------------------------------------CCC
Cavia_porcellus|16884              AAGAGGATCATTTGT------------------------------------------CCT
Callithrix_jacchus|16234           AAGAGAATCATTTGT------------------------------------------CCT
Gorilla_gorilla|27910              AAGAGAATCATTTGT------------------------------------------CCT
Pongo_abelii|25321                 AAGAGAATCATTTGT------------------------------------------CCT
Pan_troglodytes|33528              AAGAGAATCATTTGT------------------------------------------CCT
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              AAGAGGATCATTTGT------------------------------------------CCT
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               AAGAGGATCATTTGT------------------------------------------CCT
Sus_scrofa|7275                    CGGAGAATTACCTGT------------------------------------------ACT
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             CGAAGGATTACCTGT------------------------------------------ACC
Erinaceus_europaeus|11556          CGAAGAGTCACCTGT------------------------------------------GCT
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 GGAAGGATTACCTGT------------------------------------------GCT
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             CGAAGGATTACCTGT------------------------------------------ACT
Oryzias_latipes|10889              CGCAGAGTCACCTGC------------------------------------------ACC
Gasterosteus_aculeatus|1240        CGCAGACTCACCTGC------------------------------------------ACC
Tetraodon_nigroviridis|12063       CGCAGACTCACCTGC------------------------------------------ACC
Fugu_rubripes|12054                CGCAGACTCACCTGC------------------------------------------ACC
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            CGGAGAATTACTTGT------------------------------------------ACC
Cavia_porcellus|24636              CAGACGATTACCTGT------------------------------------------ACT
Rattus_norvegicus|16671            CGAAGGATCACCTGC------------------------------------------ACT
Myotis_lucifugus|15927             CGAAGAATTACCTGT------------------------------------------ACT
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                AGAAGGATAACCTGC------------------------------------------ACT
Taeniopygia_guttata|13478          AGAAGAATAACCTGC------------------------------------------ACT
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 CGAAGGGTCACCTGC------------------------------------------ACT
Rattus_norvegicus|22026            CGAAGGGTCACCTGC------------------------------------------ACT
Ornithorhynchus_anatinus|23474     CGAAGGATTACCTGC------------------------------------------ACA
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        CGAAGGATTACCTGT------------------------------------------ACA
Echinops_telfairi|12695            CGGAGGATGACCTGT------------------------------------------ACT
Cavia_porcellus|12568              CGGAGGATTACCTGT------------------------------------------ACT
Bos_taurus|11426                   CGGAGAATTACCTGT------------------------------------------ACT
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------GTGAACTGT------------------------------------------GCA
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 CGAAGAATTACCTGT------------------------------------------ACT
Callithrix_jacchus|22501           CGAAGAATTACCTGT------------------------------------------ACT
Rhesus_macaque|9284                CGAAGAATTACCTGT------------------------------------------ACT
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           CGAAGGATAACCTGT------------------------------------------ACT
Sorex_araneus|10550                AGAAGAATTACCTGT------------------------------------------ACG
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        AAACCTCTTCAGCAG---AGACCTCGACAT---TTTGGAGCCGAATTTCACGGATTAATC
Daphnia_pulex|23786                ------------------CGAGCGGCAAGT------------------------------
Tribolium_castaneum|7722           GACGAGGTGCCTCCCGATTTGCCCAGTTTT---TTGGGCCGCGACTACCACGGGGCTATC
Bombyx_mori|1440                   GACCATTGTCCGGAT---AGACCTAAGTTT---TACGGGAAAGAATTTCATGGCATTCTA
Culex_quinquefasciatus|8347        AGTCTCAATGAAGAA---CGCCCAGACTTT---TATGGGCTTGAGTATCATGGGACAATA
Drosophila_willistoni|6759         CAAGATGCAATTGAAGAATCAGCCAGACGCCTTTATGGCAAGGAATATCACGGCATCATG
Drosophila_persimilis|9372         GTGGAGCAGGACAACCAGGCTGCGCGGCTA---TACGGCTCCGAGTACCATGGCCTGATG
Drosophila_melanogaster|20217      GTGGAGGCCAATAACTTGGCGGGCAGGCTA---TACGGCTCCGAGTACCATGGCCTGATG
Drosophila_simulans|12658          GTGGAGGCCAACAACTTGGCGGGCAGGCTA---TACGGCTCCGAGTACCATGGCCTGATG
Pediculus_humanus|1518             CAGTATGTCATACCT---AGATCAGAATTC---TGCGATAATGATTATCACGGTCCACTT
Nematostella_vectensis|14687       AACGAGGTAGTGAAT---CGCGTTATTGCT---GGAGTAACTATGTTTCATGGTTCTATT
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            CGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGANNNNNNNNNNNNNNNN
Tarsius_syrichta|890               CGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCACGGGATCATC
Macropus_eugenii|10045             CGGGAGNNNNNNNNN---NNNNNNNNNNNN---NNNNNNNNNNNGTTTCATGGGATCATC
Gasterosteus_aculeatus|27934       CAGGAGATGGAAAAC---AGACCCAAATAC---TACGGCAGAGAATTTCACGGCATGATC
Oryzias_latipes|7013               CAGGAGATGGAGACC---AGACCTAAATAC---TATGGCAGAGAGTTCCATGGCATGATC
Fugu_rubripes|14746                ------------------CGT------------TTCCTCTCCAGATTTCACGGCAGGATC
Tetraodon_nigroviridis|16104       CAGGAGATGGAGAGC---AGGCCCAAATAC---TATGGCAGAGAATTTCATGGCAGGGTG
Spermophilus_tridecemlineatus|2344 CGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGANNNNNNNNNNNNNNNN
Danio_rerio|9306                   CAGGAGATGGAAAGC---AGACCGAAATAC---TATGGTAGAGAGTTCCACGGTCTGATT
Choloepus_hoffmanni|11191          CGAGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCATGGAATCATC
Felis_catus|38196                  ------GTGGAGAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCATGGGATCATC
Dipodomys_ordii|13518              NGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCATGGGATTATC
Echinops_telfairi|2788             NNNNNNGTGGAGAAC---AGACCAAAATAT---TATGGAAGAGAGTTCCACGGGATCATC
Xenopus_tropicalis|20641           GCTGTCCACAGATCT---AAGAAG------------GGCAGGAAGCGGCAGGAGCTGCTA
Erinaceus_europaeus|7699           NNNNNNGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCATGGAATCATC
Vicugna_pacos|12004                GGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCACGGGATCATC
Dasypus_novemcinctus|12376         CGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCACGGGATCATC
Myotis_lucifugus|13996             GGGGAGGTGGAAAAC---AGACCAAAATAT---TACGGAAGAGAGTTCCACGGGATCATC
Ochotona_princeps|1540             CGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCATGGGATTATA
Anolis_carolinensis|11713          CGAGAGGTGGAGAAC---AGACCAAAGTAC---TATGGCAGAGAGTTTCATGGGATCATT
Gallus_gallus|8478                 CGGGAGGTGGAGAAC---AGACCAAAGTAT---TACGGAAGAGAGTTCCATGGGATAATT
Monodelphis_domestica|32218        ---------------------------------------------TTTCACGGGATCATC
Ornithorhynchus_anatinus|18048     CAGGAGGTGGAGAAC---CGGCCAAAATAT---TATGGAAGAGAATTCCATGGGATAATC
Tursiops_truncatus|17458           GGGGAGGTGGGAAAC---AGACCAAAATAT---TATGGAAGAGANNNNNNNNNNNNNNNN
Bos_taurus|20383                   GGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTCCACGGTATCATA
Loxodonta_africana|20466           CGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTCCATGGAATCATC
Procavia_capensis|1128             CGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGANNNNNNNNNNNNNNNN
Sorex_araneus|13650                GGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGGAGAGAGTTCCATGGGATCATC
Microcebus_murinus|8758            NNNNNNGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGANNNNNNNNNNNNNNNN
Sus_scrofa|9306                    ------GTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCATGGAATCATC
Tupaia_belangeri|17337             NNNNNNNNNNNNNNN---NNNNNNNNNNNN---NNNNNNNNNNNGTTTCACGGGATCATC
Mus_musculus|35474                 CGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCATGGGATCATC
Rattus_norvegicus|25044            CGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCATGGGATCATC
Cavia_porcellus|16884              CGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCATGGGATCATC
Callithrix_jacchus|16234           CGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCACGGGATCATC
Gorilla_gorilla|27910              CGGGAGGTGGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCACGGGATCATC
Pongo_abelii|25321                 CGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCACGGGATCATC
Pan_troglodytes|33528              CGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCACGGGATCATC
Rhesus_macaque|26807               ------GTGGAAAAC---AGACCAAAATAT---TATGGGAGAGAGTTTCATGGGATCATC
Canis_familiaris|5395              GGGGAGGTGGAGAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCACGGGATCATC
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               GGGGAGGTGGAAAAC---AGACCAAAATAT---TATGGAAGAGAATTTCATGGGATCATC
Sus_scrofa|7275                    AATGAGGTAGAAAAC---AGGCCAAAGTAT---TATGGAAGAGAGTTTCACGGCATGATC
Macropus_eugenii|8027              ------GTAGAAAAC---AGACCAAAATAT---TATGGAAGAGANNNNNNNNNNNNNNNN
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------GTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTCCACGGCATGATC
Tupaia_belangeri|12767             TGTGAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCACGGCATGATC
Erinaceus_europaeus|11556          AATGAGGTGGAAAAT---AGACCAAAATAT---TACGGAAGAGAGTTTCATGGCATGATT
Tarsius_syrichta|9123              ------GTGGACAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCATGGCATGATC
Pteropus_vampyrus|10445            ------GTAGAGAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCACGGCATGATC
Felis_catus|45196                  ------GTTGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCATGGCATGATC
Spermophilus_tridecemlineatus|4303 CAAGAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCACGGCATGATC
Procavia_capensis|2688             GTCAAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGANNNNNNNNNNNNNNNN
Dasypus_novemcinctus|1164          ------GTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTCCACGGCATGATC
Otolemur_garnettii|929             TGTGAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCACGGCATGATC
Oryzias_latipes|10889              TCCGAGGTGGAGAAC---CGTCCTAAATAC---TACGGCAGAGAGTTCCACGGGATGATC
Gasterosteus_aculeatus|1240        TGTGAGGTGGACAAC---CGGCCCAAATAC---TATGGAAGAGAGTACCATGGGATGATC
Tetraodon_nigroviridis|12063       AGTGAGGTTGACAAC---CGACCTAAATAC---TACGGAAGAGAATACCACGGCATGATC
Fugu_rubripes|12054                AGTGAGGTTGACAAC---CGGCCTAAATAC---TATGGTAGAGAATACCATGGTATGATC
Microcebus_murinus|15358           ------GTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCACGGCATGATC
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            CGAGAGGTGTTTAAC---AGACCAAAGTAC---TACGGAAGAGAATTTTTTGGTATGATT
Cavia_porcellus|24636              TGTGAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCAAAGCATGATC
Rattus_norvegicus|16671            TGCAAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCATGGTATGATC
Myotis_lucifugus|15927             AATGAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTCCACGGCAGGATC
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                TGTGAGGTAGAGAAC---CGTCCCAAATAT---TATGGAAGAGAATTTCATGGCATGATC
Taeniopygia_guttata|13478          AGTGAGGTAGAGAAC---AGACCCAAATAT---TATGGAAGAGAATTCCATGGGATGATC
Dipodomys_ordii|1968               ---------------------------------------------TTTCACGGCATGATT
Mus_musculus|22308                 TGTGAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTATCATGGCATGATC
Rattus_norvegicus|22026            TGCGAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCATGGCATGATC
Ornithorhynchus_anatinus|23474     TGTGAGGTAGAAAAC---AGACCAAAATAT---TATGGAAGAGAATTTCATGGCATGATC
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        TGTGAGGTAGAAAAC---AGACCAAAATAT---TATGGAAGAGAGTTTCATGGTATGATC
Echinops_telfairi|12695            AGTGAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCATGGCATGATC
Cavia_porcellus|12568              TGTGAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCACGGCATGATA
Bos_taurus|11426                   AATGAGGTGGCAAAT---CATCCAAAatacaaatatgggatggaagttcatggaaaggtc
Vicugna_pacos|6873                 ------GTAGAAAAC---AGACCGAAGTAT---TATGGAAGAGAGTTTCACGGCATGATC
Pongo_abelii|18313                 TGCAAGGTGGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCATGGCATGATC
Gorilla_gorilla|11189              ------------------------------------------------------ATGATC
Homo_sapiens|48422                 TGCGAGGTGGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCATGGCATGATC
Callithrix_jacchus|22501           TGCGAGGTGGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCATGGCATGATC
Rhesus_macaque|9284                TGCGAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCATGGCATGATC
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------GTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCATGGCATGATC
Loxodonta_africana|14241           TGTGAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTCCATGGCATGATC
Sorex_araneus|10550                AATGAGGTAGAAAAC---AGACCAAAGTAT---TATGGAAGAGAGTTTCACGGCATGATC
Tursiops_truncatus|357             ------GTAGAAAAT---AGACCAAAGTAT---TACGGAAGAGAGTTTCATGGCATGATC
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        GATAGAAATGAGGCCGAAAAAATGCTG---CTGGAGGCC---------GGAGAAGGCTCG
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ACGCACATCCAGGCCCAGAATCTCCTCAGCCCCCAT------------GAAAATGGGGCT
Bombyx_mori|1440                   GGACATAAGGAAGCCACACTGTTGTTAGAAAATGAA------------CCGAACGGTGCC
Culex_quinquefasciatus|8347        AATCATAAAAAGAGTGAAAGCATCTTG---GAGGATAAG---------CGGGATGGATCG
Drosophila_willistoni|6759         GGCCATGCCGAAGCCGAACAATTGTTACTGGGAGGAGGAGATCATACCCAGGAGAGTAAC
Drosophila_persimilis|9372         GGCCACCTGGAGGCGGAGCATCTGCTCGGTCTCACTGGC---------GGCGAAGGCAGC
Drosophila_melanogaster|20217      GGCCACCTGGAGGCGGAGCAGCTGCTG---GCCAATGCC---------CGCGACGGCAGC
Drosophila_simulans|12658          GGCCACCTGGAGGCGGAGCAGCTGCTGGCCAATGCC------------CGCGACGGCAGC
Pediculus_humanus|1518             TCTAATGCAGAAGCAGTAAAAATGTTAACA------------------AAAGAGGGTCAA
Nematostella_vectensis|14687       TCACGAGAAGAGGCAGATGAGCTGGTG------AGTCGT---------CAAGACGGCTGT
Callithrix_jacchus|17478           ---------------------------------ATGGGA---------------------
Otolemur_garnettii|5617            NNNNNNNNNNNNNNNNNNNNNNNNNNN---------------------NNNNNNNNNNNN
Tarsius_syrichta|890               TCCCGGGAGCAGGCGGATGAGCTGCTC------GGTGGC---------GTGGAGGGCGCC
Macropus_eugenii|10045             TCTCGCGAGCAAGCTGATGAGCTTCTA------GGGGGT---------GTAGAGGGAGCC
Gasterosteus_aculeatus|27934       TCTCGGCAATATGCCGATGAGCTTCTG------GCGGGA---------GCAGAGGGTGCT
Oryzias_latipes|7013               CCTCGAGAGTATGCAGATCAGCTGCTG------GCAGGG---------GTGGAGGGTGCT
Fugu_rubripes|14746                TCTCGGGAATATGCCGACGAGCTGCTG------GCCACT---------GCAGAAGGTGCT
Tetraodon_nigroviridis|16104       TCGCGGGAATACGCAGACGAGCTGCTG------GCCGGG---------GCAGAAGGTGCT
Spermophilus_tridecemlineatus|2344 NNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---------NNNNNNNNNNNN
Danio_rerio|9306                   TCCAGAGAGCAAGCAGATGAACTTCTG------GCGGGG---------ACAGAAGGTGCT
Choloepus_hoffmanni|11191          TCCAGGGAGCAGGCAAATGAACTTCTC------GGAGGT---------GTAGATGGGGCA
Felis_catus|38196                  TCCCGGGAGCAGGCGGACGAGCTTCTC------GGAGGT---------GTGGAGGGTGCC
Dipodomys_ordii|13518              TCCCGGGAGCAGGCTGATGAGCTTCTG------GGAGGT---------GTGGAGGGTGCC
Echinops_telfairi|2788             TCTCGGGAGCAGGCCGACGAGCTTCTC------CGAGGG---------GTGGAGGGCGCC
Xenopus_tropicalis|20641           GCA---------------------------------------------------------
Erinaceus_europaeus|7699           TCACGGGAGCAGGCAGATGAGCTCCTG------GGAGGT---------GTGGAAGGTGCC
Vicugna_pacos|12004                TCCCGAGAGCAGGCAGATGAGCTTCTC------GGAGGC---------GTGGAGGGCGCC
Dasypus_novemcinctus|12376         TCCCGGGAGCAGGCGGACGAGCTGCTC------GGGGGC---------GTGGAGGGGGCG
Myotis_lucifugus|13996             TCTCGGGAGCAGGCTGACGAGCTTCTC------GGAGGC---------GTGGAAGGCGCG
Ochotona_princeps|1540             TCCCGGGAGCAGGCTGACGAGCTCCTC------GGGGGC------------GTGAGCGCC
Anolis_carolinensis|11713          TCTCGCGAACAAGCTGATGAATTACTT------GGTGGT---------GTAGAAGGAGCC
Gallus_gallus|8478                 TCTCGGGAGCAAGCAGATGAGATACTT------GCTGGC---------GTGGAAGGAGCA
Monodelphis_domestica|32218        TCTCGAGAGCAAGCGGACCAGCTCCTT------GGGGGT---------GCCGAGGGGGCG
Ornithorhynchus_anatinus|18048     TCACGGGAGCAAGCTGATAACCTGCTT------GCAGGT---------GTGGAAGGAGCT
Tursiops_truncatus|17458           NNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---------NNNNNNNNNNNN
Bos_taurus|20383                   TCCCGAGAGAAGGCAGATGAGCTTCTT------GGAGGC---------GTAGAGGGTGCC
Loxodonta_africana|20466           TCTCGGGAGAAGGCTGACGAGCTTCTA------GGAGGT---------GTGGAGGGTGCC
Procavia_capensis|1128             NNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---------NNNNNNNNNNNN
Sorex_araneus|13650                TCTCGGGAGCAGGCGGATGAGCTTCTG------GGAGGT---------GTGGAGGGTGCC
Microcebus_murinus|8758            NNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---------NNNNNNNNNNNN
Sus_scrofa|9306                    TCCCGAGAGCAGGCAGATGAACTTCTT------GGAGGC---------GTGGAGGGTGCC
Tupaia_belangeri|17337             TCCCGGGAGCAGGCGGATGAGCTTCTC------GGAGGT---------GTGGAGGGCGCC
Mus_musculus|35474                 TCTCGGGAGCAGGCTGATGAGCTTCTA------GGCGGC---------GTGGAAGGTGCC
Rattus_norvegicus|25044            TCCCGGGAGCAGGCTGATGAGCTTCTA------GGCGGA---------GTAGAGGGTGCC
Cavia_porcellus|16884              TCGCGGGAGCAGGCGGATGAGCTCCTG------GGAGGC---------GTGGAGGGCGCC
Callithrix_jacchus|16234           TCCCGGGAGCAGGCGGACGAGCTTCTC------GGAGGT---------GTGGAGGGTGCC
Gorilla_gorilla|27910              TCTCGGGAGCAGGCGGATGAGCTTCTT------GGAGGC---------GTGGAGGGTGCC
Pongo_abelii|25321                 TCCCGGGAGCAGGCGGATGAGCTTCTT------GGAGGC---------GTGGAGGGTGCC
Pan_troglodytes|33528              TCTCGGGAGCAGGCGGATGAGCTTCTT------GGAGGC---------GTGGAGGGTGCC
Rhesus_macaque|26807               TCTCGGGAGCAGGCGGATGAGCTGCTC------GGAGGT---------GTGGAGGGTGCC
Canis_familiaris|5395              TCCCGGGAACAGGCAGACGAGCTTCTC------GGAGGC---------GTGGAGGGCGCC
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               TCCCGGGAGCAGGCAGATGAGCTTCTT------GGAGGC---------GTGGAGGGTGCC
Sus_scrofa|7275                    TCCCGAGAAGCAGCAGACCAGCTCTTG------AGTGTA---------GCTGAGGGGAGC
Macropus_eugenii|8027              NNNNNNNNNNNNNNNNNNNNNNNNNNN---------------------NNNNNNNNNNNN
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            TCCAGAGAAGCAGCTGACCAGCTCTTG------AGCGTG---------GCTGAGGGGAGC
Tupaia_belangeri|12767             TCCAGAGAAACAGCCGACCAGCTCTTG------AGTGTG---------GCTGAGGGGAGC
Erinaceus_europaeus|11556          TCCCGAGAAGCAGCGGACCAGCTGTTG------AGTGTA---------GCTGAGGGGAGC
Tarsius_syrichta|9123              TCCAGAGAAGCAGCCGACCAGCTCTTG------AGTGTG---------GCTGAGGGGAGC
Pteropus_vampyrus|10445            TCCCGAGAAGCAACAGACCAGCTCTTG------AGTGTG---------GCTGAGGGGAGC
Felis_catus|45196                  TCCCGAGAAGAAGCAGACCAGCTCTTG------AGTGTG---------GCTGAGGGGAGT
Spermophilus_tridecemlineatus|4303 TCCAGAGAAGCAGCTGACCAGCTCTTG------AGTGTG---------GCTGAGGGGAGC
Procavia_capensis|2688             NNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---------NNNNNNNNNNNN
Dasypus_novemcinctus|1164          TCCAGAGAAGCAGCAGACCAGCTCTTG------AGTGTG---------GCTGAGGGGAGC
Otolemur_garnettii|929             TCCAGAGAAGCTGCAGACCAGCTCTTG------AGTGTG---------CTGAAGGGGAGC
Oryzias_latipes|10889              TCCAGGGAGGAAACGGACCAGCTCCTG------AGTCAG---------GCCGAAGGCAGC
Gasterosteus_aculeatus|1240        TCCAGAGAAGATGCCGACCAGTGGCTG------AGTCAG---------GCCGAAGGCAGC
Tetraodon_nigroviridis|12063       TCAAGAGAAGAGGCCGACCAGTTGCTG------AGTCAG---------GCTGAAGGCAGC
Fugu_rubripes|12054                TCAAGAGAAGAGGCTGACCAGTTGCTG------AGTCAA---------GCTGAAGGCAGC
Microcebus_murinus|15358           TCCAGAGAAGCCACCGACCAGCTCTTG------AGTGTG---------GCTGAGGGGAGC
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            TCAAGAGAGGAAACAGACCAATTGTTA------AGCGGA---------GCAGAAGGAAGT
Cavia_porcellus|24636              TCTGGAGAAGTAGCTGACCAGCTCTTG------AGTGTG---------GCTGAGGGGAGT
Rattus_norvegicus|16671            TCTAGAGAAGAAACTGACCAGCTCCTG------AGTGTG---------GCTGAGGGGAGC
Myotis_lucifugus|15927             TCCCGGGAAGCGGCCGACCAGCTCCTG------AGTGTG---------GCTGAGGGGAGC
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                TCAAGGGAAGAAGCTGACCAGTTATTA------AGTGTT---------GCAGAGGGAAGC
Taeniopygia_guttata|13478          TCAAGAGAGGAAGCTGACCAATTATTA------AGTGTT---------GCAGAGGGAAGT
Dipodomys_ordii|1968               TCCAGAGAAGCATCTGACCAGCTCTTG------AGTGTA---------GCCGAGGGGAGC
Mus_musculus|22308                 TCTAGAGAAGAGACTGACCAGCTCCTG------AGTGTG---------GCTGAGGGGAGC
Rattus_norvegicus|22026            TCTAGAGAAGAGACTGACCAGCTCCTG------AGTGTG---------GCTGAGGGGAGC
Ornithorhynchus_anatinus|23474     TCCAGAGAAACAGCTGACCAGCTTTTG------AGTGTG---------GCAGAAGGAAGC
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        TCCAGAGAGGCAGCAGACCAGCTCCTG------AGCATG---------GCTGAGGGAAGT
Echinops_telfairi|12695            TCCCGAGAAGCAGCCGACCAGCTCTTG------AGCGTG---------GCCGAAGGGAGC
Cavia_porcellus|12568              TCTCGAGAAGCAGCTGACCAGCTCTTG------AGTGTG---------GCTGAGGGAAGT
Bos_taurus|11426                   ttagaagaaatgtcccatagcttctta------agtgtt---------tatgaaaggtct
Vicugna_pacos|6873                 TCCCGAGAAGCTGCAGACCAGCTCCTG------AGTGTA---------GCTGAGGGGAGC
Pongo_abelii|18313                 TCCAGAGAAGCAGCCGACCAGCTCTTG------ATTGTG---------GCTGAGGGGAGC
Gorilla_gorilla|11189              TCCAGAGAAGCAGCCGACCAGCTCTTG------ATTGTG---------GCTGAGGGGAGC
Homo_sapiens|48422                 TCCAGAGAAGCAGCCGACCAGCTCTTG------ATTGTG---------GCTGAGGGGAGC
Callithrix_jacchus|22501           TCCAGAGAAGCAGCCGACCAGCTCTTG------CTTGTG---------GCTGAGGGGAGC
Rhesus_macaque|9284                TCCAGAGAAGCAGCCGACCAGCTCTTG------ATTGTG---------GCTGAGGGGAGC
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           TCCAGAGAAGCAGCAGACCAGCTCTTG------AGTGTG---------GCTGAAGGGAGC
Loxodonta_africana|14241           TCCAGAGAAGCAGCAGACCAGCTCTTG------AGTGTG---------GCTGAGGGGAGC
Sorex_araneus|10550                TCCCGAGAAGCAGCTGACCAGCTCTTG------AGCTTG---------GCTGAAGGCAGC
Tursiops_truncatus|357             TCCCGAGAAGCAGCAGACCAGCTCTTG------AGTGTA---------GCTGAGGGGAGC
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        TATTTGGTGCGGGAGTCGAATCGGAGCAGAGAC---GCGTGCACTTTGTGTATG---ATT
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           TATTTGGTGCGCAGCAGTCGCTCGGCCAACGGCCAGTTTCACACCTTGAGTCTC---AAA
Bombyx_mori|1440                   TTCTTGATTAGAAAAGGGAATCCCTACAACGAC---TTTTACACACTGACTTGG---AGA
Culex_quinquefasciatus|8347        TATCTCGTTCGACGAAGTCCGGGTGCCAATAGC---TATTACACACTGAGTCTG---CGG
Drosophila_willistoni|6759         TATTTAATACGTCGCAGTCCCACAGCGGATGGC---TACTTCACCCTGAGTCTT---CTT
Drosophila_persimilis|9372         TATCTGGTGCGACGCAGCCCCATGTCCGACGGC---TTCTACACGCTGAGCCTG---CGC
Drosophila_melanogaster|20217      TACTTTGTACGCCGGAGCCCCCAATCCGATGGC---TACTACACGCTTAGCCTG---CGC
Drosophila_simulans|12658          TACTTTGTCCGCCGGAGCCCCCAATCCGATGGC---TACTACACGCTGAGCCTG---CGC
Pediculus_humanus|1518             TATTTAGTTAGAAAAAGTTCTAGCAGTTGTGATAAATTTTTCACACTGTCATTG---AGG
Nematostella_vectensis|14687       TACCTTGTCCGGGAAAGCCAACGTTCGCCATGG---GCATATACTTTGACAATG---AGA
Callithrix_jacchus|17478           ------------------------GAGCCAGCA---------------------------
Otolemur_garnettii|5617            NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
Tarsius_syrichta|890               TATATCCTTAGAGAAAGCCAGAGGCAACCAGGA---TGCTACACGCTGGCGCTC---AGG
Macropus_eugenii|10045             TATATTCTCAGAGAAAGTCAGCGCCAGCCCGGC---TGCTACACGTTGGCACTA---AGG
Gasterosteus_aculeatus|27934       TACCTCATCAGGGAAAGCCAAAGACAGCCAGGG---ACTCACACCTTGGCCTTA---AGC
Oryzias_latipes|7013               TATCTCATCAGGGAGAGTCAAAGACAGCCAGGG---ACACACACCTTGGCCTTA---AGG
Fugu_rubripes|14746                TACCTCATCAGGGAAAGCCAAAGGCAGCCAGGG---ACACACACCTTGGCCTTA---AGG
Tetraodon_nigroviridis|16104       TACCTTATCAGGGAAAGCCAGCGGCAGCCAGGG---ACCCACACCTTGGCCCTA---AGG
Spermophilus_tridecemlineatus|2344 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNN---NNG
Danio_rerio|9306                   TATCTCATCAGAGAGAGTCAGAGACAGCCAGGA---ACATACACACTTGCTTTG---AGA
Choloepus_hoffmanni|11191          TACATCCTTAGAGAAAGCCAGCGACAGCCAGGA---TGCTACACGTTAGCTCTA---AGG
Felis_catus|38196                  TACATTCTTAGAGAAAGCCAACGCCAGCCAGGA---TGCTACACGTTAGCTCTA---AGN
Dipodomys_ordii|13518              TACATCCTTCGGGAAAGCCAACGCCAGCCAGGA---TGTTACACGCTAGCGCTA---AGG
Echinops_telfairi|2788             TACATCCTCAGGGAAAGCCAGCGCCAGCCGGGA---TGCTACACCTTAGCTCTC---CGG
Xenopus_tropicalis|20641           ---------------------------------------CTTGCCCTAGGGATG---AAG
Erinaceus_europaeus|7699           TACATTCTCAGAGAAAGTCAGCGTCAGCCAGGA---TGCTACACGTTAGCTCTA---AGG
Vicugna_pacos|12004                TACATCCTTAGAGAAAGCCAGCGCCAGCCAGGG---TGCTACACGTTAGCCCTA---AGG
Dasypus_novemcinctus|12376         TACATTCTGAGGGAGAGCCAGCGGCAGCCAGGA---TGCTACACGTTAGCGCTA---AGG
Myotis_lucifugus|13996             TACATTCTCAGAGAGAGCCAGCGCCAGCCAGGA---TGCTACACGTTAGCTCTG---CGG
Ochotona_princeps|1540             TACATCCTCCGTGAGAGCCAGCGGCAGCCGGGA---TGCTACACGCNNNNNNNN---NNG
Anolis_carolinensis|11713          TATATTCTCAGAGAGAGCCAGCGGCAACCTGGA---TGCTATACTCTAGCTCTT---AGA
Gallus_gallus|8478                 TACATTCTAAGAGAAAGCCAGAGGCAACCCGGC---TGCTACACACTTGCTCTC---AGA
Monodelphis_domestica|32218        TATATTCTCAGAGAAAGTCAGCGACAGCCCGGT---TGCTACACGTTAGCACTA---AGG
Ornithorhynchus_anatinus|18048     TATATTCTCAGAGAAAGCCAGCGGCAGCCAGGC---TGCTACACCTTAGCTCTA---AGA
Tursiops_truncatus|17458           NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNN---NNG
Bos_taurus|20383                   TACATTCTTCGAGAAAGCCAGCGCCAGCCAGGA---TGCTACACGTTAGCACTA---AGG
Loxodonta_africana|20466           TACATTCTTAGAGAAAGCCAGCGGCAGCCGGGA---TGCTACACCTTAGCTCTA---AGG
Procavia_capensis|1128             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNN---NNG
Sorex_araneus|13650                TACATCCTTAGAGAAAGCCAGCGCCAGCCAGGA---TGCTACACATTAGCTCTG---AGG
Microcebus_murinus|8758            NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNN---NNG
Sus_scrofa|9306                    TACATTCTTAGAGAAAGCCAGCGCCAGCCAGGA---TGCTACACGTTAGCGCTA---AGG
Tupaia_belangeri|17337             TACATCCTTCGAGAGAGCCAGCGACAGCCAGGG---TGCTACACGTTAGCTCTC---AGA
Mus_musculus|35474                 TACATCCTTCGAGAAAGCCAGCGGCAGCCAGGA---TGCTACACGCTGGCACTG---AGG
Rattus_norvegicus|25044            TACATCCTTCGAGAGAGCCAACGGCAGCCGGGA---TGCTACACGCTGGCACTG---AGG
Cavia_porcellus|16884              TATATCCTTCGAGAAAGCCAGCGGCAGCCAGGA---TGCTACACATTAGCTCTG---AGG
Callithrix_jacchus|16234           TACATCCTTAGAGAAAGCCAGCGGCAACCAGGA---TGCTACACGCTGGCTCTC---AGG
Gorilla_gorilla|27910              TACATCCTTAGAGAAAGCCAGCGGCAACCAGGA---TGCTACACGCTGGCTCTC---AGG
Pongo_abelii|25321                 TACATCCTTAGAGAAAGCCAGCGGCAACCAGGA---TGCTACACGCTGGCTCTG---AGG
Pan_troglodytes|33528              TACATCCTTAGAGAAAGCCAGCGGCAACCAGGA---TGCTACACGCTGGCTCTC---AGG
Rhesus_macaque|26807               TACATCCTTAGAGAAAGCCAGCGGCAACCAGGA---TGCTACACGCTGGCTCTC---AGG
Canis_familiaris|5395              TACATTCTTAGAGAAAGTCAGCGCCAGCCAGGA---TGCTACACATTAGCTCTC---AGA
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               TACATCCTTAGAGAAAGCCAGCGCCAGCCAGGA---TGCTACACGTTAGCTCTG---AGG
Sus_scrofa|7275                    TACCTCATTCGGGAGAGCCAGCGTCAGCCGGGA---ACCTACACTTTGGCTTTAAGTAGG
Macropus_eugenii|8027              NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNA
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            TACCTCATCCGAGAGAGCCAACGGCAGCCAGGA---ACCTACACTTTGGCTTTA---AGA
Tupaia_belangeri|12767             TACCTCATTCGGGAGAGCCAACGCCAGCCAGGA---ACCTACACTTTGGCTTTA---AGA
Erinaceus_europaeus|11556          TACCTCATTCGGGAAAGCCAGCGTCAGCCAGGG---ACCTACACTTTGGCTTTA---AGN
Tarsius_syrichta|9123              TACCTCATCCGAGAGAGCCAGCGACAGCCAGGG---ACCTACACTTTGGCTTTA---AGA
Pteropus_vampyrus|10445            TACCTCATTCGGGAGAGCCAGCGACAGCCAGGA---ACCTACACTCTGGCTTTA---AGA
Felis_catus|45196                  TACCTCATTCGCGAGAGCCAGCGTCAGCCAGGA---ACCTACACTTTGGCTTTA---AGN
Spermophilus_tridecemlineatus|4303 TACCTTATTCGGGAGAGTCAGCGGCAACCAGGA---ACCTACACGTTGGCTTTA---AGA
Procavia_capensis|2688             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---NNNNNNNNNNNNNNNNNN---NNN
Dasypus_novemcinctus|1164          TACCTCATTCGGGAGAGCCAGCGTCAGCCAGGA---ACCTACACTTTGGCATTG---AGN
Otolemur_garnettii|929             TACCTCATCCGG---AGCCAGCGTCAGCCTGGG---ACGTACACTTTGGCTTTA---AGN
Oryzias_latipes|10889              TACCTCATCCGAGAGAGCCAGAGGCAGCCGGGC---ACCTACACCCTGGCCCTG---AGG
Gasterosteus_aculeatus|1240        TACCTCATCAGAGAGAGTCAGAGACAGCCGGGC---ACCTACACGCTGGCTCTA---AGG
Tetraodon_nigroviridis|12063       TACCTTATCAGAGAGAGTCAGAGGCAGCCGGGC---ACATACACACTGGCTCTG---AGG
Fugu_rubripes|12054                TACCTCATCAGAGAGAGTCAGAGGCAGCCGGGT---ACATACACACTAGCTCTA---AGA
Microcebus_murinus|15358           TACCTCATCCGGGAGAGCCAGCGCCAGCCTGGG---ACCTACACTTTGGCTTTA---AGN
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            TACCTCATTCGTGAGAGTCAGAGGCAGCCTGGA---ACATACACTTTGGCACTC---AGA
Cavia_porcellus|24636              TACCTCATTGGGGAGAGATGGAGGCAGCCAGGA---ACCTACACTTTGGCTTTA---AGA
Rattus_norvegicus|16671            TACCTCATCCGTGAGAGCCAGCAGCAGCCTGGA---ATGTACANCAAAAGGTTG------
Myotis_lucifugus|15927             TACCTCATTCGGGAGAGCCAGCGCCAGCCAGGA---ACCTACACTTTGGCTTTA---AGG
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                TATCTCATTCGTGAAAGCCAAAGGCAGCCTGGA---ACCTACACTTTGGCATTA---AGA
Taeniopygia_guttata|13478          TATCTCATTCGTGAAAGCCAAAGGCAACCTGGA---ACCTACACTTTGGCATTA---AGA
Dipodomys_ordii|1968               TACCTTATTCGGGAGAGTCAGCGGCAGCCTGGA---ACCTATACTTTGGCTTTAAGNNNN
Mus_musculus|22308                 TACCTCATCCGTGAGAGCCAGCGGCAGCCAGGA---ACGTACACTTTGGCTTTA---AGA
Rattus_norvegicus|22026            TACCTCATCCGTGAGAGCCAGCGGCAGCCCGGA---ACATACACTTTGGCTTTA---AGA
Ornithorhynchus_anatinus|23474     TATCTGATTCGTGAGAGCCAGCGGCAGCCAGGA---ACCTACACTCTGGCACTA---AGA
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        TATCTTATTCGTGAGAGTCAGCGTCAGCTAGGA---ACCTACACATTGGCATTA---AGA
Echinops_telfairi|12695            TACCTCATCCGGGAGAGCCAGCGCCAGCCCGGA---ACCTACACGTTGGCTTTA---AGA
Cavia_porcellus|12568              TACCTCATTCGGGAGAGTCAGAGGCAGCCAGGA---ACCTACACTTTGGCTTTA---AGA
Bos_taurus|11426                   ttcatggctcgagaggagaatcagcagccatca---acattagacctgttatGC---AGA
Vicugna_pacos|6873                 TACCTCATTCGGGAGAGCCAGCGTCAGCCAGGA---ACCTACACTTTGGCTTTA---AGA
Pongo_abelii|18313                 TACCTCATCCGGGAGAGCCAGCGGCAGCCAGGG---ACCTACACTTTGGCTTTA---AGA
Gorilla_gorilla|11189              TACCTCATCCGGGAGAGCCAGCGGCAGCCAGGG---ACCTACACTTTGGCTTTA---AGA
Homo_sapiens|48422                 TACCTCATCCGGGAGAGCCAGCGGCAGCCAGGG---ACCTACACTTTGGCTTTA---AGA
Callithrix_jacchus|22501           TACCTCATCCGGGAGAGCCAGCGGCAGCCAGGG---ACCTACACTTTGGCTTTA---AGA
Rhesus_macaque|9284                TACCTCATCCGGGAGAGCCAGCGGCAGCCAGGG---ACCTACACTTTGGCTTTA---AGA
Canis_familiaris|20431             ---------------------------------------------------------AGA
Choloepus_hoffmanni|3438           TACCTCATTCGGGAGAGCCAGCGTCAGCCGGGA---ACCTACACTTTGGCATTA---AGA
Loxodonta_africana|14241           TACCTCATTCGGGAGAGCCAGCGTCAGCCAGGA---ACCTATACTTTGGCTTTA---AGA
Sorex_araneus|10550                TACCTCATTCGGGAGAGCCAGCGTCAGCCAGGG---ACCTACACTTTGGCCTTA---AGA
Tursiops_truncatus|357             TACCTCATTCGGGAGAGCCAGCGTCAGCCAGGA---ACCTACACTTTGGCTTTA---AGA
                                                                                               

Ixodes_scapularis|17566            ---------------------------------------------------ATGCACTAC
Caenorhabditis_elegans|9662        TTTGATGCAAAGGTTATGAATTATAAACTCTACTAC------GAC---GGTCAATTCTAC
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           TTTAACGATAAAATTCATCATTACAAACTTTTCTATGACCCAAAT---TCGGGGCTTTAT
Bombyx_mori|1440                   TTCAATGACAAAGTTCATCATTATAAACTTTACTAT------GAT---GGAACACATTAC
Culex_quinquefasciatus|8347        TTCGATCAGAAGACAAAACACTACAAAATTTACTATTCTCCAGAC---AAAGGACATTAT
Drosophila_willistoni|6759         TACAATGGCAAAGTCAAGCATTTTAAATTGTACCACAAGCCGGGC---TGTGGTCACTAT
Drosophila_persimilis|9372         TTCAACAAGCGCACAAGGCACTACAAGCTGTTCCACAAGCCCGGC---GTGGGCCACTAC
Drosophila_melanogaster|20217      TTCAACAAGCGACCCAAGCACTACAAGCTCCTCTATAAGCCCGGC---GTGGGACACTAT
Drosophila_simulans|12658          TTCAACAAGCGACCCAAGCACTACAAGCTGCTCTATAAGCCCGGC---GTGGGACACTAT
Pediculus_humanus|1518             TTTAATAATAAAGTTCACAATTACAAATTGTTTTAC------GAGAAAGGTAATTTTTTC
Nematostella_vectensis|14687       TTCGATGGG---ACAAAAAACTTTAGGCTGTATTAT------GAT---GGAATGCATTAC
Callithrix_jacchus|17478           ------------------------------------------ACAGCCGGGGCCCTGCAC
Otolemur_garnettii|5617            TTTGGAAACCAGACCTTAAACTATAGACTCTTCCAT------GAT---GGAAAACATTTT
Tarsius_syrichta|890               TTTGGAAACCAGACCCTAAACTACAGGCTCTTTCAT------GAT---GGAAAACACTTT
Macropus_eugenii|10045             TTTGGAAACCAGACCCTTAACTACCGACTTTTCTAC------GAT---GGGAAACACTTT
Gasterosteus_aculeatus|27934       TTTGGCCACCAGACCCTCAACTACAGATTGTTTTAC------GAT---GGGAAGCACTTT
Oryzias_latipes|7013               TTTGGAGATCAGACACTCAACTACAGGTTGTTTTAT------GAT---GGGAAACACTTT
Fugu_rubripes|14746                TTTGGTCACCAGACCCTCAACTACAGGTTGTTCTAC------GAT---GGGAAGCACTTC
Tetraodon_nigroviridis|16104       TTTGGCCATCAGACCCTCAACTACAGGTTGTTCTAC------GAT---GGGAAGCACTTT
Spermophilus_tridecemlineatus|2344 TTTGGAAACCAGACCTTAAACTACCGGCTCTTCCAC------GAT---GGGAAGCACTTT
Danio_rerio|9306                   TTTGGAGGCCAAACTCTCAACTACCGACTCTTCTAT------GAT---GGAAAGCACTTT
Choloepus_hoffmanni|11191          TTTGGAAACCAGACCTTAAATTACAGGCTCTTCTAC------GAT---GGGAAACATTTT
Felis_catus|38196                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNN---NNNNNNNACTTC
Dipodomys_ordii|13518              TTTGGAAACCAGACCTTAAACTACCGGCTCTTCCAC------GAT---GGGAAGCATTTC
Echinops_telfairi|2788             TTTGGAAATCAGACCTTGAACTACAGGCTCTTCTAC------GAT---GGGAAACATTTT
Xenopus_tropicalis|20641           GTTGGGGCTAGGAGC---------------------------------------------
Erinaceus_europaeus|7699           TTTGGAAATCAGACTTTAAACTACAGGCTCTTCTAC------GAT---GGCAAACACTTT
Vicugna_pacos|12004                TTCGGAAACCAGACCTTAAACTACAGGCTCTTCTAT------GAT---GGAAAACACTTT
Dasypus_novemcinctus|12376         TTTGGAAACCAGACCTTAAACTACAGGCTCTTCTAC------GAT---GGGAAACATTTC
Myotis_lucifugus|13996             TTTGGAAACCAGACCTTAAACTACAGGCTCTTCTAC------GAT---GGAAAACACTTC
Ochotona_princeps|1540             TTTGGAAACCAGACCTTGAACTACCGGCTCTTCCAT------GAT---GGCAAGCACTTC
Anolis_carolinensis|11713          TTTGGTAACCAGACCTTAAACTACAGGCTTTTTTAC------GAT---GGGAAGCACTTT
Gallus_gallus|8478                 TTTGGCAATCAGACCTTAAACTACAGGTTGTTCTAT------GAT---GGGAAGCACTTC
Monodelphis_domestica|32218        TTCGGGAACCAGACCCTTAACTACCGGCTTTTCTAT------GAT---GGGAAACACTTT
Ornithorhynchus_anatinus|18048     TTTGGAAATCAGACTTTAAATTATAGGCTCTTCTAC------GAT---GGGAAACATTTT
Tursiops_truncatus|17458           TTTGGAAACCAGACCTTGAACTACAGGCTCTTCTAT------GAT---GGAAAACACTTT
Bos_taurus|20383                   TTTGGAAATCAGACCTTAAACTACAGGCTCTTCTAT------GAT---GGAAAACACTTT
Loxodonta_africana|20466           TTCGGGAACCAGACATTAAACTACAGGCTCTTCTAT------GAT---GGGAAACACTTT
Procavia_capensis|1128             TTCGGGAACCAGACCCTAAACTACACGCTCTTCTAT------GAT---GGGAAACACTTT
Sorex_araneus|13650                TTTGGAAACCAGACATTAAACTACAGACTCTTCTAT------GAT---GGCAAACACTTT
Microcebus_murinus|8758            TTTGGAAACCAGACCTTAAACTACAGGCTCTTCCAC------GAT---GGAAAACACTTT
Sus_scrofa|9306                    TTTGGAAACCAGACCTTAAACTACAGGCTCTTCTAT------GAT---GGAAAACACTTT
Tupaia_belangeri|17337             TTTGGAAACCAGACCTTAAACTACAGGCTCTTCCAT------GAC---GGGAAACATTTT
Mus_musculus|35474                 TTTGGGAACCAGACCTTAAACTACCGGCTCTTCCAC------GAC---GGGAAGCACTTT
Rattus_norvegicus|25044            TTTGGAAACCAGACCTTAAACTACCGGCTCTTCCAT------GAT---GGGAAGCATTTT
Cavia_porcellus|16884              TTTGGAAACCAGACCTTAAACTACCGGCTCTTCCAT------GAT---GGGAAACACTTT
Callithrix_jacchus|16234           TTTGGAAACCAGACCTTAAACTACAGGCTCTTCCAT------GAC---GGGAAACACTTC
Gorilla_gorilla|27910              TTTGGAAACCAGACCTTAAACTACAGGCTCTTCCAC------GAC---GGGAAACACTTT
Pongo_abelii|25321                 TTTGGAAACCAGACCTTAAACTACAGGCTCTTCCAT------GAC---GGGAAACACTTT
Pan_troglodytes|33528              TTTGGAAACCAGACCTTAAACTACAGGCTCTTCCAC------GAC---GGGAAACACTTT
Rhesus_macaque|26807               TTTGGAAACCAGACCTTAAACTACAGGCTCTTCCAC------GAC---GGGAAACACTTT
Canis_familiaris|5395              TTTGGAAACCAGACTTTAAACTACAGGCTCTTCTAT------GAT---GGAAAACACTTT
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               TTTGGAAACCAGACCTTAAACTACAGGCTCTTCTAC------GAT---GGAAAACACTTT
Sus_scrofa|7275                    CACAAAGAAAGAACAGAAAGGTTTATTTTGTTTTTT------AAC---TCAAGTCACTTC
Macropus_eugenii|8027              TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAACACTTT
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
Tupaia_belangeri|12767             TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
Erinaceus_europaeus|11556          NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNN---NNNNNNNNNNNN
Tarsius_syrichta|9123              TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
Pteropus_vampyrus|10445            TTTGGAAGTCAGACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
Felis_catus|45196                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNN---NNNNNNNNNNNN
Spermophilus_tridecemlineatus|4303 TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGCAAGCACTTT
Procavia_capensis|2688             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNN---NNNNNNNNNNNN
Dasypus_novemcinctus|1164          NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNN---NNNNNNNNNNNN
Otolemur_garnettii|929             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNN---NNNNNNNNNNNN
Oryzias_latipes|10889              TTTGGGAATCAAACCCGAAACTTCCGTCTGTACCAT------GAC---GGGAAGCATTTT
Gasterosteus_aculeatus|1240        TTCGGGAACCAGACGAGAAACTTCCGTCTCTACCAC------GAC---GGGAAGCACTTT
Tetraodon_nigroviridis|12063       TTTGGGAATCAGACGAGGAACTTTCGCCTCTATCAC------GAT---GGGAAGCATTTT
Fugu_rubripes|12054                TTTGGGAATCAGACGAGAAACTTTCGTCTCTATCAT------GAT---GGGAAGCACTTT
Microcebus_murinus|15358           NNNNNNNNNCAAACCAGA---TTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            TTTGGGAACCAGACCAGAAACTTTAGGCTCTACTAC------GAT---GGGAAACATTTT
Cavia_porcellus|24636              TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             TTTGGAAACCAGACCTTAAACTACAGGCTCTTCTAC------GAT---GGAAAACACTTC
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                TTTGGAAGTCAAACCAGAAACTTCAGACTCTACTAC------GAT---GGAAAGCACTTT
Taeniopygia_guttata|13478          TTTGGAAGTCAAACCAGAAACTTCAGACTCTACTAC------GAT---GGAAAACACTTT
Dipodomys_ordii|1968               NNNNNNNNNNNNNNNNNNNNNNNNNNNTCATACTAC------------GATAAGCACTTT
Mus_musculus|22308                 TTTGGAAGTCAGACCAGAAACTTCAGGCTGTACTAC------GAT---GGAAAGCACTTT
Rattus_norvegicus|22026            TTTGGAAGTCAGACCAGAAACTTCAGGCTGTACTAC------GAT---GGAAAGCACTTT
Ornithorhynchus_anatinus|23474     TTTGGAAATCAAACCAGAAACTTCAGGCTCTACCAC------GAT---GGCAAGCACTTT
Pan_troglodytes|24690              ------------------------------------------------GGAGAGCCAGCG
Monodelphis_domestica|19121        TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
Echinops_telfairi|12695            TTCGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
Cavia_porcellus|12568              TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
Bos_taurus|11426                   TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
Vicugna_pacos|6873                 TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
Pongo_abelii|18313                 TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGCAAGCACTTT
Gorilla_gorilla|11189              TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGCAAGCACTTT
Homo_sapiens|48422                 TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGCAAGCACTTT
Callithrix_jacchus|22501           TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGCAAGCACTTT
Rhesus_macaque|9284                TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGCAAGCACTTT
Canis_familiaris|20431             TTTGGAAGTCAAACCAGAAACTTCAGGCTGTACTAC------GAT---GGAAAGCACTTC
Choloepus_hoffmanni|3438           TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
Loxodonta_africana|14241           TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
Sorex_araneus|10550                TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAACACTTT
Tursiops_truncatus|357             TTTGGAAGTCAAACCAGAAACTTCAGGCTCTACTAC------GAT---GGAAAGCACTTT
                                                                                               

Ixodes_scapularis|17566            GTGGGG------GAGAAGCGCTTCCTGACGCTGCAGGACCTCGTGGCGGACGGCCTGATC
Caenorhabditis_elegans|9662        GTTGGG------GAGAAGCGTTTCGACACTATGGACCTTTTGGTGGCTGATGGGCTCATT
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           GTTAGG------GAAAAACGCTATGACTGTGTCAGGTCGTTAGTGGCTGATGGCTTAGTC
Bombyx_mori|1440                   ATAAAA------GATAAACGTTATGACACTATATATGACCTTGTTGCGGATGGACTCATT
Culex_quinquefasciatus|8347        CTCCAGGAAAATTTCAAAAAATTCGATACTGTCCAAGATCTGGTAGCTGATGGATTGGTT
Drosophila_willistoni|6759         CTAAGCGAGGAGGTCAAACGTTTCGATACCATCTATGACATGGTGGCCGATGGCCTCATC
Drosophila_persimilis|9372         CTGCGCGAGCAGGACAAGCGCTTCGACTCGGTCTACGACATGGTGGCCGACGGCCTTATC
Drosophila_melanogaster|20217      CTGCGCGGCCAGGACAAGCGCTTCGACACGGTGCACGACATGGTCGCCGACGGGCTGATC
Drosophila_simulans|12658          CTGCGCGGCCAGGACAAGCGCTTCGACACGGTGCACGACATGGTCGCCGACGGGCTGATC
Pediculus_humanus|1518             GTAAAA---AAGGAAAGACTTTTTCAAACTGTTTACGATTTGGTCGCTGATGGATTGGTT
Nematostella_vectensis|14687       GTTGGT------GATAAGAGGTTCCAGACCATCCACGAACTGGTAGCTGATGGTCTCATC
Callithrix_jacchus|17478           TTTGGC---------------TTTCAGAAA------------------------------
Otolemur_garnettii|5617            GTGGGA------GAGAAGAGGTTTGAGTCGATTCATGACCTGGTGACAGATGGCTTGATA
Tarsius_syrichta|890               GTGGGT------GAGAAGAGGTTTGAGTCGATTCACGATCTGGTGACAGATGGCTTGATA
Macropus_eugenii|10045             GTGGGA------GAGAAAAGGTTTGAATCCATCCACGACTTGGTGACAGATGGCTTGATC
Gasterosteus_aculeatus|27934       GTCGGA------GAGAAGAGGTTCGAGTCGGTCCACGACCTCGTGACAGACGCCCTCATC
Oryzias_latipes|7013               GTTGGA------GAGAAGAGGTTCGAGTCTGTTCATGACCTTGTAACTGATGCCCTCATC
Fugu_rubripes|14746                GTCGGG------GAGAAGAGGTTCGAGTCGGTCCACGACCTCGTCACGGACGCGCTCATC
Tetraodon_nigroviridis|16104       GTTGGG------GAGAAGAGGTTCGAGTCGGTCCACGACCTGGTGACGGATGCGCTCATC
Spermophilus_tridecemlineatus|2344 GTGGGT------GAGAAGAGGTTCGAGTCCATTCATGACCTGGTGACGGATGGCCTGATA
Danio_rerio|9306                   GTGGGA------GAAAAACGTTTTGAATCGGTTCATGATCTGGTTACGGATGGTCTCATC
Choloepus_hoffmanni|11191          GTGGGA------GAGAAGAGGTTTGAATCCATACACGACCTGGTAACAGATGGCTTGATA
Felis_catus|38196                  GTGGGC------GAGAAGAGATTTGAATCGATTCACGATCTGGTCACAGACGGCTTGATA
Dipodomys_ordii|13518              GTAGGC------GAGAAGAGGTTTGAATCCATTCATGATCTGGTGACAGATGGCTTGATA
Echinops_telfairi|2788             GTGGGC------GAGAAGAGGTTTGAGTCGATTCATGATCTCGTCACAGATGGCTTGATA
Xenopus_tropicalis|20641           ---------------------------------------------------------ACA
Erinaceus_europaeus|7699           GTGGGT------GAGAAGAGGTTTGAATCGATTCATGACCTGGTCACAGATGGCTTGATA
Vicugna_pacos|12004                GTGGGC------GAGAAGAGGTTTGAATCGATTCACGATCTGGTCACAGATGGCTTGATA
Dasypus_novemcinctus|12376         GTAGGA------GAGAAGAGGTTTGAATCCATCCACGACTTGGTAACAGATGGCTTGATA
Myotis_lucifugus|13996             GTGGGC------GAGAAGAGGTTCGAGTCCATCCACGACTTGGTCACAGATGGCCTGATA
Ochotona_princeps|1540             GTGGGG------GAGAAGAGGTTCGAGTCCATTCATGACCTGGTGACGGATGGTTTGATA
Anolis_carolinensis|11713          GTAGGG------GAGAAGAGGTTCGAATCAATCCATGATTTGGTTACAGACGGCTTGATA
Gallus_gallus|8478                 GTTGGG------GAGAAAAGATTCGAATCAATCCATGATCTAGTAACAGATGGCTTGATA
Monodelphis_domestica|32218        GTGGGA------GAGAAGAGGTTTGAATCCATCCACGACTTGGTGACAGATGGCCTGATC
Ornithorhynchus_anatinus|18048     GTCGGG------GAGAAGAGATTTGAATCGATCCATGATTTGGTAACAGATGGCTTGATA
Tursiops_truncatus|17458           GTGGGT------GAGAAGAGGTTTGAATCGATTCACGATCTGGTCACAGATGGCTTGATA
Bos_taurus|20383                   GTGGGC------GAGAAGAGGTTTGAATCAATTCATGATTTGGTCACAGATGGCTTGATA
Loxodonta_africana|20466           GTGGGA------GAGAAGAGGTTTGAATCCATTCATGACCTGGTAACAGATGGGTTGATA
Procavia_capensis|1128             GTGGGA------GAGAAC---TTCGAATCCATTCACGATCTGGTAACAGATGGCTTGATA
Sorex_araneus|13650                GTGGGT------GAGAAGAGGTTTGAATCAATCCACGATCTGGTCACAGATGGCTTGATA
Microcebus_murinus|8758            GTGGGA------GAGAAGAGGTTTGAGTCGATTCACGATCTGGTGACAGATGGCTTGATA
Sus_scrofa|9306                    GTGGGC------GAGAAGAGGTTTGAATCGATTCACGATCTGGTCACAGATGGCTTGATA
Tupaia_belangeri|17337             GTGGGC------GAGAAGAGGTTTGAATCCATTCATGATCTGGTGACAGATGGCCTGATC
Mus_musculus|35474                 GTGGGT------GAGAAGAGGTTCGAATCCATTCACGACCTGGTGACAGATGGCTTGATC
Rattus_norvegicus|25044            GTGGGT------GAGAAGAGGTTCGAATCCATTCACGACCTGGTGACAGATGGCTTGATC
Cavia_porcellus|16884              GTGGGC------GAAAAGAGATTTGAATCCATTCACGATCTGGTGACAGATGGCTTGATA
Callithrix_jacchus|16234           GTGGGT------GAGAAGAGGTTTGAGTCGATTCACGATCTAGTGACAGATGGCTTGATA
Gorilla_gorilla|27910              GTGGGT------GAGAAGAGGTTTGAGTCGATTCACGATCTGGTGACAGATGGCTTGATA
Pongo_abelii|25321                 GTGGGT------GAGAAGAGGTTTGAGTCGATTCACGATCTGGTGACAGATGGCTTGATA
Pan_troglodytes|33528              GTGGGT------GAGAAGAGGTTTGAGTCGATTCACGATCTGGTGACAGATGGCTTGATA
Rhesus_macaque|26807               GTGGGC------GAGAAGAGGTTTGAGTCGATTCACGATCTGGTGACAGATGGCTTGATA
Canis_familiaris|5395              GTGGGC------GAGAAGAGGTTTGAATCGATTCACGATCTGGTCACAGATGGCTTGATA
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               GTGGGA------GAGAAGAGGTTTGAATCGATTCATGATCTGGTCACAGATGGCTTGATA
Sus_scrofa|7275                    ---------------------CTGGACTCGTTCCATAACTGTCTAAGTTATGGTTTAGTG
Macropus_eugenii|8027              GTTGGG------GAGAAACGTTTTGAGTCCATCCACGATCTGGTGACTGATGGATTGATT
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Tupaia_belangeri|12767             GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Erinaceus_europaeus|11556          NNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Tarsius_syrichta|9123              GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Pteropus_vampyrus|10445            GTTGGG------GAGAAGCGCTTTGAGTCCATCCACGATCTGGTGACTGATGGATTGATT
Felis_catus|45196                  NNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Spermophilus_tridecemlineatus|4303 GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Procavia_capensis|2688             NNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Dasypus_novemcinctus|1164          NNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Otolemur_garnettii|929             NNNNNN------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Oryzias_latipes|10889              GTGGGC------GAGAAGAGGTTCGAGTCCATCCATGACCTGGTGACGGACGGCCTCATC
Gasterosteus_aculeatus|1240        GTTGGA------GAAAAGAGGTTCGAGTCCATCCACGACCTGGTCACCGACGGCCTCATC
Tetraodon_nigroviridis|12063       GTCGGA------GAGAAGAGGTTTGAGTCCATTCACGACCTGGTCACTGATGCTCTCATC
Fugu_rubripes|12054                GTTGGC------GAGAAGAGGTTCGAGTCTATTCATGACCTGGTCACAGATGCTCTCATC
Microcebus_murinus|15358           GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            GTCGGA------GAGAAAAGGTTTGAGTCCATCCACGACTTGGTGACGGATGGCTTGATT
Cavia_porcellus|24636              GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             GTGGGC------GAGAAGAGGTTCGAGTCCATCCACGACTTGGTCACAGATGGCCTGATA
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                GTTGGG------GAGAAACGTTTTGAGTCCATCCATGACCTGGTGACAGATGGATTGATT
Taeniopygia_guttata|13478          GTTGGG------GAGAAACGTTTTGAGTCCATCCATGACCTGGTGACAGATGGATTGATT
Dipodomys_ordii|1968               GTTGGG------GAGAAACGCTTTGAGTCTATCCATGATCTGGTGACTGATGGCTTGATT
Mus_musculus|22308                 GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Rattus_norvegicus|22026            GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Ornithorhynchus_anatinus|23474     GTTGGG------GAGAAACGGTTTGAGTCCATCCACGATCTGGTGACTGATGGATTGATT
Pan_troglodytes|24690              GCAGCC---------------------------AGGGACCTA------------------
Monodelphis_domestica|19121        GTTGGG------GAGAAACGTTTTGAGTCCATCCACGATCTGGTGACTGATGGATTGATT
Echinops_telfairi|12695            GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGATTGATT
Cavia_porcellus|12568              GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Bos_taurus|11426                   GTTGGG------GAGAAGCGCTTTGAGTCCATCCACGATCTGGTGACTGATGGATTGATT
Vicugna_pacos|6873                 GTTGGG------GAGAAGCGCTTTGAGTCCATCCACGATCTGGTGACTGATGGATTGATT
Pongo_abelii|18313                 GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Gorilla_gorilla|11189              GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Homo_sapiens|48422                 GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Callithrix_jacchus|22501           GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Rhesus_macaque|9284                GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGCTTGATT
Canis_familiaris|20431             GTTGGG------GAGAAGCGCTTTGAGTCCATCCACGATCTGGTGACTGATGGATTGATT
Choloepus_hoffmanni|3438           GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGATTGATT
Loxodonta_africana|14241           GTTGGG------GAGAAACGCTTTGAGTCCATCCACGATCTGGTGACTGATGGATTGATT
Sorex_araneus|10550                GTTGGG------GAGAAGCGCTTTGAGTCCATCCACGATCTGGTGACTGATGGATTGATT
Tursiops_truncatus|357             GTTGGG------GAGAAGCGCTTTGAGTCCATCCACGATCTGGTGACTGATGGATTGATT
                                                                                               

Ixodes_scapularis|17566            ACGATGTACCTGGAGACTTACGCTGGGGAGTACATCAACTCGATGTGCGCCCAGTCGCGC
Caenorhabditis_elegans|9662        TCAATGTTTGTGGACCTTCACGCGGCGGATTATATAAAAAGAATGGCGGATGAGGCGATT
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ACAATGTATCTCGAACTTAAGGCACCTTTAATTTTGCAAAGACTTGCCACCGCTAAT---
Bombyx_mori|1440                   ACCTGCCACATGGAGATAAAAGCTCATCATATACTGGAGATGATCAACTCAAGGGCCAAT
Culex_quinquefasciatus|8347        GATTTCCACATGCGATTACATGCCGGCCCAATCATTCAAGAGATGATGAGCCAAACGAAA
Drosophila_willistoni|6759         AATTTTCATATGCAACTCCATGCTAGCCCAATCATACAGCAAATCAATCAGCAAACCAAG
Drosophila_persimilis|9372         AACTTCCACATGCAGCTCCACGCCAGCCCCATCATACAGCAGATTAATCAGCAAACCAAA
Drosophila_melanogaster|20217      AACTTTCACATGCAGCTCCACGCCAGTCCCATCATCCAGCAGATTAACCAGCAGACCAAG
Drosophila_simulans|12658          AACTTCCACATGCAGCTCCACGCCAGTCCCATCATCCAGCAGATTAACCAGCAAACCAAG
Pediculus_humanus|1518             ACTTTGTACATTGAATTACATGCTGGAAAGTATATAAGTGTTATGCATGGAGAGTGCAAT
Nematostella_vectensis|14687       ACGATGTACATGGACACTTATGCTAAAGATTATATCGATACAATGATGATAGATGCAGTC
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ACGCTATACATAGAAACAAAAGCTGCCGAATACATCTCAAAAATGACAACCAACCCCATC
Tarsius_syrichta|890               ACATTGTACATAGAAACAAAGGCTGCCGAATACATTTCAAAGATGACAACGAACCCCATC
Macropus_eugenii|10045             ACACTGTACATAGAAACAAAAGCCTCCGAATACATTTCCAAAATGACAACAAACCCTATC
Gasterosteus_aculeatus|27934       ACTCTCTACATTGAGACCAAGGCGGCGGAGTACATTGCCAAAATGACCACTAACCCCATC
Oryzias_latipes|7013               ACTCTTTACATCGAGACCAAGGCGGCGGAGTACATTGCCAAAATGACCACAAACCCGATC
Fugu_rubripes|14746                ACCCTCTACATTGAGACCAAGGCGGCGGAGTACATCGCCAAGATGACCACCAATCCTATC
Tetraodon_nigroviridis|16104       ACCCTCTACATCGAGACCAAGGCGGCGGAGTACATCGCCAGAATGACCACCAATCCCATC
Spermophilus_tridecemlineatus|2344 ACGCTGTACATAGAAACAAAAGCTGCCGAATACATTTCCAAGATGACCACAAATCCCATC
Danio_rerio|9306                   ACTCTCTACATTGAGACAAAGGCCGCGGAGTACATCGCTAAGATGACCACAAACCCCATT
Choloepus_hoffmanni|11191          ACACTGTACATAGAAACGAAAGCTTCTGAATACATTTCAAAAATGACAACAAACCCCATT
Felis_catus|38196                  ACACTGTACATAGAAACAAAAGCTTCTGAATACATTTCCAAAATGACAACAAACCCCATT
Dipodomys_ordii|13518              ACGTTGTACATAGAAACAAAAGCTGCTGAATACATTTCCAAAATGACAACTAACCCCATC
Echinops_telfairi|2788             ACACTCTACATAGAAACAAAGGCTTCCGAGTACATTTCAAAGATGACCACCAACCCCATT
Xenopus_tropicalis|20641           GTGCTGTGGCAACCTCTAAAACTCTTTGCCTATTCG------------------------
Erinaceus_europaeus|7699           ACACTGTATATAGAAACAAAAGCTTCTGAATACATTTCCAAAATGACCACAAACCCAATT
Vicugna_pacos|12004                ACGTTGTACATAGAAACAAAGGCTTCCGAATACATTTCCAAAATGACAACAAACCCCATT
Dasypus_novemcinctus|12376         ACACTGTACATAGAAACAAAAGCTTCTGAATACATTTCAAAAATGACAACAAACCCCATT
Myotis_lucifugus|13996             ACACTGTACATAGAGACAAAAGCCTCCGAGTACATTTCCAAAATGACCACAAACCCCATC
Ochotona_princeps|1540             ACGCTGTACATAGAAACGAAAGCTGCCGAGTACATCTCCAAGATGACCACAAACCCCATC
Anolis_carolinensis|11713          ACATTGTATATAGAAACAAAGGCTTCTGAATATATTTCTAAAATGACAACAAATCCTATC
Gallus_gallus|8478                 ACGTTGTATATAGAAACAAAGGCTTCTGAGTATATTTCCAAAATGACGACAAATCCCATC
Monodelphis_domestica|32218        ACACTGTACATAGAAACAAAAGCCTCTGAATACATTTCCAAAATGACAACAAACCCCATC
Ornithorhynchus_anatinus|18048     ACGCTGTATATAGAAACCAAAGCTTCTGAATACATTTCAAAAATGACAACCAACCCCATC
Tursiops_truncatus|17458           ACGCTGTACATAGAAACAAAAGCGTCTGAATACATTTCCAAAATGACAACAAATCCCATC
Bos_taurus|20383                   ACACTGTACATAGAAACAAAAGCTTCAGAATACATTTCCAAAATGACAACAAACCCCATC
Loxodonta_africana|20466           ACACTGTACATAGAAACAAAGGCTTCTGAATACATTTCAAAAATGACAACGAACCCCATT
Procavia_capensis|1128             ACATTGTACATA---ACAAAGGCTTCCGAATACATTTCGAAAATGACAACGAACCCCATT
Sorex_araneus|13650                ACACTCTACATAGAAACAAAAGCTTCTGAATACATATCCAAAATGACAACAAACCCCATT
Microcebus_murinus|8758            ACGCTGTACATAGAAACAAAAGCTGCCGAATACATCTCAAAAATGACAACTAACCCCATC
Sus_scrofa|9306                    ACACTGTACATAGAAACAAAAGCTTCTGAATACATTTCCAAAATGACAACAAACCCCATC
Tupaia_belangeri|17337             ACGCTGTACATAGAAACAAAAGCTGCCGAGTACATTTCCAAAATGACAACTAACCCCATC
Mus_musculus|35474                 ACACTCTACATAGAGACCAAGGCTGCTGAGTACATCGCGAAAATGACCACAAATCCCATC
Rattus_norvegicus|25044            ACGCTCTACATAGAGACCAAGGCTGCTGAGTACATTGCAAAAATGACCACAAATCCCATC
Cavia_porcellus|16884              ACGTTGTACATAGAAACAAAAGCTGCTGAATACATTTCAAAAATGACAACGAACCCCATC
Callithrix_jacchus|16234           ACACTGTACATAGAAACAAAAGCTGCCGAATACATTTCAAAAATGACAACTAACCCCATC
Gorilla_gorilla|27910              ACACTGTACATAGAAACAAAAGCTGCCGAGTACATTTCAAAAATGACAACTAACCCCATC
Pongo_abelii|25321                 ACACTGTACATAGAAACAAAAGCTGCCGAGTACATTTCAAAAATGACAACTAACCCCATC
Pan_troglodytes|33528              ACTCTGTACATAGAAACAAAAGCTGCCGAGTACATTTCAAAAATGACAACTAACCCCATC
Rhesus_macaque|26807               ACACTGTACATAGAAACAAAAGCTGCCGAGTACATTTCAAAAATGACAACTAACCCCATC
Canis_familiaris|5395              ACATTGTACATAGAAACAAAGGCTTCTGAATACATTTCCAAAATGACAACAAACCCCATT
Pteropus_vampyrus|4823             ---------------------------------------------------------ATC
Equus_caballus|20466               ACACTGTACATAGAAACAAAAGCTTCGGAATACATTTCCAAAATGACAACGAACCCCATT
Sus_scrofa|7275                    ACATCGTGGCATGTGTCGGCTGTAAATCAACTTCTTCTTAAACTA---GTATATCCAGTT
Macropus_eugenii|8027              ACTCTCTATATTGAAACCAAGGCAGCAGAATATATTGCCAAGATGACGATAAATCCAATT
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Tupaia_belangeri|12767             ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Erinaceus_europaeus|11556          NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Tarsius_syrichta|9123              ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Pteropus_vampyrus|10445            ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Felis_catus|45196                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Spermophilus_tridecemlineatus|4303 ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Procavia_capensis|2688             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Dasypus_novemcinctus|1164          NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Otolemur_garnettii|929             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Oryzias_latipes|10889              ACGCTCTACATCGAGACGAAGGCGGCGGAGTACATCGCCAAGATGACCATCAACCCCATC
Gasterosteus_aculeatus|1240        ACGCTCTACATCGAGACCAAGGCAGCGGAGTACATCGCTAAGATGACCATAAACCCCATC
Tetraodon_nigroviridis|12063       ACGCTCTATGTTGAAACCAAGGCTGCCGAGTACATTGCTAAGATGACGATAAACCCCATC
Fugu_rubripes|12054                ACACTCTACGTTGAGACCAAGGCTGCGGAGTACATTGCTAAGATGACGATAAACCCCATT
Microcebus_murinus|15358           ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ACCCTCTACATTGAGACCAAGGCGGCGGAATATATTGCCAAGATGACTATAAATCCCATT
Cavia_porcellus|24636              ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ACACTGTACATAGAGACAAAAGCCTCCGAGTACATTTCCAAAATGACCACAAACCCCATC
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ACTCTTTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACAATAAATCCAATT
Taeniopygia_guttata|13478          ACTCTTTATATTGAAACGAAGGCAGCTGAATACATTTCCAAGATGACAATTAATCCAATT
Dipodomys_ordii|1968               ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Mus_musculus|22308                 ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Rattus_norvegicus|22026            ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Ornithorhynchus_anatinus|23474     ACTCTGTATATTGAAACCAAGGCAGCAGAATATATTGCCAAGATGACGATAAATCCAATT
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ACTCTCTATATTGAAACCAAGGCAGCAGAATATATTGCCAAGATGACGATAAATCCAATT
Echinops_telfairi|12695            ACTCTCTATATTGAAACCAAGGCAGCAGAGTACATTGCCAAGATGACGATAAACCCAATT
Cavia_porcellus|12568              ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Bos_taurus|11426                   ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Vicugna_pacos|6873                 ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Pongo_abelii|18313                 ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Gorilla_gorilla|11189              ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Homo_sapiens|48422                 ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Callithrix_jacchus|22501           ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Rhesus_macaque|9284                ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATA
Canis_familiaris|20431             ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Choloepus_hoffmanni|3438           ACTCTGTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Loxodonta_africana|14241           ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
Sorex_araneus|10550                ACTCTCTATATTGAAACCAAGGCAGCAGAATATATTGCCAAGATGACGATAAACCCCATT
Tursiops_truncatus|357             ACTCTCTATATTGAAACCAAGGCAGCAGAATACATTGCCAAGATGACGATAAACCCAATT
                                                                                               

Ixodes_scapularis|17566            ------TACGAGGACAGCCCCTACATGACGCTC---------------------------
Caenorhabditis_elegans|9662        ------TATGAGGATAGCCCATATTCTCGGTATACGAACGCCGCCGCCACCACT------
Daphnia_pulex|23786                ------TACGAGCAAAGCCCCTACTTCACCCTAAACGAGAGGAAGCGTCGCACTTTGAGT
Tribolium_castaneum|7722           ------TATCAAGAGAGTCCTTACATGACGTTAAATAAGCGCAAGTTGAGGGCTTTAAGC
Bombyx_mori|1440                   ------TACACGGACAGCCCGTATGTGACGTTAAATAGAAGAAAATTAAATACATTATCT
Culex_quinquefasciatus|8347        AACTGCTACGAACAGAGTCCATACATGACACTAAACCGGCGTAAATTACGAGTTTTGTCT
Drosophila_willistoni|6759         AACTGTTACCAACAGAGTCCCTACATGACCCTTAACAAGCGCAAATTGCGCGCCCTATCC
Drosophila_persimilis|9372         AACTGCTACCAGCAAAGTCCCTATATGACGCTCAACGGACGC------------------
Drosophila_melanogaster|20217      AACTGCTACCAGCAAAGCCCATACATGACCTTAAATGGCCGGAAACTTAGGGCTCTGTCC
Drosophila_simulans|12658          AACTGCTACCAGCAAAGCCCCTACATGACCTTAAATGGCCGGAAACTTAGGGCTCTGTCC
Pediculus_humanus|1518             ------TATGAAAGTTCCCCACATTTTACATTAAACAGAATGAAAAGAGAGAAAACAGTT
Nematostella_vectensis|14687       ------AGGCCAGATGAGGGTAGTAAGGAAGCAGTGCAAGAAAATGGGCAAGTGAAAGCT
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------TATGAACACATCGGATATGCCACTCTGCTCAGAGAAAAAGTATCCAGGAGACTG
Tarsius_syrichta|890               ------TATGAGCACATTGGATATGCCACTCTGCTCAGAGAAAAAGTATCCAGAAGGCTG
Macropus_eugenii|10045             ------TACGAACACATTGGCTACGCCACTTTGCTAAGAGAGAAGGTGTCCAGGAGATTG
Gasterosteus_aculeatus|27934       ------TACGAGCACCTTGGCTACACCTCGTTGCTCAAGGACAAGATGGTGCACAGGCTG
Oryzias_latipes|7013               ------TATGAGCATCTCGGCTATACGTCCCTGATCAAAGACAAGATGGTGCACCGACTG
Fugu_rubripes|14746                ------TACGAGCATCTGGGTTACACCTCGCTGCTGAAGGACAAGACGGTGCACAGGCTG
Tetraodon_nigroviridis|16104       ------TACGAGCATCTGGGATACACCTCGCTGCTGAAGGACAAGACAGTGCACAGGCTG
Spermophilus_tridecemlineatus|2344 ------TACGAACACATCGGGTACGCCACTCTACTCAGAGAAAAGGTGTCCAGAAGGCTG
Danio_rerio|9306                   ------TACCAGCACTTGGGCTATACTTCTCTTTTGAGGCAACCCGCGCAGAAGAATACA
Choloepus_hoffmanni|11191          ------TACGAACACATTGGTTATGCCACCTTACTCAGAGAAAAAGTATCCAGAAGGCTG
Felis_catus|38196                  ------TACGAACACATTGGATATGCCACTCTGCTCAGAGAAAAAGTATCCAGGAGGCTG
Dipodomys_ordii|13518              ------TATGAACACATTGGATATGCAACCCTACTCAGAGAAAAAGTATCCAGAAGGCTG
Echinops_telfairi|2788             ------TACGAACACATTGGATACGCCACTTTACTCCGAGAGAAAGTGTCCAGGCGGCTG
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------TATGAACACATTGGATATGCCACTTTACTCCGAGAAAAAGTATCCAGAAGGCTG
Vicugna_pacos|12004                ------TATGAACACATTGGATATGCCACTTTACTCAGAGAAAAAGTCTCCAGGAGGCTA
Dasypus_novemcinctus|12376         ------TATGAACACATTGGTTATGCCACCTTGCTCAGAGAAAAAGTGTCGAGAAGATTG
Myotis_lucifugus|13996             ------TATGAGCACATCGGATACGCCACGCTACTCAGAGAGAAGGTATCCAGGAGGCTG
Ochotona_princeps|1540             ------TACGAGCACATTGGCTACGCCACTCTACTCCGAGAAAAAGTCTCCAGGCGGCTG
Anolis_carolinensis|11713          ------TATGAACACATTGGATATGCCACCTTGCTTAGAGAAAAGGTTTCCCGGAGACTG
Gallus_gallus|8478                 ------TACGAACACATTGGATATGCCACACTGCTTAGAGAGAAGGTCTCCCGGAGGCTG
Monodelphis_domestica|32218        ------TATGAACACATTGGCTACGCCACTTTGCTAAGAGAGAAGGTGTCCAGGAGACTG
Ornithorhynchus_anatinus|18048     ------TATGAACACATTGGCTATGCCACGTTGCTTAGAGAAAAAGTGTCGAAAAGGCTG
Tursiops_truncatus|17458           ------TATGAACACATTGGATATGCCACTTTACTCAGAGAAAAAGTATCCAGGAGGCTA
Bos_taurus|20383                   ------TATGAACACATTGGATATGCCACTCTACTCAGAGAAAAAGTATCCAGAAGGCTA
Loxodonta_africana|20466           ------TATGAGCACATCGGATATGCCACTTTACTCAGAGAAAAAGTATCCAGAAGGCTG
Procavia_capensis|1128             ------TATGAACACATTGGATATGCCACTTTACTCAGAGAGAAAGTATCCAGAAGGCTG
Sorex_araneus|13650                ------TATGAACACATCGGATATGCCACCTTACTCAGAGAAAAAGTGTCCCGGAGGCTG
Microcebus_murinus|8758            ------TACGAACATATTGGATATGCCACTCTGCTCAGAGAAAAGGTATCCAGGAGGCTG
Sus_scrofa|9306                    ------TATGAACACATTGGCTATGCCACTTTGCTCAGAGAAAAAGTCTCCCGGAGACTA
Tupaia_belangeri|17337             ------TATGAACACATTGGATATGCCACGCTACTCAGAGAAAAAGTATCCAGAAGGCTG
Mus_musculus|35474                 ------TACGAGCACATCGGATACGCCACTCTCCTCAGAGAAAAAGTGTCCCGAAGGCTG
Rattus_norvegicus|25044            ------TACGAGCACATCGGATACGCCACTCTCCTCAGAGAAAAAGTGTCCAGAAGGCTG
Cavia_porcellus|16884              ------TATGAACACATTGGATATGCCACTTTACTCCGAGAAAAAGTATCCAGAAGGCTG
Callithrix_jacchus|16234           ------TATGAACACATTGGATATGCCACCCTACTCAGAGAAAAAGTATCCAGAAGGCTG
Gorilla_gorilla|27910              ------TATGAACACATTGGATATGCCACCCTACTCAGAGAAAAAGTATCCAGAAGGCTG
Pongo_abelii|25321                 ------TATGAACACATTGGATATGCCACCCTACTCAGAGAAAAAGTATCCAGAAGGCTG
Pan_troglodytes|33528              ------TATGAACACATTGGATATGCCACCCTACTCAGAGAAAAAGTATCCAGAAGGCTG
Rhesus_macaque|26807               ------TACGAACACATTGGATATGCCACCCTACTCAGAGAAAAAGTATCCAGAAAGCTG
Canis_familiaris|5395              ------TATGAACACATTGGATATGCCACTCTACTCCGAGAAAAAGTATCCAGGAGGCTG
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------TATGAACACATTGGATATGCCACTTTACTGAGAGAAAAAGTATCCAGAAGGCTA
Sus_scrofa|7275                    ------TTAGCTTTGGTAAAGTACTCTTACCTGTCTTACACAAAGTTTTTTAAAAAGCAG
Macropus_eugenii|8027              ------TATGAGCACATAGGATACACCACTTTAAACAGAGAGCCAGCATACAAAAAACAC
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------TATGAGCACGTAGGATACACAACCTTAAACAGAGAGCCAGCATACAAAAAACAT
Tupaia_belangeri|12767             ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACAAAAAACAT
Erinaceus_europaeus|11556          ------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Tarsius_syrichta|9123              ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACAAAAAACAT
Pteropus_vampyrus|10445            ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACCAAAAACAT
Felis_catus|45196                  ------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Spermophilus_tridecemlineatus|4303 ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACAAAAAACAC
Procavia_capensis|2688             ------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Dasypus_novemcinctus|1164          ------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Otolemur_garnettii|929             ------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Oryzias_latipes|10889              ------TACGAGCACGTGGGCTACACCACCCTGAACCAGGAGCCCACCCTGAAAAACCAG
Gasterosteus_aculeatus|1240        ------TACGAACACGTTGGCTACACTACGCTGAACCAGGAGCCCACTCTGAAAAAACAC
Tetraodon_nigroviridis|12063       ------TATGAGCACGTGGGCTACACCACCTTGAACCAGGAACCCGCCCTAAAAGAACAC
Fugu_rubripes|12054                ------TACGAACATGTGGGCTACACCACCCTGAACCAGGAGCCCAGTCTAAAAAAACAC
Microcebus_murinus|15358           ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACAAAAAACAT
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------TACGAACATATAGGGTACACGACTCTAAACAGAGAGCCGGCACACAAAAAGCAA
Cavia_porcellus|24636              ------TATGAGCACATAGGATACACAACCTTAAACAGAGACCCAGCATAT---------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------TATGAGCACATCGGATACGCCACGCTACTCAGAGAGAAGGTATCCAGGAGG---
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------TATGAACACATAGGATATACAACTTTAAACAGAGAGCCAGCACACAAAAAACAT
Taeniopygia_guttata|13478          ------TATGAACACGTAGGATATACAACCTTAAACAGAGAGCCAGCACACAAAAAGCAT
Dipodomys_ordii|1968               ------TATGAGCACGTAGGATACACAACCTTAAACAGAGAGCCAGCATACAAAAAACAT
Mus_musculus|22308                 ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACAAACAGCAC
Rattus_norvegicus|22026            ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACAAACAGCAC
Ornithorhynchus_anatinus|23474     ------TATGAACACATAGGATACACAACTCTAAACAGAGAGCCAGCATACAAAAAACAT
Pan_troglodytes|24690              ------------CACTTTGGCTTT------------------------------------
Monodelphis_domestica|19121        ------TATGAGCACATAGGATACACCACTTTAAACAGAGAGCCAGCATACAAAAAACAC
Echinops_telfairi|12695            ------TATGAGCACATAGGATACACAACTCTAACCCGGGAGCCAGCATGCAAAAAACAC
Cavia_porcellus|12568              ------TATGAGCACATAGGATACACAACTTTAAACAGAGAGCCAGCATACAAAAAACAT
Bos_taurus|11426                   ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACCAAAAACAT
Vicugna_pacos|6873                 ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACCAAAAACAT
Pongo_abelii|18313                 ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACAAAAAACAT
Gorilla_gorilla|11189              ------TATGAGCACGTAGGATACACAACCTTAAACAGAGAGCCAGCATACAAAAAACAT
Homo_sapiens|48422                 ------TATGAGCACGTAGGATACACAACCTTAAACAGAGAGCCAGCATACAAAAAACAT
Callithrix_jacchus|22501           ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACAAAAAACAT
Rhesus_macaque|9284                ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACAAAAAACAT
Canis_familiaris|20431             ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACCAAAAACAT
Choloepus_hoffmanni|3438           ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACAAAAAACAT
Loxodonta_africana|14241           ------TATGAGCACATAGGATACACAACTTTAAACAGAGAGCCAGCATACAAAAAACAT
Sorex_araneus|10550                ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACCAAAAACAT
Tursiops_truncatus|357             ------TATGAGCACATAGGATACACAACCTTAAACAGAGAGCCAGCATACCAAAAACAT
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                CGTAATAATAGG------------------------------------------------
Tribolium_castaneum|7722           AAAGAACATGCCAAAAATAAAAATTACGTGAAAGATTCAAACATTCCGCCAAAT------
Bombyx_mori|1440                   AAAATACAACAAGCTTCGAACAAGTCAAGTCCAATATTAAACAGAATTGAATCG------
Culex_quinquefasciatus|8347        AACGAGATAAGGAAATCATCTAAACTATCGATGCTCAATGATGAGATATCCACG------
Drosophila_willistoni|6759         AGTGAACTGAAGCGAAAAACCGAAGAAGTGGCCAAGGAAAAGGATGAGAAACCC------
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      AATGAGCTGGGCAAGGCCGCCGCCAAGGAATCGAAGGAATCGCCAGCCGAGGAG------
Drosophila_simulans|12658          AATGAGCTGGGCAAGGCCGCCGCCAAGGAATCCAAGGAATCGCCAGCCGAGGAG------
Pediculus_humanus|1518             CCTCCTGTTGTAGAA---------------------------------------------
Nematostella_vectensis|14687       GTTGAGACAGATGGGGCTAAGACACAGACGGGGGAGGTAAGAGTTTGTGACAGA------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            AGCAGGTCTAAGAACGAATCAAGAAAAGCGAACGTGACAAAT---GAAGAGCAC------
Tarsius_syrichta|890               AGCAGGTCTAAAAACGAATCAAGGAAAACGAGCGTCACAAAT---GAAGAGCAC------
Macropus_eugenii|10045             AGCAGGTCAAAACATGAGTCCAGAAAAATGAGTGTAACCAGT---GAAGAGCGT------
Gasterosteus_aculeatus|27934       AGCCGTGGACGCACAGAACCACGCAGGGTCACCTTCCAGAGA---GACGAGAAG------
Oryzias_latipes|7013               AGCCGTGCACGCTCAGAACCCCGTCGAGTCACCTTCCAGAGG---GAGGAAAGG------
Fugu_rubripes|14746                AACCGCGGACGCACAGAACCACGCAGGGTCACATTCCAGAGG---GATGAAAGAGTGAGT
Tetraodon_nigroviridis|16104       AGCCGCGGACGCACGGAACCGCGCAGGGTCACGTTCCAGAGGGATGACAGAAGA------
Spermophilus_tridecemlineatus|2344 AGCAGGTCTAAAAATGAATCAAGAAAAACGAACGTCATGAAT---GAAGAGCAC------
Danio_rerio|9306                   AACAAGACAAATGCTGAATGGTCCGATCCAAAACATTCTATG---TCTGAGAAC------
Choloepus_hoffmanni|11191          AGCAAGTCTAAAAATGAGTCAAGAAAACCAAATGTTGCAAAT---GAGGAACAC------
Felis_catus|38196                  AGCAGGTCGAAGAACGAATCAAGGAAAACAAGCGTCGCAAAT---GAAGAACAC------
Dipodomys_ordii|13518              AGCAGGTCAAAAAATGAATCAAGGAAAGCAAGTGTCACCAAT---GAAGAACAC------
Echinops_telfairi|2788             AGCAGGTCCAAAAACGAGTCACGGAAAGCCAGCATCGCCAGC---GAGGAGCAC------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           AGCAGGTCAAAAAATGAATCAAGAAAAGCAAGTGTCACAAAT---GAAGAACAC------
Vicugna_pacos|12004                AGCAGATCTAAAAATGAATCAAGGAAAGCCAGCGTCACGAGT---GAAGAACAC------
Dasypus_novemcinctus|12376         AGCAAGTCTAAAAATGAGTCAAGAAAACCAAGCGTTGCAAAT---GAAGAACAC------
Myotis_lucifugus|13996             AGCCGGTCGAAGAACGAGGCCCGGAAAGCGAGCGTCACAAGT---GAAGAGCAC------
Ochotona_princeps|1540             AGCAGGTCTAAAAACGAATCCAGGAAGACGAGCGTCAGCCAC---GAAGGGCAC------
Anolis_carolinensis|11713          AGTAGATCAAAAACTGAATCAAGAAAAGCTAGTGTAACGGCATGTGAAGAAACT------
Gallus_gallus|8478                 AGCAGAACAAAAAACGAATCAAGAAAAGCAAGTGTAACAAGT---GAAGAAAAT------
Monodelphis_domestica|32218        AGCCGGTCCAAGAACGAGTCGAGAAAAGCGAGCGTGACCAGCGAAGAGCACCAT------
Ornithorhynchus_anatinus|18048     AGCCGGACAAAGAATGAATCAAGGAAAACAAGTGTAACAAGT---GAGGAACAC------
Tursiops_truncatus|17458           AGCAGGTCTAAAAACGAATCAAGAAAAGCCAGCGTCACAAAT---GAAGAACAC------
Bos_taurus|20383                   AGCAGGTCTAAAAACGAATCAAGAAAAGCCAGCGTCACAAAT---GAAGAGCAC------
Loxodonta_africana|20466           AGCCGGTCTAAAAACGAATCAAGGAAAACAAGTGTCGCAAAT---GACGAACAC------
Procavia_capensis|1128             AGCAGGTCTAAAAACGAATCCAGGAAAACAAACGTTGCAAAT---GAAGAGCAC------
Sorex_araneus|13650                AGCAGGTCTAAAAACGAATCAAGGAAAACGAGTGTCACAAAT---GATGAACAT------
Microcebus_murinus|8758            AGCAGGTCCAAAAACGAACCGAGAAAAGCAAATGTGACAAAT---GAAGAGCAC------
Sus_scrofa|9306                    AGCAGGTCTAAAAATGAATCAAGAAAAGCCAACGTCACCAAC---GAAGAGCAC------
Tupaia_belangeri|17337             AGCAGGTCTAAAAATGAATCAAGAAAGCCAAGCGTCAGCAAT---GAAGAACAC------
Mus_musculus|35474                 AGCAGGTCTAAAAACGAATCAAGGAAAGCTAGCGTCAGCAAC---GAGGAGCAC------
Rattus_norvegicus|25044            AGCAGGTCTAAAAATGAGTCAAGAAAGGCTGGTGTCACCCAC---GAGGAACAC------
Cavia_porcellus|16884              AGCAGGTCTAAAAACGAGTCAAGGAAAACAAACGTCACAAAC---GAAGAGCAC------
Callithrix_jacchus|16234           AGCAGGTCTAAAAACGAACCAAGAAAAACAAACGTCACACAC---GAGGAACAC------
Gorilla_gorilla|27910              AGCAGGTCTAAAAATGAACCAAGAAAAACAAACGTCACACAT---GAAGAACAC------
Pongo_abelii|25321                 AGCAGGTCTAAAAATGAACCAAGAAAAACAAACGTCACACAT---GAAGAACAC------
Pan_troglodytes|33528              AGCAGGTCTAAAAATGAACCAAGAAAAACAAACGTCACACAT---GAAGAACAC------
Rhesus_macaque|26807               AGCAAGTCTAAAAACGAACCAAGAAAAACAAACGTCACACAC---GAAGAACAC------
Canis_familiaris|5395              AGCAGGTCTAAAAATGAATCAAGAAAAACAAGCGTTACAAAT---GAAGAACAC------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               AGCAGGTCTAAAAACGAGTCAAGGAAAACAAACGTCACAAAT---GAAGAACAC------
Sus_scrofa|7275                    CAACCTGTGGGCACCGCCTCACACATCCATTCCATCGAGACCAGACGAGAAGCC------
Macropus_eugenii|8027              ATGCCCGCCCTGAAAGATACACATGATTGGAAAGAGTCTACAGGAGAGGATGGG------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ATGGCAGTCCTGAAAGAGACACAGGATGAGAAAGAGTCTACAGGCCAGGATGGG------
Tupaia_belangeri|12767             ATGCCAGTCCTGAAAGAGACACATGATGAGAAAGATTCTACAGGCCAGGATGGG------
Erinaceus_europaeus|11556          NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------
Tarsius_syrichta|9123              ATGCCAGTCCTGAAAGAGACACATGATGAGAGAGATTCTTCAGGCCAGGATGGG------
Pteropus_vampyrus|10445            ATGCCAGTCCTGAAAGAGACACATGATGAGAAAGATTCTACAGGCCAGGATGGG------
Felis_catus|45196                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------
Spermophilus_tridecemlineatus|4303 ATGGCAGTCCTGAAAGAGACACATGATGAGAGAGATGCTGCAGGCCAGGATGGG------
Procavia_capensis|2688             NNNCCAGTCCTGAAAGAGACACATGATGAGAAAAGATCTACAGGACAGGATGGG------
Dasypus_novemcinctus|1164          NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------
Otolemur_garnettii|929             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------
Oryzias_latipes|10889              GTGCAGCGCTGCCCGGACGAGCCCGACGCCGCC---CGCGGCAGGAACGACTGC------
Gasterosteus_aculeatus|1240        CTGCCACAAAGCCCCGACGCCCCGGATGGCCCCGTCCCGCCCAAAGACGACCGC------
Tetraodon_nigroviridis|12063       CTTCCACTCAGTCCGGAAACTCCAGACGGACCCATTCCCGCAAAAGACGACCAT------
Fugu_rubripes|12054                CTCCCACTCAGTCCGGAAACTCCAGACGGACCCATACCGGCAAAAGATGACCTT------
Microcebus_murinus|15358           ATGCCAGTCCTGAAAGAGACACATGATGAGAGAGATCCTACAGGCCAGGATGGG------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ATGCCAGCCCTGCGGGAGGCACACGTAGAAAAAGAATGTCCAGGAGAAGATGGG------
Cavia_porcellus|24636              ATAGGAGTCCTGAAAGAGACACATAATGAGAAAGATGCTGCAGGCCAGGATGGG------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ATGCCAACCCTGAGAGATGCACATGATGGCAAAGACTCTACAGGAGAGGATGAG------
Taeniopygia_guttata|13478          ATGCCAACCCTGAGAGATGAACATGATGGCAAAGAGTCTACAGGAGAGGATGAG------
Dipodomys_ordii|1968               ATGGCAATCGTGAAAGAGACAAATGATGAGAGAGATGCTACAGGCCAGGATGGG------
Mus_musculus|22308                 ATGGCAGTCCTGAAAGAGACACATGATGAGAAAGAGGCTACAGGCCAGGATGGG------
Rattus_norvegicus|22026            ATGGCAGTCCTGAAAGAGACACATGATGAGAAAGAGGCTACAGGCCAGGATGGG------
Ornithorhynchus_anatinus|23474     ATGCCAACCCTGAGAGATACACAGGATGAGAGAGATTCTACGGGAGAGGATGGG------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ATGCCCGCCCTGAAAGATACACATGATTGGAAAGAGTCTACAGGAGAGGATGGG------
Echinops_telfairi|12695            GTGCCCGTCCTGAAAGAGACACAGGATGAGAAAGATTCTCCAGGCCAGGATGGG------
Cavia_porcellus|12568              ATGGGAGTCCTGAAAGAGACACAGGATGAGAAAGATGCTGCAGGCCAGGATGGG------
Bos_taurus|11426                   ATGCCAGTCCTGAAAGAGACACTTGATGAGAAAGATTCTACAGGCCAGGATGGG------
Vicugna_pacos|6873                 ATGCCAGTCCTGAAAGAGACACATGATGAGAAAGATTCTACAGGCCAGGATGGG------
Pongo_abelii|18313                 ATGCCAGTCCTGAAAGAGACACATGATGAGAGAGATTCTACAGGCCAGGATGGG------
Gorilla_gorilla|11189              ATGCCAGTCCTGAAAGAGACACATGATGAGAGAGATTCTACAGGCCAGGATGGG------
Homo_sapiens|48422                 ATGCCAGTCCTGAAAGAGACACATGATGAGAGAGATTCTACAGGCCAGGATGGG------
Callithrix_jacchus|22501           ATGCCAGTCCTGAAAGAGACACATGATGAGAGAGATTCTACAGGCCAGGATGGG------
Rhesus_macaque|9284                ATGCCAGTCCTGAAAGAGACACATGATGAGAGAGATTCTACAGGCCAGGATGGG------
Canis_familiaris|20431             ATGCCAGTCCTGAAAGAGACACATGATGAGAGAGATTCTACAGGCCAGGATGGG------
Choloepus_hoffmanni|3438           ATGCCAGTCCTGAAAGAAACACATGATGAGAGAGATTCTACAGGCCAGGATGGG------
Loxodonta_africana|14241           ATGCCAGTCCTGAAAGAGACACATGATGAGAAAGATTCTACAGGCCAGGATGGG------
Sorex_araneus|10550                ATGCCAGTCCCGAAAGAGGCACTTGATGAGAACGATTCTACAGGCCAGGATGGG------
Tursiops_truncatus|357             ATGCCAGTCCCGAAAGAGACACTTGATGAGAAAGATTCTACAGGCCAGGATGGG------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------ATTCCATTAAGTCAGCAGATA---------------------------
Bombyx_mori|1440                   ------AAAATCACTGAAGTTGATTCATCTATA---------------------------
Culex_quinquefasciatus|8347        ------------TTGAGCATTGACGAACCCGGG---------------------------
Drosophila_willistoni|6759         ------------AAGCCATTGGAT---CAACTG---------------------------
Drosophila_persimilis|9372         ---------------------------AAGCTG---------------------------
Drosophila_melanogaster|20217      ------------AAGGAGCAGAAG------------------------------------
Drosophila_simulans|12658          ------------AAGGAGCAGAAG------------------------------------
Pediculus_humanus|1518             ---------------------------AAAGTT---------------------------
Nematostella_vectensis|14687       ---------------------------CGATTT---------------------------
Callithrix_jacchus|17478           ---------------------------AGGCTG---------------------------
Otolemur_garnettii|5617            ------------ACGCCAGTGGAG---AAGNNN---------------------------
Tarsius_syrichta|890               ------------ACACCGGTGGAG---AAGATC---------------------------
Macropus_eugenii|10045             ------------CCAGCAGTTGAA---AAGNNN---------------------------
Gasterosteus_aculeatus|27934       ------------------------------ATA---------------------------
Oryzias_latipes|7013               ------------GCATCTTGTCCA---CAGATC---------------------------
Fugu_rubripes|14746                TTATTGGTTATTGAAGCTGTGGAGCCGAGCGTGCGGGGTTGTTTTGTCGAGAGTGTGTGT
Tetraodon_nigroviridis|16104       ---------GCTGCTGAGATCGCC------------------------------------
Spermophilus_tridecemlineatus|2344 ------------ACACCAGTAGAA---AAGATC---------------------------
Danio_rerio|9306                   ------------TCTGGGATCAGAGAAAGAATT---------------------------
Choloepus_hoffmanni|11191          ------------ATAGCAGTTGAA---AAGNNN---------------------------
Felis_catus|38196                  ------------ACGGCGGTTGAA---AAGATC---------------------------
Dipodomys_ordii|13518              ------------ACACCCGTGGAA---AAGATC---------------------------
Echinops_telfairi|2788             ------------ACGGCCGTGGAG---AAGATC---------------------------
Xenopus_tropicalis|20641           ---------------------------CAGATC---------------------------
Erinaceus_europaeus|7699           ------------ACATCAGTTGAA------------------------------------
Vicugna_pacos|12004                ------------ACAGCTGTGGAA---AAGNNN---------------------------
Dasypus_novemcinctus|12376         ------------ACAGCAGTTGAG---AAGCTC---------------------------
Myotis_lucifugus|13996             ------------CCCACAGTTGAA---AAGATC---------------------------
Ochotona_princeps|1540             ------------TCGGGAGTGGAG---AAGNNN---------------------------
Anolis_carolinensis|11713          ------------ACACCAGTTGAA---AAGATC---------------------------
Gallus_gallus|8478                 ------------ACCCCGGTTGAG---AAGATC---------------------------
Monodelphis_domestica|32218        ------------CCCGCTGTGGAG---AAGATT---------------------------
Ornithorhynchus_anatinus|18048     ------------GCCACTATGGAG---AAGATC---------------------------
Tursiops_truncatus|17458           ------------ACAGCGGTTGAA---AAGATC---------------------------
Bos_taurus|20383                   ------------ACACCCGTCGAAAAGAAACTA---------------------------
Loxodonta_africana|20466           ------------ACGGCGGTGGAA---AAGATC---------------------------
Procavia_capensis|1128             ------------TCAGCAGTGGAA---AAGATC---------------------------
Sorex_araneus|13650                ------------TCAGCAGTAGAA---AAGATC---------------------------
Microcebus_murinus|8758            ------------ACGTCAGTGGAA---AAGATC---------------------------
Sus_scrofa|9306                    ------------GCAGCAGTTGAA---AAGATC---------------------------
Tupaia_belangeri|17337             ------------ACGACCGTGGAA---AAGATC---------------------------
Mus_musculus|35474                 ------------ACGCCAGTGGAG---AAGATC---------------------------
Rattus_norvegicus|25044            ------------ACACCAGTGGAG---AAGATC---------------------------
Cavia_porcellus|16884              ------------ACGTCAGTGGAG---AAGATC---------------------------
Callithrix_jacchus|16234           ------------ACGGCGGTGGAA---AAGATC---------------------------
Gorilla_gorilla|27910              ------------ACGGCGGTGGAA---AAGATC---------------------------
Pongo_abelii|25321                 ------------ACAGCGGTGGAA---AAGATC---------------------------
Pan_troglodytes|33528              ------------ACGGCGGTGGAA---AAGATC---------------------------
Rhesus_macaque|26807               ------------ACGGCAGTGGAC---AAGATC---------------------------
Canis_familiaris|5395              ------------ACAACAGTTGAA---AAGATC---------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------ACAGCGGTTGAA---AAGATC---------------------------
Sus_scrofa|7275                    ------------TCCTCTGAAGCAAAAAGAACC---------------------------
Macropus_eugenii|8027              ------------GTGTCAGAGAAA---AGGTTG---------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------GTGTCAGAGAAA---AGGNNN---------------------------
Tupaia_belangeri|12767             ------------GTATCAGAGAAA---AGGTTG---------------------------
Erinaceus_europaeus|11556          ------------NNNNNNNNNNNN---NNNTTG---------------------------
Tarsius_syrichta|9123              ------------GTGTCAGAGGAA---AGGTTG---------------------------
Pteropus_vampyrus|10445            ------------GTATCAGAGAAA---AGGTTG---------------------------
Felis_catus|45196                  ------------NNNNNNNNNNNN---NNNNNN---------------------------
Spermophilus_tridecemlineatus|4303 ------------GTATCAGAGAAA---AGGNNN---------------------------
Procavia_capensis|2688             ------------GTGTCAGAGAAA---AGGTTG---------------------------
Dasypus_novemcinctus|1164          ------------NNNNNNNNNNNN---NNNTTG---------------------------
Otolemur_garnettii|929             ------------NNNNNNNNNNNN---NNNTTG---------------------------
Oryzias_latipes|10889              ------------AGCACGGAGAGG---CAGCTG---------------------------
Gasterosteus_aculeatus|1240        ------------CAGGCCGAGGAG---AGGCTC---------------------------
Tetraodon_nigroviridis|12063       ------------AATACAGAGGAG---AGGCTC---------------------------
Fugu_rubripes|12054                ------------AATACAGAAGAG---AGGCTG---------------------------
Microcebus_murinus|15358           ------------GTATCAGAGAAA---AGGTTG---------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------ATATCAGAAAAA---AGGTTA---------------------------
Cavia_porcellus|24636              ------------GTGTCAGAGAAA---ACGTTG---------------------------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------GAGCCG---GTCTTG---------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------GTAGCAGAAAAG---AGGCTG---------------------------
Taeniopygia_guttata|13478          ------------GTAGCAGAAAAG---AGGTTG---------------------------
Dipodomys_ordii|1968               ------------GTATCTGAGAAA---AGGTTG---------------------------
Mus_musculus|22308                 ------------GTATCAGAGAAA---AGGTTG---------------------------
Rattus_norvegicus|22026            ------------GTGTCAGAGAAA---AGGTTG---------------------------
Ornithorhynchus_anatinus|23474     ------------GTGTCAGAGAAA---AGGTTG---------------------------
Pan_troglodytes|24690              ---------------------------AAGTTG---------------------------
Monodelphis_domestica|19121        ------------GTGTCAGAGAAA---AGGTTG---------------------------
Echinops_telfairi|12695            ------------GTGTCAGAGAAA---AGGTTG---------------------------
Cavia_porcellus|12568              ------------GTGTCAGAGAAA---AGGTTG---------------------------
Bos_taurus|11426                   ------------GTGTCAGAGAAA---AGGTTG---------------------------
Vicugna_pacos|6873                 ------------GTGTCAGAGAAA---AGGTTG---------------------------
Pongo_abelii|18313                 ------------GTGTCAGAGAAA---AGGTTG---------------------------
Gorilla_gorilla|11189              ------------GTGTCAGAGAAA---AGGTTG---------------------------
Homo_sapiens|48422                 ------------GTGTCAGAGAAA---AGGTTG---------------------------
Callithrix_jacchus|22501           ------------GTGTCAGAGAAA---AGGTTG---------------------------
Rhesus_macaque|9284                ------------GTGTCAGAGAAA---AGGTTG---------------------------
Canis_familiaris|20431             ------------GTGTCAGAGAAA---AGGTTG---------------------------
Choloepus_hoffmanni|3438           ------------GTATCAGAGAAA---AGGTTG---------------------------
Loxodonta_africana|14241           ------------GTATCAGAGAAA---AGGTTG---------------------------
Sorex_araneus|10550                ------------GTGTCAGAGAAA---AGGCTG---------------------------
Tursiops_truncatus|357             ------------GTATCAGAGAAA---AGGTTG---------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------------------------------------------------------
Bombyx_mori|1440                   ------------------------------------------------------------
Culex_quinquefasciatus|8347        ------------------------------------------------------------
Drosophila_willistoni|6759         ------------------------------------------------------------
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          ------------------------------------------------------------
Pediculus_humanus|1518             ------------------------------------------------------------
Nematostella_vectensis|14687       ------------------------------------------------------------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------------------------------------------
Tarsius_syrichta|890               ------------------------------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ------------------------------------------------------------
Oryzias_latipes|7013               ------------------------------------------------------------
Fugu_rubripes|14746                AGATCTGTCCTGCTGTCGTACAGAGTCAGCCCCCACTGTGCCGTTTGGTCCGTGTCCTCG
Tetraodon_nigroviridis|16104       ------------------------------------------------------------
Spermophilus_tridecemlineatus|2344 ------------------------------------------------------------
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ------------------------------------------------------------
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              ------------------------------------------------------------
Echinops_telfairi|2788             ------------------------------------------------------------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------------------------------------------------------------
Vicugna_pacos|12004                ------------------------------------------------------------
Dasypus_novemcinctus|12376         ------------------------------------------------------------
Myotis_lucifugus|13996             ------------------------------------------------------------
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          ------------------------------------------------------------
Gallus_gallus|8478                 ------------------------------------------------------------
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------------------------------------------
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   ------------------------------------------------------------
Loxodonta_africana|20466           ------------------------------------------------------------
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ------------------------------------------------------------
Microcebus_murinus|8758            ------------------------------------------------------------
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ------------------------------------------------------------
Mus_musculus|35474                 ------------------------------------------------------------
Rattus_norvegicus|25044            ------------------------------------------------------------
Cavia_porcellus|16884              ------------------------------------------------------------
Callithrix_jacchus|16234           ------------------------------------------------------------
Gorilla_gorilla|27910              ------------------------------------------------------------
Pongo_abelii|25321                 ------------------------------------------------------------
Pan_troglodytes|33528              ------------------------------------------------------------
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ------------------------------------------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------------------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ------------------------------------------------------------
Erinaceus_europaeus|11556          ------------------------------------------------------------
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ------------------------------------------------------------
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ------------------------------------------------------------
Oryzias_latipes|10889              ------------------------------------------------------------
Gasterosteus_aculeatus|1240        ------------------------------------------------------------
Tetraodon_nigroviridis|12063       ------------------------------------------------------------
Fugu_rubripes|12054                ------------------------------------------------------------
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------------------------------------------
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------------------------------------------------------
Taeniopygia_guttata|13478          ------------------------------------------------------------
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------------------------------------------
Rattus_norvegicus|22026            ------------------------------------------------------------
Ornithorhynchus_anatinus|23474     ------------------------------------------------------------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------------------------------------
Echinops_telfairi|12695            ------------------------------------------------------------
Cavia_porcellus|12568              ------------------------------------------------------------
Bos_taurus|11426                   ------------------------------------------------------------
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------------------------------------------
Callithrix_jacchus|22501           ------------------------------------------------------------
Rhesus_macaque|9284                ------------------------------------------------------------
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------------------------------
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------------------------------------------------------
Bombyx_mori|1440                   ------------------------------------------------------------
Culex_quinquefasciatus|8347        ------------------------------------------------------------
Drosophila_willistoni|6759         ------------------------------------------------------------
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          ------------------------------------------------------------
Pediculus_humanus|1518             ------------------------------------------------------------
Nematostella_vectensis|14687       ------------------------------------------------------------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------------------------------------------
Tarsius_syrichta|890               ------------------------------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ------------------------------------------------------------
Oryzias_latipes|7013               ------------------------------------------------------------
Fugu_rubripes|14746                CGTCCAACAGAGAGCCATCTGCCCTCACACAAAAGAGCGCAGCCTCTCGTCCTCCCACCC
Tetraodon_nigroviridis|16104       ------------------------------------------------------------
Spermophilus_tridecemlineatus|2344 ------------------------------------------------------------
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ------------------------------------------------------------
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              ------------------------------------------------------------
Echinops_telfairi|2788             ------------------------------------------------------------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------------------------------------------------------------
Vicugna_pacos|12004                ------------------------------------------------------------
Dasypus_novemcinctus|12376         ------------------------------------------------------------
Myotis_lucifugus|13996             ------------------------------------------------------------
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          ------------------------------------------------------------
Gallus_gallus|8478                 ------------------------------------------------------------
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------------------------------------------
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   ------------------------------------------------------------
Loxodonta_africana|20466           ------------------------------------------------------------
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ------------------------------------------------------------
Microcebus_murinus|8758            ------------------------------------------------------------
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ------------------------------------------------------------
Mus_musculus|35474                 ------------------------------------------------------------
Rattus_norvegicus|25044            ------------------------------------------------------------
Cavia_porcellus|16884              ------------------------------------------------------------
Callithrix_jacchus|16234           ------------------------------------------------------------
Gorilla_gorilla|27910              ------------------------------------------------------------
Pongo_abelii|25321                 ------------------------------------------------------------
Pan_troglodytes|33528              ------------------------------------------------------------
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ------------------------------------------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------------------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ------------------------------------------------------------
Erinaceus_europaeus|11556          ------------------------------------------------------------
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ------------------------------------------------------------
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ------------------------------------------------------------
Oryzias_latipes|10889              ------------------------------------------------------------
Gasterosteus_aculeatus|1240        ------------------------------------------------------------
Tetraodon_nigroviridis|12063       ------------------------------------------------------------
Fugu_rubripes|12054                ------------------------------------------------------------
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------------------------------------------
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------------------------------------------------------
Taeniopygia_guttata|13478          ------------------------------------------------------------
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------------------------------------------
Rattus_norvegicus|22026            ------------------------------------------------------------
Ornithorhynchus_anatinus|23474     ------------------------------------------------------------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------------------------------------
Echinops_telfairi|12695            ------------------------------------------------------------
Cavia_porcellus|12568              ------------------------------------------------------------
Bos_taurus|11426                   ------------------------------------------------------------
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------------------------------------------
Callithrix_jacchus|22501           ------------------------------------------------------------
Rhesus_macaque|9284                ------------------------------------------------------------
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------------------------------
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------------------------------------------------------
Bombyx_mori|1440                   ------------------------------------------------------------
Culex_quinquefasciatus|8347        ------------------------------------------------------------
Drosophila_willistoni|6759         ------------------------------------------------------------
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          ------------------------------------------------------------
Pediculus_humanus|1518             ------------------------------------------------------------
Nematostella_vectensis|14687       ------------------------------------------------------------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------------------------------------------
Tarsius_syrichta|890               ------------------------------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ------------------------------------------------------------
Oryzias_latipes|7013               ------------------------------------------------------------
Fugu_rubripes|14746                CAACAGCCTCACCAGGCAGAAATATCTATATATAAGTCGTCTCTTCCTCGTCTGTCGCCT
Tetraodon_nigroviridis|16104       ------------------------------------------------------------
Spermophilus_tridecemlineatus|2344 ------------------------------------------------------------
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ------------------------------------------------------------
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              ------------------------------------------------------------
Echinops_telfairi|2788             ------------------------------------------------------------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------------------------------------------------------------
Vicugna_pacos|12004                ------------------------------------------------------------
Dasypus_novemcinctus|12376         ------------------------------------------------------------
Myotis_lucifugus|13996             ------------------------------------------------------------
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          ------------------------------------------------------------
Gallus_gallus|8478                 ------------------------------------------------------------
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------------------------------------------
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   ------------------------------------------------------------
Loxodonta_africana|20466           ------------------------------------------------------------
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ------------------------------------------------------------
Microcebus_murinus|8758            ------------------------------------------------------------
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ------------------------------------------------------------
Mus_musculus|35474                 ------------------------------------------------------------
Rattus_norvegicus|25044            ------------------------------------------------------------
Cavia_porcellus|16884              ------------------------------------------------------------
Callithrix_jacchus|16234           ------------------------------------------------------------
Gorilla_gorilla|27910              ------------------------------------------------------------
Pongo_abelii|25321                 ------------------------------------------------------------
Pan_troglodytes|33528              ------------------------------------------------------------
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ------------------------------------------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------------------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ------------------------------------------------------------
Erinaceus_europaeus|11556          ------------------------------------------------------------
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ------------------------------------------------------------
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ------------------------------------------------------------
Oryzias_latipes|10889              ------------------------------------------------------------
Gasterosteus_aculeatus|1240        ------------------------------------------------------------
Tetraodon_nigroviridis|12063       ------------------------------------------------------------
Fugu_rubripes|12054                ------------------------------------------------------------
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------------------------------------------
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------------------------------------------------------
Taeniopygia_guttata|13478          ------------------------------------------------------------
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------------------------------------------
Rattus_norvegicus|22026            ------------------------------------------------------------
Ornithorhynchus_anatinus|23474     ------------------------------------------------------------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------------------------------------
Echinops_telfairi|12695            ------------------------------------------------------------
Cavia_porcellus|12568              ------------------------------------------------------------
Bos_taurus|11426                   ------------------------------------------------------------
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------------------------------------------
Callithrix_jacchus|22501           ------------------------------------------------------------
Rhesus_macaque|9284                ------------------------------------------------------------
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------------------------------
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------------------------------------------------------
Bombyx_mori|1440                   ------------------------------------------------------------
Culex_quinquefasciatus|8347        ------------------------------------------------------------
Drosophila_willistoni|6759         ------------------------------------------------------------
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          ------------------------------------------------------------
Pediculus_humanus|1518             ------------------------------------------------------------
Nematostella_vectensis|14687       ------------------------------------------------------------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------------------------------------------
Tarsius_syrichta|890               ------------------------------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ------------------------------------------------------------
Oryzias_latipes|7013               ------------------------------------------------------------
Fugu_rubripes|14746                CAGACTACGCATGTGTGCATCTTTTCGAGGAATGTCAGCCACAATGGCAAATATCTTCAC
Tetraodon_nigroviridis|16104       ------------------------------------------------------------
Spermophilus_tridecemlineatus|2344 ------------------------------------------------------------
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ------------------------------------------------------------
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              ------------------------------------------------------------
Echinops_telfairi|2788             ------------------------------------------------------------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------------------------------------------------------------
Vicugna_pacos|12004                ------------------------------------------------------------
Dasypus_novemcinctus|12376         ------------------------------------------------------------
Myotis_lucifugus|13996             ------------------------------------------------------------
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          ------------------------------------------------------------
Gallus_gallus|8478                 ------------------------------------------------------------
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------------------------------------------
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   ------------------------------------------------------------
Loxodonta_africana|20466           ------------------------------------------------------------
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ------------------------------------------------------------
Microcebus_murinus|8758            ------------------------------------------------------------
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ------------------------------------------------------------
Mus_musculus|35474                 ------------------------------------------------------------
Rattus_norvegicus|25044            ------------------------------------------------------------
Cavia_porcellus|16884              ------------------------------------------------------------
Callithrix_jacchus|16234           ------------------------------------------------------------
Gorilla_gorilla|27910              ------------------------------------------------------------
Pongo_abelii|25321                 ------------------------------------------------------------
Pan_troglodytes|33528              ------------------------------------------------------------
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ------------------------------------------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------------------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ------------------------------------------------------------
Erinaceus_europaeus|11556          ------------------------------------------------------------
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ------------------------------------------------------------
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ------------------------------------------------------------
Oryzias_latipes|10889              ------------------------------------------------------------
Gasterosteus_aculeatus|1240        ------------------------------------------------------------
Tetraodon_nigroviridis|12063       ------------------------------------------------------------
Fugu_rubripes|12054                ------------------------------------------------------------
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------------------------------------------
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------------------------------------------------------
Taeniopygia_guttata|13478          ------------------------------------------------------------
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------------------------------------------
Rattus_norvegicus|22026            ------------------------------------------------------------
Ornithorhynchus_anatinus|23474     ------------------------------------------------------------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------------------------------------
Echinops_telfairi|12695            ------------------------------------------------------------
Cavia_porcellus|12568              ------------------------------------------------------------
Bos_taurus|11426                   ------------------------------------------------------------
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------------------------------------------
Callithrix_jacchus|22501           ------------------------------------------------------------
Rhesus_macaque|9284                ------------------------------------------------------------
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------------------------------
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------------------------------------------------------
Bombyx_mori|1440                   ------------------------------------------------------------
Culex_quinquefasciatus|8347        ------------------------------------------------------------
Drosophila_willistoni|6759         ------------------------------------------------------------
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          ------------------------------------------------------------
Pediculus_humanus|1518             ------------------------------------------------------------
Nematostella_vectensis|14687       ------------------------------------------------------------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------------------------------------------
Tarsius_syrichta|890               ------------------------------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ------------------------------------------------------------
Oryzias_latipes|7013               ------------------------------------------------------------
Fugu_rubripes|14746                CTGCCCTGTCACTCCGGGAAACGTCAAGATTTTCCAGACGGGAGAGAAAAGCCGCTGCTC
Tetraodon_nigroviridis|16104       ------------------------------------------------------------
Spermophilus_tridecemlineatus|2344 ------------------------------------------------------------
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ------------------------------------------------------------
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              ------------------------------------------------------------
Echinops_telfairi|2788             ------------------------------------------------------------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------------------------------------------------------------
Vicugna_pacos|12004                ------------------------------------------------------------
Dasypus_novemcinctus|12376         ------------------------------------------------------------
Myotis_lucifugus|13996             ------------------------------------------------------------
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          ------------------------------------------------------------
Gallus_gallus|8478                 ------------------------------------------------------------
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------------------------------------------
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   ------------------------------------------------------------
Loxodonta_africana|20466           ------------------------------------------------------------
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ------------------------------------------------------------
Microcebus_murinus|8758            ------------------------------------------------------------
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ------------------------------------------------------------
Mus_musculus|35474                 ------------------------------------------------------------
Rattus_norvegicus|25044            ------------------------------------------------------------
Cavia_porcellus|16884              ------------------------------------------------------------
Callithrix_jacchus|16234           ------------------------------------------------------------
Gorilla_gorilla|27910              ------------------------------------------------------------
Pongo_abelii|25321                 ------------------------------------------------------------
Pan_troglodytes|33528              ------------------------------------------------------------
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ------------------------------------------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------------------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ------------------------------------------------------------
Erinaceus_europaeus|11556          ------------------------------------------------------------
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ------------------------------------------------------------
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ------------------------------------------------------------
Oryzias_latipes|10889              ------------------------------------------------------------
Gasterosteus_aculeatus|1240        ------------------------------------------------------------
Tetraodon_nigroviridis|12063       ------------------------------------------------------------
Fugu_rubripes|12054                ------------------------------------------------------------
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------------------------------------------
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------------------------------------------------------
Taeniopygia_guttata|13478          ------------------------------------------------------------
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------------------------------------------
Rattus_norvegicus|22026            ------------------------------------------------------------
Ornithorhynchus_anatinus|23474     ------------------------------------------------------------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------------------------------------
Echinops_telfairi|12695            ------------------------------------------------------------
Cavia_porcellus|12568              ------------------------------------------------------------
Bos_taurus|11426                   ------------------------------------------------------------
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------------------------------------------
Callithrix_jacchus|22501           ------------------------------------------------------------
Rhesus_macaque|9284                ------------------------------------------------------------
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------------------------------
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------------------------------------------------------
Bombyx_mori|1440                   ------------------------------------------------------------
Culex_quinquefasciatus|8347        ------------------------------------------------------------
Drosophila_willistoni|6759         ------------------------------------------------------------
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          ------------------------------------------------------------
Pediculus_humanus|1518             ------------------------------------------------------------
Nematostella_vectensis|14687       ------------------------------------------------------------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------------------------------------------
Tarsius_syrichta|890               ------------------------------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ------------------------------------------------------------
Oryzias_latipes|7013               ------------------------------------------------------------
Fugu_rubripes|14746                AGAGGGCTCGCAGTGGTGTTTTACTTTGCCTCCAAGCGGCCAGCGCTTTCATTTTATCTC
Tetraodon_nigroviridis|16104       ------------------------------------------------------------
Spermophilus_tridecemlineatus|2344 ------------------------------------------------------------
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ------------------------------------------------------------
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              ------------------------------------------------------------
Echinops_telfairi|2788             ------------------------------------------------------------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------------------------------------------------------------
Vicugna_pacos|12004                ------------------------------------------------------------
Dasypus_novemcinctus|12376         ------------------------------------------------------------
Myotis_lucifugus|13996             ------------------------------------------------------------
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          ------------------------------------------------------------
Gallus_gallus|8478                 ------------------------------------------------------------
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------------------------------------------
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   ------------------------------------------------------------
Loxodonta_africana|20466           ------------------------------------------------------------
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ------------------------------------------------------------
Microcebus_murinus|8758            ------------------------------------------------------------
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ------------------------------------------------------------
Mus_musculus|35474                 ------------------------------------------------------------
Rattus_norvegicus|25044            ------------------------------------------------------------
Cavia_porcellus|16884              ------------------------------------------------------------
Callithrix_jacchus|16234           ------------------------------------------------------------
Gorilla_gorilla|27910              ------------------------------------------------------------
Pongo_abelii|25321                 ------------------------------------------------------------
Pan_troglodytes|33528              ------------------------------------------------------------
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ------------------------------------------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------------------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ------------------------------------------------------------
Erinaceus_europaeus|11556          ------------------------------------------------------------
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ------------------------------------------------------------
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ------------------------------------------------------------
Oryzias_latipes|10889              ------------------------------------------------------------
Gasterosteus_aculeatus|1240        ------------------------------------------------------------
Tetraodon_nigroviridis|12063       ------------------------------------------------------------
Fugu_rubripes|12054                ------------------------------------------------------------
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------------------------------------------
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------------------------------------------------------
Taeniopygia_guttata|13478          ------------------------------------------------------------
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------------------------------------------
Rattus_norvegicus|22026            ------------------------------------------------------------
Ornithorhynchus_anatinus|23474     ------------------------------------------------------------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------------------------------------
Echinops_telfairi|12695            ------------------------------------------------------------
Cavia_porcellus|12568              ------------------------------------------------------------
Bos_taurus|11426                   ------------------------------------------------------------
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------------------------------------------
Callithrix_jacchus|22501           ------------------------------------------------------------
Rhesus_macaque|9284                ------------------------------------------------------------
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------------------------------
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------------------------------------------------------
Bombyx_mori|1440                   ------------------------------------------------------------
Culex_quinquefasciatus|8347        ------------------------------------------------------------
Drosophila_willistoni|6759         ------------------------------------------------------------
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          ------------------------------------------------------------
Pediculus_humanus|1518             ------------------------------------------------------------
Nematostella_vectensis|14687       ------------------------------------------------------------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------------------------------------------
Tarsius_syrichta|890               ------------------------------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ------------------------------------------------------------
Oryzias_latipes|7013               ------------------------------------------------------------
Fugu_rubripes|14746                GGATTTGCAGTTGCCCTTAAGGTCTTTAGCTTTCTGCTTCGCCATTGTGACACTTTATCA
Tetraodon_nigroviridis|16104       ------------------------------------------------------------
Spermophilus_tridecemlineatus|2344 ------------------------------------------------------------
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ------------------------------------------------------------
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              ------------------------------------------------------------
Echinops_telfairi|2788             ------------------------------------------------------------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------------------------------------------------------------
Vicugna_pacos|12004                ------------------------------------------------------------
Dasypus_novemcinctus|12376         ------------------------------------------------------------
Myotis_lucifugus|13996             ------------------------------------------------------------
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          ------------------------------------------------------------
Gallus_gallus|8478                 ------------------------------------------------------------
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------------------------------------------
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   ------------------------------------------------------------
Loxodonta_africana|20466           ------------------------------------------------------------
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ------------------------------------------------------------
Microcebus_murinus|8758            ------------------------------------------------------------
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ------------------------------------------------------------
Mus_musculus|35474                 ------------------------------------------------------------
Rattus_norvegicus|25044            ------------------------------------------------------------
Cavia_porcellus|16884              ------------------------------------------------------------
Callithrix_jacchus|16234           ------------------------------------------------------------
Gorilla_gorilla|27910              ------------------------------------------------------------
Pongo_abelii|25321                 ------------------------------------------------------------
Pan_troglodytes|33528              ------------------------------------------------------------
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ------------------------------------------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------------------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ------------------------------------------------------------
Erinaceus_europaeus|11556          ------------------------------------------------------------
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ------------------------------------------------------------
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ------------------------------------------------------------
Oryzias_latipes|10889              ------------------------------------------------------------
Gasterosteus_aculeatus|1240        ------------------------------------------------------------
Tetraodon_nigroviridis|12063       ------------------------------------------------------------
Fugu_rubripes|12054                ------------------------------------------------------------
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------------------------------------------
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------------------------------------------------------
Taeniopygia_guttata|13478          ------------------------------------------------------------
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------------------------------------------
Rattus_norvegicus|22026            ------------------------------------------------------------
Ornithorhynchus_anatinus|23474     ------------------------------------------------------------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------------------------------------
Echinops_telfairi|12695            ------------------------------------------------------------
Cavia_porcellus|12568              ------------------------------------------------------------
Bos_taurus|11426                   ------------------------------------------------------------
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------------------------------------------
Callithrix_jacchus|22501           ------------------------------------------------------------
Rhesus_macaque|9284                ------------------------------------------------------------
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------------------------------
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------------------------------------------------------
Bombyx_mori|1440                   ------------------------------------------------------------
Culex_quinquefasciatus|8347        ------------------------------------------------------------
Drosophila_willistoni|6759         ------------------------------------------------------------
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          ------------------------------------------------------------
Pediculus_humanus|1518             ------------------------------------------------------------
Nematostella_vectensis|14687       ------------------------------------------------------------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------------------------------------------
Tarsius_syrichta|890               ------------------------------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ------------------------------------------------------------
Oryzias_latipes|7013               ------------------------------------------------------------
Fugu_rubripes|14746                TCACTAATCCATTTTGCTCCTGAGTCAGACCTGGTCAGAGTGCTTCAGCTGCTTCCGCGC
Tetraodon_nigroviridis|16104       ------------------------------------------------------------
Spermophilus_tridecemlineatus|2344 ------------------------------------------------------------
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ------------------------------------------------------------
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              ------------------------------------------------------------
Echinops_telfairi|2788             ------------------------------------------------------------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------------------------------------------------------------
Vicugna_pacos|12004                ------------------------------------------------------------
Dasypus_novemcinctus|12376         ------------------------------------------------------------
Myotis_lucifugus|13996             ------------------------------------------------------------
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          ------------------------------------------------------------
Gallus_gallus|8478                 ------------------------------------------------------------
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------------------------------------------
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   ------------------------------------------------------------
Loxodonta_africana|20466           ------------------------------------------------------------
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ------------------------------------------------------------
Microcebus_murinus|8758            ------------------------------------------------------------
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ------------------------------------------------------------
Mus_musculus|35474                 ------------------------------------------------------------
Rattus_norvegicus|25044            ------------------------------------------------------------
Cavia_porcellus|16884              ------------------------------------------------------------
Callithrix_jacchus|16234           ------------------------------------------------------------
Gorilla_gorilla|27910              ------------------------------------------------------------
Pongo_abelii|25321                 ------------------------------------------------------------
Pan_troglodytes|33528              ------------------------------------------------------------
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ------------------------------------------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------------------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ------------------------------------------------------------
Erinaceus_europaeus|11556          ------------------------------------------------------------
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ------------------------------------------------------------
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ------------------------------------------------------------
Oryzias_latipes|10889              ------------------------------------------------------------
Gasterosteus_aculeatus|1240        ------------------------------------------------------------
Tetraodon_nigroviridis|12063       ------------------------------------------------------------
Fugu_rubripes|12054                ------------------------------------------------------------
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------------------------------------------
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------------------------------------------------------
Taeniopygia_guttata|13478          ------------------------------------------------------------
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------------------------------------------
Rattus_norvegicus|22026            ------------------------------------------------------------
Ornithorhynchus_anatinus|23474     ------------------------------------------------------------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------------------------------------
Echinops_telfairi|12695            ------------------------------------------------------------
Cavia_porcellus|12568              ------------------------------------------------------------
Bos_taurus|11426                   ------------------------------------------------------------
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------------------------------------------
Callithrix_jacchus|22501           ------------------------------------------------------------
Rhesus_macaque|9284                ------------------------------------------------------------
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------------------------------
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------------------------------------------------------
Bombyx_mori|1440                   ------------------------------------------------------------
Culex_quinquefasciatus|8347        ------------------------------------------------------------
Drosophila_willistoni|6759         ------------------------------------------------------------
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          ------------------------------------------------------------
Pediculus_humanus|1518             ------------------------------------------------------------
Nematostella_vectensis|14687       ------------------------------------------------------------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------------------------------------------
Tarsius_syrichta|890               ------------------------------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ------------------------------------------------------------
Oryzias_latipes|7013               ------------------------------------------------------------
Fugu_rubripes|14746                TGGGCTGTTCTGTCTCCCCTCTGTAACTTTCCTCAGAGGAGATGGAGTGTCTGTGGGAAC
Tetraodon_nigroviridis|16104       ------------------------------------------------------------
Spermophilus_tridecemlineatus|2344 ------------------------------------------------------------
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ------------------------------------------------------------
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              ------------------------------------------------------------
Echinops_telfairi|2788             ------------------------------------------------------------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------------------------------------------------------------
Vicugna_pacos|12004                ------------------------------------------------------------
Dasypus_novemcinctus|12376         ------------------------------------------------------------
Myotis_lucifugus|13996             ------------------------------------------------------------
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          ------------------------------------------------------------
Gallus_gallus|8478                 ------------------------------------------------------------
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------------------------------------------
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   ------------------------------------------------------------
Loxodonta_africana|20466           ------------------------------------------------------------
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ------------------------------------------------------------
Microcebus_murinus|8758            ------------------------------------------------------------
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ------------------------------------------------------------
Mus_musculus|35474                 ------------------------------------------------------------
Rattus_norvegicus|25044            ------------------------------------------------------------
Cavia_porcellus|16884              ------------------------------------------------------------
Callithrix_jacchus|16234           ------------------------------------------------------------
Gorilla_gorilla|27910              ------------------------------------------------------------
Pongo_abelii|25321                 ------------------------------------------------------------
Pan_troglodytes|33528              ------------------------------------------------------------
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ------------------------------------------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------------------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ------------------------------------------------------------
Erinaceus_europaeus|11556          ------------------------------------------------------------
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ------------------------------------------------------------
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ------------------------------------------------------------
Oryzias_latipes|10889              ------------------------------------------------------------
Gasterosteus_aculeatus|1240        ------------------------------------------------------------
Tetraodon_nigroviridis|12063       ------------------------------------------------------------
Fugu_rubripes|12054                ------------------------------------------------------------
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------------------------------------------
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------------------------------------------------------
Taeniopygia_guttata|13478          ------------------------------------------------------------
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------------------------------------------
Rattus_norvegicus|22026            ------------------------------------------------------------
Ornithorhynchus_anatinus|23474     ------------------------------------------------------------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------------------------------------
Echinops_telfairi|12695            ------------------------------------------------------------
Cavia_porcellus|12568              ------------------------------------------------------------
Bos_taurus|11426                   ------------------------------------------------------------
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------------------------------------------
Callithrix_jacchus|22501           ------------------------------------------------------------
Rhesus_macaque|9284                ------------------------------------------------------------
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------------------------------
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------------------------------------------------------
Bombyx_mori|1440                   ------------------------------------------------------------
Culex_quinquefasciatus|8347        ------------------------------------------------------------
Drosophila_willistoni|6759         ------------------------------------------------------------
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          ------------------------------------------------------------
Pediculus_humanus|1518             ------------------------------------------------------------
Nematostella_vectensis|14687       ------------------------------------------------------------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------------------------------------------
Tarsius_syrichta|890               ------------------------------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ------------------------------------------------------------
Oryzias_latipes|7013               ------------------------------------------------------------
Fugu_rubripes|14746                CCGACCGGGCCGCTGTGGAGGCtgaagaaaacagaggaggTCTGGGAGGAGCTGATCACC
Tetraodon_nigroviridis|16104       ------------------------------------------------------------
Spermophilus_tridecemlineatus|2344 ------------------------------------------------------------
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ------------------------------------------------------------
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              ------------------------------------------------------------
Echinops_telfairi|2788             ------------------------------------------------------------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------------------------------------------------------------
Vicugna_pacos|12004                ------------------------------------------------------------
Dasypus_novemcinctus|12376         ------------------------------------------------------------
Myotis_lucifugus|13996             ------------------------------------------------------------
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          ------------------------------------------------------------
Gallus_gallus|8478                 ------------------------------------------------------------
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------------------------------------------
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   ------------------------------------------------------------
Loxodonta_africana|20466           ------------------------------------------------------------
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ------------------------------------------------------------
Microcebus_murinus|8758            ------------------------------------------------------------
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ------------------------------------------------------------
Mus_musculus|35474                 ------------------------------------------------------------
Rattus_norvegicus|25044            ------------------------------------------------------------
Cavia_porcellus|16884              ------------------------------------------------------------
Callithrix_jacchus|16234           ------------------------------------------------------------
Gorilla_gorilla|27910              ------------------------------------------------------------
Pongo_abelii|25321                 ------------------------------------------------------------
Pan_troglodytes|33528              ------------------------------------------------------------
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ------------------------------------------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------------------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ------------------------------------------------------------
Erinaceus_europaeus|11556          ------------------------------------------------------------
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ------------------------------------------------------------
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ------------------------------------------------------------
Oryzias_latipes|10889              ------------------------------------------------------------
Gasterosteus_aculeatus|1240        ------------------------------------------------------------
Tetraodon_nigroviridis|12063       ------------------------------------------------------------
Fugu_rubripes|12054                ------------------------------------------------------------
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------------------------------------------
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------------------------------------------------------
Taeniopygia_guttata|13478          ------------------------------------------------------------
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------------------------------------------
Rattus_norvegicus|22026            ------------------------------------------------------------
Ornithorhynchus_anatinus|23474     ------------------------------------------------------------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------------------------------------
Echinops_telfairi|12695            ------------------------------------------------------------
Cavia_porcellus|12568              ------------------------------------------------------------
Bos_taurus|11426                   ------------------------------------------------------------
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------------------------------------------
Callithrix_jacchus|22501           ------------------------------------------------------------
Rhesus_macaque|9284                ------------------------------------------------------------
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------------------------------
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------------------------------------------------------
Bombyx_mori|1440                   ------------------------------------------------------------
Culex_quinquefasciatus|8347        ------------------------------------------------------------
Drosophila_willistoni|6759         ------------------------------------------------------------
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          ------------------------------------------------------------
Pediculus_humanus|1518             ------------------------------------------------------------
Nematostella_vectensis|14687       ------------------------------------------------------------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------------------------------------------
Tarsius_syrichta|890               ------------------------------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ------------------------------------------------------------
Oryzias_latipes|7013               ------------------------------------------------------------
Fugu_rubripes|14746                CACAAGGCTAGAAGACATGAGAGGAAGCGTCAGGAGCTGCTGGCTTTGGCTCTGGGAGTC
Tetraodon_nigroviridis|16104       ------------------------------------------------------------
Spermophilus_tridecemlineatus|2344 ------------------------------------------------------------
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ------------------------------------------------------------
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              ------------------------------------------------------------
Echinops_telfairi|2788             ------------------------------------------------------------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------------------------------------------------------------
Vicugna_pacos|12004                ------------------------------------------------------------
Dasypus_novemcinctus|12376         ------------------------------------------------------------
Myotis_lucifugus|13996             ------------------------------------------------------------
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          ------------------------------------------------------------
Gallus_gallus|8478                 ------------------------------------------------------------
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------------------------------------------
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   ------------------------------------------------------------
Loxodonta_africana|20466           ------------------------------------------------------------
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ------------------------------------------------------------
Microcebus_murinus|8758            ------------------------------------------------------------
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ------------------------------------------------------------
Mus_musculus|35474                 ------------------------------------------------------------
Rattus_norvegicus|25044            ------------------------------------------------------------
Cavia_porcellus|16884              ------------------------------------------------------------
Callithrix_jacchus|16234           ------------------------------------------------------------
Gorilla_gorilla|27910              ------------------------------------------------------------
Pongo_abelii|25321                 ------------------------------------------------------------
Pan_troglodytes|33528              ------------------------------------------------------------
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ------------------------------------------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------------------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ------------------------------------------------------------
Erinaceus_europaeus|11556          ------------------------------------------------------------
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ------------------------------------------------------------
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ------------------------------------------------------------
Oryzias_latipes|10889              ------------------------------------------------------------
Gasterosteus_aculeatus|1240        ------------------------------------------------------------
Tetraodon_nigroviridis|12063       ------------------------------------------------------------
Fugu_rubripes|12054                ------------------------------------------------------------
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------------------------------------------
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------------------------------------------------------
Taeniopygia_guttata|13478          ------------------------------------------------------------
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------------------------------------------
Rattus_norvegicus|22026            ------------------------------------------------------------
Ornithorhynchus_anatinus|23474     ------------------------------------------------------------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------------------------------------
Echinops_telfairi|12695            ------------------------------------------------------------
Cavia_porcellus|12568              ------------------------------------------------------------
Bos_taurus|11426                   ------------------------------------------------------------
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------------------------------------------
Callithrix_jacchus|22501           ------------------------------------------------------------
Rhesus_macaque|9284                ------------------------------------------------------------
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------------------------------
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------------------------------------------------
Daphnia_pulex|23786                ------------------------------------------------------------
Tribolium_castaneum|7722           ------------------------------------------------------------
Bombyx_mori|1440                   ------------------------------------------------------------
Culex_quinquefasciatus|8347        ------------------------------------------------------------
Drosophila_willistoni|6759         ------------CAGCAGCAGCAACAACAACAACAACAATCCGAGTCTGCACAGCCTCAG
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          ------------------------------------------------------------
Pediculus_humanus|1518             ------------------------------------------------------------
Nematostella_vectensis|14687       ------------------------------------------------------------
Callithrix_jacchus|17478           ------------------------------------------------------------
Otolemur_garnettii|5617            ------------------------------------------------------------
Tarsius_syrichta|890               ------------------------------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ------------------------------------------------------------
Oryzias_latipes|7013               ------------------------------------------------------------
Fugu_rubripes|14746                AAACTGGGAAGCAAGGGGACGATTTTGTGGAAGCCTATTAAACTGTTGGCCTCCTGTCCA
Tetraodon_nigroviridis|16104       ------------------------------------------------------------
Spermophilus_tridecemlineatus|2344 ------------------------------------------------------------
Danio_rerio|9306                   ------------------------------------------------------------
Choloepus_hoffmanni|11191          ------------------------------------------------------------
Felis_catus|38196                  ------------------------------------------------------------
Dipodomys_ordii|13518              ------------------------------------------------------------
Echinops_telfairi|2788             ------------------------------------------------------------
Xenopus_tropicalis|20641           ------------------------------------------------------------
Erinaceus_europaeus|7699           ------------------------------------------------------------
Vicugna_pacos|12004                ------------------------------------------------------------
Dasypus_novemcinctus|12376         ------------------------------------------------------------
Myotis_lucifugus|13996             ------------------------------------------------------------
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          ------------------------------------------------------------
Gallus_gallus|8478                 ------------------------------------------------------------
Monodelphis_domestica|32218        ------------------------------------------------------------
Ornithorhynchus_anatinus|18048     ------------------------------------------------------------
Tursiops_truncatus|17458           ------------------------------------------------------------
Bos_taurus|20383                   ------------------------------------------------------------
Loxodonta_africana|20466           ------------------------------------------------------------
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ------------------------------------------------------------
Microcebus_murinus|8758            ------------------------------------------------------------
Sus_scrofa|9306                    ------------------------------------------------------------
Tupaia_belangeri|17337             ------------------------------------------------------------
Mus_musculus|35474                 ------------------------------------------------------------
Rattus_norvegicus|25044            ------------------------------------------------------------
Cavia_porcellus|16884              ------------------------------------------------------------
Callithrix_jacchus|16234           ------------------------------------------------------------
Gorilla_gorilla|27910              ------------------------------------------------------------
Pongo_abelii|25321                 ------------------------------------------------------------
Pan_troglodytes|33528              ------------------------------------------------------------
Rhesus_macaque|26807               ------------------------------------------------------------
Canis_familiaris|5395              ------------------------------------------------------------
Pteropus_vampyrus|4823             ------------------------------------------------------------
Equus_caballus|20466               ------------------------------------------------------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ------------------------------------------------------------
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ------------------------------------------------------------
Tupaia_belangeri|12767             ------------------------------------------------------------
Erinaceus_europaeus|11556          ------------------------------------------------------------
Tarsius_syrichta|9123              ------------------------------------------------------------
Pteropus_vampyrus|10445            ------------------------------------------------------------
Felis_catus|45196                  ------------------------------------------------------------
Spermophilus_tridecemlineatus|4303 ------------------------------------------------------------
Procavia_capensis|2688             ------------------------------------------------------------
Dasypus_novemcinctus|1164          ------------------------------------------------------------
Otolemur_garnettii|929             ------------------------------------------------------------
Oryzias_latipes|10889              ------------------------------------------------------------
Gasterosteus_aculeatus|1240        ------------------------------------------------------------
Tetraodon_nigroviridis|12063       ------------------------------------------------------------
Fugu_rubripes|12054                ------------------------------------------------------------
Microcebus_murinus|15358           ------------------------------------------------------------
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ------------------------------------------------------------
Cavia_porcellus|24636              ------------------------------------------------------------
Rattus_norvegicus|16671            ------------------------------------------------------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ------------------------------------------------------------
Taeniopygia_guttata|13478          ------------------------------------------------------------
Dipodomys_ordii|1968               ------------------------------------------------------------
Mus_musculus|22308                 ------------------------------------------------------------
Rattus_norvegicus|22026            ------------------------------------------------------------
Ornithorhynchus_anatinus|23474     ------------------------------------------------------------
Pan_troglodytes|24690              ------------------------------------------------------------
Monodelphis_domestica|19121        ------------------------------------------------------------
Echinops_telfairi|12695            ------------------------------------------------------------
Cavia_porcellus|12568              ------------------------------------------------------------
Bos_taurus|11426                   ------------------------------------------------------------
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 ------------------------------------------------------------
Gorilla_gorilla|11189              ------------------------------------------------------------
Homo_sapiens|48422                 ------------------------------------------------------------
Callithrix_jacchus|22501           ------------------------------------------------------------
Rhesus_macaque|9284                ------------------------------------------------------------
Canis_familiaris|20431             ------------------------------------------------------------
Choloepus_hoffmanni|3438           ------------------------------------------------------------
Loxodonta_africana|14241           ------------------------------------------------------------
Sorex_araneus|10550                ------------------------------------------------------------
Tursiops_truncatus|357             ------------------------------------------------------------
                                                                                               

Ixodes_scapularis|17566            ---------CACTCGTACCAGCGCCAGCTGAGGCAGAAG---------------------
Caenorhabditis_elegans|9662        ---------TCAGACATTGTACGCCGTCCCGTCACTCGA---------------------
Daphnia_pulex|23786                ---------CCTGCCCTTGTTCAGCCGATCTCAGACGAC---------------------
Tribolium_castaneum|7722           ---------------------------------------------TTAGGGCCCAATTTT
Bombyx_mori|1440                   ---------AAGCCAATCTGCGAACTCACTCCCACTATA------GAAAATAATCCATTA
Culex_quinquefasciatus|8347        ---------AACGATTTGACCGCAAAGCTTATAGACGAT------GCTGACGATGAATTA
Drosophila_willistoni|6759         GCGACGCAGGCGGGTCTGAGAATACGTAAGAGCCTTGCC---TTGGATGCGGATCCCATG
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ---------CAGGAGGAGCCACCGCCTCCAGCCGTGGAT---------------CCCATG
Drosophila_simulans|12658          ---------CAGGAGGAGCCACCGCCTCCTGCCGTGGAT---------------CCCATG
Pediculus_humanus|1518             ------------------------AAAAATTCATTAAAC---------------GAAGAA
Nematostella_vectensis|14687       ------------AGTGCTAGCAAGCGACCTAGCGTGAAA---------------------
Callithrix_jacchus|17478           ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Otolemur_garnettii|5617            ---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---NNNNNN
Tarsius_syrichta|890               ---------TCCTCCCTGGTTCGAAGGGCAGCCCTCACA------CACAAC---GACAAC
Macropus_eugenii|10045             ---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---NNNNNN
Gasterosteus_aculeatus|27934       ------TCATCACCTCTAGTGCGACGGAGTGCCTTGAAA------GATACGCCGGAGAAG
Oryzias_latipes|7013               ------TCCTCCCCTTTGCTGAGAAGGAGTGCCCTGAAG------GACACCCCTGAGAAG
Fugu_rubripes|14746                CAGATTGCCTCACCTCTTGTGCGTCGCACCGTCTTGAAA------GATGCTCCGGAAAAG
Tetraodon_nigroviridis|16104       ---------TCACCGCTGGTGCGACGGACCGTGTTGAAA------GACGCTCCAGAAAAG
Spermophilus_tridecemlineatus|2344 ---------TCCTCCCTGGTTCGAAGGGCTGCCCTCACA------CACAAA---GACAAC
Danio_rerio|9306                   ATCAGCCCATCGCCGCTGAGCAGACGGACCACACTCAAA------GATGGACCAGAGAAA
Choloepus_hoffmanni|11191          ---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---NNNNNN
Felis_catus|38196                  ---------TCGTCCCTGGTCCGAAGGGCCGCCCTCACG------CACAAC---GACAAC
Dipodomys_ordii|13518              ---------TCCTCCCTGGTTCGAAGGGCTGCCCTCACA------CACAAC---GACAAC
Echinops_telfairi|2788             ---------TCCTCCCTGGTGCGAAGGGCCGCCCTCACG------CACAAC---GACAAC
Xenopus_tropicalis|20641           ---------ACTTCTCTGGTCCGAAGAGCAGCAATAGCC------AAAAAT---GACAAC
Erinaceus_europaeus|7699           ---------AAGATCTCCCTGCGAAGAGCTCTCACGCAC---------------GACAAC
Vicugna_pacos|12004                ---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---NNNNNN
Dasypus_novemcinctus|12376         ---------TCCTCCCTGGTGCGAAGGGCTGCCCTCACC------CACAAC---GACAAC
Myotis_lucifugus|13996             ---------TCCTCCCTGGTCAGGAGGGCCGCCCTCACG------CACAAC---GACAAC
Ochotona_princeps|1540             ---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---NNNNNN
Anolis_carolinensis|11713          ---------ACATCTTTGGTCCGGAGAGCTGCGTTAACA------CAAAAT---GACAAC
Gallus_gallus|8478                 ---------ACCTCCTTGGTCCGAAGAGCAGCCTTAACT------CAAAAC---GACAAC
Monodelphis_domestica|32218        ---------TCCTCCCTGGTGCGGAGAGCAGCCCTCGCG------CAGAAT---GACAAC
Ornithorhynchus_anatinus|18048     ---------ACCTCCCTGGTCAGAAGAGCAGCTCTAACG------CAAAAC---GACAAC
Tursiops_truncatus|17458           ---------TCCTCCCTGGTCCGAAGGGCCGCCCTCTCA------CACAAC---GACAAC
Bos_taurus|20383                   ---------GTTTCCCTTATCTTAAGGACTGCTTTGCAT------CATAAA---GACGAT
Loxodonta_africana|20466           ---------TCCTCCCTGGTTCGAAGAGCCGCCCTCACG------CACAAC---GACAAC
Procavia_capensis|1128             ---------TCCTCCCTGGTTCGAAGGGCCGCCCTTACT------CACAAC---GACAAC
Sorex_araneus|13650                ---------TCGTCCCTGGTCCGAAGGGCCGCCCTCACG------CCAAAT---GACAAC
Microcebus_murinus|8758            ---------TCCTCCCTGGTTCGAAGGGCAGCCCTCACA------CACAAT---GACAAC
Sus_scrofa|9306                    ---------TCCTCCCTGGTCCGAAGGGCCGCCCTCACA------CACCAC---GACAAC
Tupaia_belangeri|17337             ---------TCCTCCTTGGTTCGAAGGGCTGCACTCACC------CACAAT---GACAAC
Mus_musculus|35474                 ---------TCTTCACTGGTCCGAAGAGCTGCCCTCACA------CACAAC---GACAAC
Rattus_norvegicus|25044            ---------TCTTCACTGGTCCGAAGAGCTGCCCTCACA------CACAAT---GACAAC
Cavia_porcellus|16884              ---------TCCTCCTTGGTTCGAAGGGCTGCCCTTACA------CACAGC---GACAAC
Callithrix_jacchus|16234           ---------TCCTCCCTGGTTCGAAGGGCAGCCCTCACA------CACAAC---GACAAC
Gorilla_gorilla|27910              ---------TCCTCCCTGGTTCGAAGGGCTGCCCTCACA------CACAAC---GACAAC
Pongo_abelii|25321                 ---------TCCTCCCTGGTTCGAAGGGCAGCCCTCACA------CACAAC---GACAAC
Pan_troglodytes|33528              ---------TCCTCCCTGGTTCGAAGGGCTGCCCTCACA------CACAAC---GACAAC
Rhesus_macaque|26807               ---------TCCTCCCTGGTTCGAAGGGCAGCCCTCACA------CACAAC---GACAAC
Canis_familiaris|5395              ---------TCGTCCCTGGTCCGAAGGGCCGCCCTCACG------CACAAC---GACAAC
Pteropus_vampyrus|4823             ---------TCCTCCCTCGTCCGGAGGGCCGCCCTCACG------CACAAC---GACAAC
Equus_caballus|20466               ---------TCCTCCCTGGTCCGCAGGGCCGCCCTCACG------CACAAC---GACAAC
Sus_scrofa|7275                    ---------CGATGCCTTTATAAAAAGCTGTCCAAGAAGGAAATGCATAAA---GAACAA
Macropus_eugenii|8027              ---------ACATCCCTCGTTAGAAGAGCAACTCTGAAA------GAAAAT---GAGCAG
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            ---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---NNNNNN
Tupaia_belangeri|12767             ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Erinaceus_europaeus|11556          ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Tarsius_syrichta|9123              ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Pteropus_vampyrus|10445            ---------ACATCACTTGTTAGAAGAGCAACTCTGGAA---------AAC---GAGCAA
Felis_catus|45196                  ---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---NNNNNN
Spermophilus_tridecemlineatus|4303 ---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---NNNNNN
Procavia_capensis|2688             ---------ACTTCACTTGTTAGAAGAGCAACTCTGAAA------GAGAAC---GAGCAA
Dasypus_novemcinctus|1164          ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAT---GAGCAG
Otolemur_garnettii|929             ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Oryzias_latipes|10889              ---------ACATCGCTGGTGCGGCGGGCGACCCTGAGG------GAGAGC---GACCTG
Gasterosteus_aculeatus|1240        ---------ACGGCGCTGGTGCGGCGGGCCACCCTGAGG------GAGAGC---GACTTG
Tetraodon_nigroviridis|12063       ---------TCGTCGCTGGTGCGCAGGTCCACCCTCAAG------GAGAGC---GATTTG
Fugu_rubripes|12054                ---------ACATCGCTGGTGCGGAGGTCCACCCTGAGG------GAGAGC---GATTTG
Microcebus_murinus|15358           ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Danio_rerio|31268                  ------------------------------------------------------------
Xenopus_tropicalis|6414            ---------ACCTCTCTCGTACGAAGAGCGACGTTAAAG------GAGAAT---GAACAG
Cavia_porcellus|24636              ---------ACATCACTTGTTAGAAGAGCAAATCTGAAA------GAAAAT---AAACAA
Rattus_norvegicus|16671            ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAT---GAACAA
Myotis_lucifugus|15927             ---------ACATCACNNNNNNNNNNNNNNNNNNNNNNN------NNNNNN---NNNNNN
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                ---------ACATCGCTTGTCAGAAGAGCGACGCTGAAA------GAAAAC---GAGCAT
Taeniopygia_guttata|13478          ---------ACGTCGCTCGTCCGAAGAGCAACTCTGAAG------GAAAAT---GAACAC
Dipodomys_ordii|1968               ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAT---GAGCAA
Mus_musculus|22308                 ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAT---GAACAA
Rattus_norvegicus|22026            ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAT---GAACAA
Ornithorhynchus_anatinus|23474     ---------ACATCACTCGTTAGAAGAGCAACTCTGAAA------GAAAAT---GAGCAA
Pan_troglodytes|24690              ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Monodelphis_domestica|19121        ---------ACATCCCTCGTTAGAAGAGCAACTCTGAAG------GAAAAT---GAGCAG
Echinops_telfairi|12695            ---------ACATCGCTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Cavia_porcellus|12568              ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAT---GAACAA
Bos_taurus|11426                   ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAACAA
Vicugna_pacos|6873                 ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Pongo_abelii|18313                 ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Gorilla_gorilla|11189              ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Homo_sapiens|48422                 ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Callithrix_jacchus|22501           ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Rhesus_macaque|9284                ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Canis_familiaris|20431             ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Choloepus_hoffmanni|3438           ---------ACATCACTTGTCAGAAGAGCAACTCTGAAA------GAAAAT---GAGCAA
Loxodonta_africana|14241           ---------ACATCACTTGTCAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Sorex_araneus|10550                ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
Tursiops_truncatus|357             ---------ACATCACTTGTTAGAAGAGCAACTCTGAAA------GAAAAC---GAGCAA
                                                                                               

Ixodes_scapularis|17566            ------------------------------------------------------------
Caenorhabditis_elegans|9662        ------------------GCACACAACTTCACGTCGTACACCTTCAAAGCTCCGCACTAC
Daphnia_pulex|23786                ---ATTCATTATGACAAAGCCCATGACTTTCGAATCCAAAACTTCAAAGGCTTGCATTGG
Tribolium_castaneum|7722           CCAGAGAAATATGAAAAACAACACGCGTTTAAATTGACAACGTTTAAGGGGCTTAATTGG
Bombyx_mori|1440                   GTCATTAAATACTCAAAATCACACAATTTTCGTGTCCACACGTTCAAAGGGCTAAACTGG
Culex_quinquefasciatus|8347        TTAGAAGCTTACGAAAAGAGTCATGTTTTTAAGACACGCACCTTTAAAGGGCTGAATTGG
Drosophila_willistoni|6759         CCATTGATCTATGAGAAAGTGCATAACTTTAAGGTGCACACCTTCAAGGGTCTCAATTGG
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      CCGCTGGTCTACGAGAAGCCGCATCACTTCAAGGTGCACACGTTTAAGGGGCTCAATTGG
Drosophila_simulans|12658          CCGCTGGTCTACGAGAAGCCGCATCACTTCAAGGTGCACACGTTTAAGGGGCTTAACTGG
Pediculus_humanus|1518             ATCTGT---------AAAAATCATTCATTTAAAGTTCATAATTTCAAAGGATTGAATTGG
Nematostella_vectensis|14687       CCGTCAGCATACACGAAAGCGCATAACTTTAAGACGAACACTTTCAAGGGTCCTCATTGG
Callithrix_jacchus|17478           ATTCCAAAG---GAAAAGGTTCCCAATTTCAAGGTCCATGCATCAGGAGGGCCATGCTGG
Otolemur_garnettii|5617            NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCACACATTTCGAGGCCCACACTGG
Tarsius_syrichta|890               CACTTCAACTATGAGAAGACACACAACTTTAAGGTCCACACATTCCGAGGCCCACACTGG
Macropus_eugenii|10045             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCACACGTTCCGGGGACCGCACTGG
Gasterosteus_aculeatus|27934       CAGTGCTCATACGAGAAGATACACAATTTTAAGGTACACACCTTTCGAGGGCCACACTGG
Oryzias_latipes|7013               CAGTGCTCCTACGAAAAGATCCACAACTTTAAGGTACACACCTTTCGAGGGCCGCACTGG
Fugu_rubripes|14746                CAGTGCTCCTATGAGAAGATGCACAACTTCAAGGTACACACCTTTCGAGGGCCACACTGG
Tetraodon_nigroviridis|16104       CAGTGCTCCTATGAGAAGATACACAACTTTAAGGTACACACGTTTCGAGGGCCACACTGG
Spermophilus_tridecemlineatus|2344 CACTTCAACTATGAGAAGACATACAAATTCAAGGTCCACACATTCCGAGGCCCGCACTGG
Danio_rerio|9306                   CACTGTAACTATGAGAAGATACACAACTTTAAGGTGCACACGTTCAGGGGGCCGCACTGG
Choloepus_hoffmanni|11191          NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Felis_catus|38196                  CACTTCAACTATGAGAAGACACACAACTTCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNN
Dipodomys_ordii|13518              CATTTCAACTATGAGAAGACACACAACTTCAAGGTCCATACATTCCGAGGCCCTCACTGG
Echinops_telfairi|2788             CACTTCAACTACGAAAAGACACACAACTTCAAGGTGCACACATTCCGAGGCCCACACTGG
Xenopus_tropicalis|20641           CATTTCAACTACGAGAAAGCACACAACTTCAAGGTTCACACGTTCCGGGGGCCACACTGG
Erinaceus_europaeus|7699           CACTACAACTATGAGAAGATGCACAACTTTAAGGTCCACACCTTCCGAGGTCCACACTGG
Vicugna_pacos|12004                NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCACACTTTCCGAGGCCCGCACTGG
Dasypus_novemcinctus|12376         CACTTCAACTATGAGAAGACACACAACTTTAAGGTGCACACGTTCCGAGGCCCGCACTGG
Myotis_lucifugus|13996             CACTTCAACTATGAGAAGACACACAACTTTAAGNNNNNNNNNNNNNNNNNNNNNNNNNNN
Ochotona_princeps|1540             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCACACATTCCGAGGCCCACACTGG
Anolis_carolinensis|11713          TATTTCAACTATGAAAAAGCACACAACTTTAAGGTCCATACATTTCGAGGTCCACATTGG
Gallus_gallus|8478                 CATTTCAACTATGAAAAAGCACACAATTTTAAGGTCCACACGTTTCGAGGTCCACACTGG
Monodelphis_domestica|32218        CACTGCAACTATGAGAAGACCCACAACTTCAAGGTCCACACGTTCCGGGGGCCGCACTGG
Ornithorhynchus_anatinus|18048     CACTTCAATTATGAAAAAACACATAACTTTAAGGTCCACACATTTCGAGGACCACATTGG
Tursiops_truncatus|17458           CACTTCAACTATGAGAAGACACACAACTTTAAGGTCCACACGTTCCGAGGCCCGCACTGG
Bos_taurus|20383                   CATTTCNACTATGAGAAGACACACAACTTTAAGGTCCACACATTCCGAGGCCCGCACTGG
Loxodonta_africana|20466           CACTTCAACTATGAAAAGACACACAACTTCAAGGTCCACACATTCCGAGGCCCGCACTGG
Procavia_capensis|1128             CACTTCAACTATGAAAAGACACACAACTTCAAGGTCCACACCTTCCGAGGCCCACACTGG
Sorex_araneus|13650                CACTTCAACTATGAGAAGACGCACAACTTTAAGGTCCACACATTCCGAGGTCCACACTGG
Microcebus_murinus|8758            CACTTCAACTATGAGAAGACACACAACTTCAAGGTTCACACATTCCGAGGCCCACACTGG
Sus_scrofa|9306                    CACTTCAACTATGAGAAGACACACAACTTTAAGGTCCACACGTTCCGAGGCCCGCACTGG
Tupaia_belangeri|17337             CACTTCAACTATGAGAAGACACACAACTTCAAGGTCCATACGTTCCGAGGCCCGCACTGG
Mus_musculus|35474                 CACTTCAACTATGAGAAGACACACAACTTCAAGGTGCACACATTCCGGGGCCCACACTGG
Rattus_norvegicus|25044            CACTTCAACTATGAGAAGACACACAACTTCAAGGTGCACACATTTCGGGGCCCACACTGG
Cavia_porcellus|16884              CACTTCAACTATGAGAAGACACACAACTTCAAGGTCCACACGTTCCGAGGCCCACACTGG
Callithrix_jacchus|16234           CACTTCAACTACGAGAAGACACACAACTTTAAGGTCCACACATTCCGAGGCCCACATTGG
Gorilla_gorilla|27910              CACTTCAATTATGAGAAGACACACAACTTTAAGGTCCACACGTTCCGAGGCCCACACTGG
Pongo_abelii|25321                 CACTTCAACTATGAGAAGACACACAACTTTAAGGTCCACACGTTCCGAGGCCCACATTGG
Pan_troglodytes|33528              CACTTCAATTATGAGAAGACACACAACTTTAAGGTCCACACGTTCCGAGGCCCACATTGG
Rhesus_macaque|26807               CACTTCAACTATGAGAAGACACACAACTTTAAGGTCCACACGTTCCGAGGCCCACATTGG
Canis_familiaris|5395              CACTTCAACTACGAGAAGACCCACAACTTCAAGGTCCATACATTCCGAGGCCCGCACTGG
Pteropus_vampyrus|4823             CACTTC---TATGAGACA------CACTTCAAGGTGCACACATTCCGAGGCCCGCACTGG
Equus_caballus|20466               CACTTCAACTATGAGAAGACACACAACTTTAAGGTCCACACGTTCCGAGGCCCACACTGG
Sus_scrofa|7275                    TTTCCTAAAGATTGTGTTCTGAGATTCTTTAATGTCCATACATTCAGAGGGCCACACTGG
Macropus_eugenii|8027              ATTCCGAAATATGAAAAGGTTCATAATTTCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNN
Branchiostoma_floridae|1548        ------------------------------------------------------------
Ochotona_princeps|13791            NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCACACATTCCGAGGACCACACTGG
Tupaia_belangeri|12767             ATTCCAAAATATGAGAAGGTTCACAATTTCAAGGTCCATACATTCAGA---CCACACTGG
Erinaceus_europaeus|11556          ATTCCCAAATATGAGAAGGTTCACAATTTCAAGNNNNNNNNNNNNNNNNNNNNNNNNNNN
Tarsius_syrichta|9123              ATTCCAAAATATGAAAAGGTTCACAATTTCAAGGTCCATACATTCAGAGGGCCACACTGG
Pteropus_vampyrus|10445            ATTCCAAAATATGAAAAGGTTCACAATTTCAAGGTCCATACATTCAGAGGGCCGCACTGG
Felis_catus|45196                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Spermophilus_tridecemlineatus|4303 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Procavia_capensis|2688             ATTCCAAAATATGAAAAGGTTCACAATTTCAAGGTGCATACATTTAGAGGGCCACACTGG
Dasypus_novemcinctus|1164          ATTCCAAAATATGAAAAGGTACACAATTTCAAGGTCCATACGTTCAGAGGGCCACACTGG
Otolemur_garnettii|929             ATTCCAAAATATGAAAAGGTTCATAATTTCAAGGTCCACACGTTCAGAGGGCCACACTGG
Oryzias_latipes|10889              GCACCCAAATACGAGAAGGTTCACAACTTCAAGGTTCACACATTCAGGGGCCCCCACTGG
Gasterosteus_aculeatus|1240        GCGCCCAAGTACGAGAAGGTCCACAACTTCAAGGTTCATACATTCAGAGGCCCCCACTGG
Tetraodon_nigroviridis|12063       GCACCCAAATACGAGAAGGTTCACAACTTCAAGGTTCATACATTCAGAGGCCCACACTGG
Fugu_rubripes|12054                GCACCCAAATACGAGAAGGTTCACAACTTCAAGGTTCATACATTCAGAGGTCCACACTGG
Microcebus_murinus|15358           ATTCCAAAATATGAAAAGGTTCACAATTTCAAGGTCCATACATTCAGAGGGCCACACTGG
Danio_rerio|31268                  ------------------------------CAGGTGCACACCTTCAGAGGGCCACACTGG
Xenopus_tropicalis|6414            GTTCCCAAGTATGAGAAAGTTCATAATTTCAAGGTGCACACATTCAGGGGCCCTCACTGG
Cavia_porcellus|24636              ATTCCAAAATATGAAAAGGTTCACAATTTCAAGGTCCATACATTCCGAGGGCCACACTGG
Rattus_norvegicus|16671            ATTCCAAAATATGAGAAGGTTCACAATTTCAAGGTTCGTATGTTCCGAGGGTCACACTGG
Myotis_lucifugus|15927             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCCACACGTTCCGAGGGCCACACTGG
Anolis_carolinensis|6157           ------------------------------------------------------------
Gallus_gallus|18740                GTTCCCAAATACGAGAAGATTCATAACTTCAAGGTGCACACGTTCAGGGGCCCGCACTGG
Taeniopygia_guttata|13478          GTTCCAAAATACGAGAAGGTTCATAATTTCAAGGTGCACACGTTCAGGGGCCCGCATTGG
Dipodomys_ordii|1968               ATTCCAAAATATGAAAAGGTTCACAATTTCAAGGTCCATACGTTCCGAGGCCCACACTGG
Mus_musculus|22308                 ATTCCAAAATATGAAAAGGTTCACAATTTCAAGGTGCATACGTTCCGAGGGCCACACTGG
Rattus_norvegicus|22026            ATTCCAAAATATGAGAAGGTTCACAATTTCAAGGTGCATACGTTCCGAGGGCCACACTGG
Ornithorhynchus_anatinus|23474     ATTCCAAAGTACGAAAAGGTTCATAATTTCAAGGTCCATACGTTCAGGGGTCCACACTGG
Pan_troglodytes|24690              ATTCCAAAATATGAAAAGATTCACAATTTCAAGGTGCATACATTCAGAGGGCCACACTGG
Monodelphis_domestica|19121        ATTCCGAAATATGAAAAGGTTCATAATTTCAAGGTCCATACGTTCAGAGGTCCACACTGG
Echinops_telfairi|12695            ATTCCAAAATATGAAAAGATTCACAATTTCAAGGTCCATACCTTCCGAGGGCCGCACTGG
Cavia_porcellus|12568              ATTCCAAAATATGAAAAGGTCCACAATTTCAAGGTCCATACATTCCGAGGGCCACACTGG
Bos_taurus|11426                   ATTCCAAAATATGAAAAGGTCCACAATTTCAAGGTCCACACATTCAGAGGGCCACACTGG
Vicugna_pacos|6873                 ATTCCAAAATATGAAAAGGTTCACAATTTCAAGGTCCACACATTCCGAGGGCCACACTGG
Pongo_abelii|18313                 ATTCCAAAATATGAAAAGATTCACAACTTCAAGGTGCATACATTCAGAGGGCCACACTGG
Gorilla_gorilla|11189              ATTCCAAAATATGAAAAGATTCACAATTTCAAGGTGCATACATTCAGAGGGCCACACTGG
Homo_sapiens|48422                 ATTCCAAAATATGAAAAGATTCACAATTTCAAGGTGCATACATTCAGAGGGCCACACTGG
Callithrix_jacchus|22501           ATTCCAAAATATGAAAAGATTCACAATTTCAAGGTACATACATTCAGAGGGCCACACTGG
Rhesus_macaque|9284                ATTCCAAAATATGAAAAGATTCACAATTTCAAGGTCCATACATTCAGAGGGCCACACTGG
Canis_familiaris|20431             ATTCCAAAATATGAAAAGGTTCACAATTTCAAGGTCCATACATTCCGAGGGCCACACTGG
Choloepus_hoffmanni|3438           ATTCCAAAATATGAAAAGGTTCACAATTTCAAGGTCCATACTTTCAGAGGGCCACACTGG
Loxodonta_africana|14241           ATTCCAAAATATGAAAAGGTTCACAATTTCAAGGTCCATACATTTAGAGGGCCACACTGG
Sorex_araneus|10550                ATTCCCAAGTATGAAAAGGTCCACAATTTCAAGGTCCATACATTCAGGGGGCCACACTGG
Tursiops_truncatus|357             ATTCCAAAATATGAAAAGGTTCACAATTTCAAGGTCCACACATTCAGGGGGCCGCACTGG
                                                                                               

Ixodes_scapularis|17566            ---------------------------------CAGCAGCAGTCCCTGCGCATGCGCCAC
Caenorhabditis_elegans|9662        TGTGATTATTGCCGAAATTTCCTGTGGGGATTGGTGCATCAGGGAATGCGATGCGAGGAC
Daphnia_pulex|23786                TGCGATTTTTGTGGCAATTTTATGTGGGGTATAATTGCCCAAGGAGTTCGATGTGAAGAT
Tribolium_castaneum|7722           TGTGAATTGTGTGGGAATTTTTTGTGGGGCTTTACGTTTCAAGGAAAGAAATGTGATGAT
Bombyx_mori|1440                   TGTGAATTCTGCGCCAATTTTCTATGGGGTTTCACTGCACAGGGAGTGAAATGTGAAGAT
Culex_quinquefasciatus|8347        TGTGAATATTGTGCAAATTTCCTCTGGGGGTTTTCATCGCAAGGAGTTCAGTGCGAAGAT
Drosophila_willistoni|6759         TGTGAGTTTTGTGCAAATTTCCTATGGGGATTCACTGCGCAGGGTGTTAAATGTGAAGCC
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      TGCGAGTTCTGCGCCAACTTCTTGTGGGGATTCACCGCCCAGGGCGTCAAGTGTGAGGCG
Drosophila_simulans|12658          TGCGAGTTCTGCGCCAACTTCTTGTGGGGATTCACCGCCCAGGGTGTCAAGTGTGAGGCG
Pediculus_humanus|1518             TGTGAATTTTGTGGTAATTTTTTATGGGGTTTCACTGCTCAAGGAGTTAAATGTGAAGAT
Nematostella_vectensis|14687       TGCGATCATTGTCGGAACTTTTTATGGGGGCTTACTATGCAGGGGGTTAAGTGTCAAGAC
Callithrix_jacchus|17478           TGTGAAGACTGTGCCATCCTCAGGTGGAGTCTCATTACTCAGGGAGGGAACTGTATGGAC
Otolemur_garnettii|5617            TGTGAATACTGTGCCAATTTCATGTGGGGACTCATCGCCCAAGGGGTCCGGTGCTCAGNN
Tarsius_syrichta|890               TGTGAATACTGTGCCAATTTCATGTGGGGGCTCATCGCCCAAGGGGTCCGGTGCTCAGNN
Macropus_eugenii|10045             TGTGAATACTGCGCCAACTTCATGTGGGGCCTCATTGCGCAGGGAGTCAGGTGCTCAGNN
Gasterosteus_aculeatus|27934       TGCGAGTACTGTGCCAACTTCATGTGGGGCCTCATTGCCCAGGGCGTCCGCTGCTCGGAT
Oryzias_latipes|7013               TGTGAATATTGTGCAAACTTCATGTGGGGCCTCATCGCCCAGGGGGTCCGCTGCTCAGAT
Fugu_rubripes|14746                TGTGAGTACTGCGCCAACTTCATGTGGGGCCTCATCGCACAAGGTGTTCGCTGTTCAGAC
Tetraodon_nigroviridis|16104       TGTGAGTACTGCGCCAACTTCATGTGGGGCCTCATCGCACAGGGCGTTCGCTGTTCAGAC
Spermophilus_tridecemlineatus|2344 TGTGAATACTGTGCAAATTTCATGTGGGGGCTCATCGCCCAAGGAGTCAGGTGCTCAGTT
Danio_rerio|9306                   TGTGAATACTGCGCTAACTTCATGTGGGGTCTCATCGCTCAGGGCGTCCGTTGTTCAGAC
Choloepus_hoffmanni|11191          NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAC
Felis_catus|38196                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAC
Dipodomys_ordii|13518              TGTGAATATTGTGCCAATTTCATGTGGGGGCTGATTGCCCAAGGAGTCCGCTGCTCAGAC
Echinops_telfairi|2788             TGTGAATATTGTGCCAATTTCATGTGGGGACTCATCGCCCAAGGGGTCCAGTGCTCAGAT
Xenopus_tropicalis|20641           TGTGAATACTGTGCCAATTTCATGTGGGGTCTCATTGCTCAGGGAGTCCGTTGCTCAGAC
Erinaceus_europaeus|7699           TGTGAATACTGTGCTAACTTCATGTGGGGGCTCATAGCTCAAGGAGTCCGGTGTTCAGAC
Vicugna_pacos|12004                TGTGAATACTGTGCCAACTTCATGTGGGGGCTCATTGCCCAAGGGGTCCGGTGCTCAGAC
Dasypus_novemcinctus|12376         TGTGAATACTGTGCTAACTTCATGTGGGGACTCATCGCCCAAGGGGTCCGGTGCTCAGAC
Myotis_lucifugus|13996             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAC
Ochotona_princeps|1540             TGTGAATACTGTGCCAACTTCATGTGGGGACTCATTGCCCAGGGCGTCCGATGCTCAGAC
Anolis_carolinensis|11713          TGTGAATATTGTGCCAACTTCATGTGGGGACTCATTGCTCAGGGTGTGAGATGTTCAGAC
Gallus_gallus|8478                 TGTGAATACTGTGCCAACTTCATGTGGGGTCTCATCGCTCAGGGAGTGAGGTGTTCAGAC
Monodelphis_domestica|32218        TGTGAATACTGCGCCAACTTCATGTGGGGACTCATCGCTCAAGGGGTCAGATGCTCAGAT
Ornithorhynchus_anatinus|18048     TGTGAATATTGTGCCAACTTCATGTGGGGCCTCATCGCTCAGGGAGTTAGGTGCTCAGAC
Tursiops_truncatus|17458           TGTGAATACTGCGCCAACTTCATGTGGGGGCTTATCGCCCAAGGAGTCCGATGCTCAGAC
Bos_taurus|20383                   TGTGAGTACTGTGCCAACTTCATGTGGGGGCTCATTGCCCAAGGGGTCCGGTGCTCAGAC
Loxodonta_africana|20466           TGTGAATACTGTGCCAATTTCATGTGGGGACTCATCGCCCAAGGAGTCCAATGCTCAGAC
Procavia_capensis|1128             TGTGAATACTGTGCCAATTTCATGTGGGGACTCATCGCCCAAGGAGTACAGTGCTCAGAT
Sorex_araneus|13650                TGTGAATACTGTGCCAACTTCATGTGGGGGCTCATCGCCCAGGGCGTCCGCTGCTCAGAC
Microcebus_murinus|8758            TGTGAATACTGTGCCAATTTCATGTGGGGGCTCATCGCCCAAGGGGTCCGGTGCTCAGAC
Sus_scrofa|9306                    TGTGAATACTGTGCCAACTTCATGTGGGGCCTCATTGCCCAAGGGGTCCGGTGCTCAGAC
Tupaia_belangeri|17337             TGTGAATACTGTGCCAACTTCATGTGGGGGCTTATCGCCCAAGGGGTCCGGTGCTCAGAC
Mus_musculus|35474                 TGTGAATACTGTGCCAATTTTATGTGGGGGCTCATCGCCCAGGGAGTCCGGTGTTCAGAT
Rattus_norvegicus|25044            TGTGAATACTGTGCCAATTTTATGTGGGGGCTCATCGCCCAGGGAGTCCGGTGTTCAGAT
Cavia_porcellus|16884              TGTGAATACTGTGCCAATTTCATGTGGGGACTCATCGCACAGGGAGTCCGGTGCTCAGAT
Callithrix_jacchus|16234           TGTGAATATTGTGCCAATTTCATGTGGGGGCTCATCGCCCAAGGGGTCCGGTGCTCAGAC
Gorilla_gorilla|27910              TGTGAATATTGTGCCAATTTCATGTGGGGGCTCATCGCCCAAGGGGTCCGGTGCTCAGAC
Pongo_abelii|25321                 TGTGAATATTGTGCCAATTTCATGTGGGGGCTCATCGCCCAAGGGGTCCGGTGCTCAGAC
Pan_troglodytes|33528              TGTGAATATTGTGCCAATTTCATGTGGGGGCTCATCGCCCAAGGGGTCCGGTGCTCAGAC
Rhesus_macaque|26807               TGTGAATATTGTGCCAATTTCATGTGGGGGCTCATCGCCCAAGGGGTCCGGTGCTCAGAC
Canis_familiaris|5395              TGTGAATACTGTGCCAACTTCATGTGGGGGCTCATTGCCCAAGGGGTTCGGTGCTCAGAC
Pteropus_vampyrus|4823             TGTGAATACTGTGCCAACTTCATGTGGGGGCTCATCGCCCAAGGGGTCCGGTGCTCAGAC
Equus_caballus|20466               TGTGAATACTGTGCCAACTTCATGTGGGGGCTCATCGCCCAAGGGGTCCGGTGCTCAGAC
Sus_scrofa|7275                    TGTGAATACTGTGCCAACTTCATGTGGGGGCTCATTGCTCAGGGAGTGAAATGTGCAGCA
Macropus_eugenii|8027              NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAT
Branchiostoma_floridae|1548        ---------------------ATGTGGGGACTGGTGGCACAAGGGGTCAAATGTGCAGAT
Ochotona_princeps|13791            TGTGAATACTGTGCCAACTTCATGTGGGGCCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Tupaia_belangeri|12767             TGTGAATACTGTGCCAACTTCATGTGGGGTCTCATTGCTCAGGGAGTGAAGTGTGCCGAC
Erinaceus_europaeus|11556          NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAT
Tarsius_syrichta|9123              TGTGAATACTGTGCCAACTTCATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCTGNN
Pteropus_vampyrus|10445            TGTGAGTACTGTGCCAACTTCATGTGGGGTCTCATTGCTCGA---GTGAAATGTGCAGNN
Felis_catus|45196                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAT
Spermophilus_tridecemlineatus|4303 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAT
Procavia_capensis|2688             TGTGAATACTGTGCCAACTTCATGTGGGGTCTCATTGCTCAGGGCGTGAAGTGTGCAGAT
Dasypus_novemcinctus|1164          TGTGAATACTGTGCCAACTTCATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Otolemur_garnettii|929             TGTGAGTACTGTGCCAACTTCATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Oryzias_latipes|10889              TGTGAATACTGTGCCAACTTCATGTGGGGTCTCATCGCTCAGGGTGTGAAGTGCGCAGAC
Gasterosteus_aculeatus|1240        TGTGAGTACTGCGCTAACTTCATGTGGGGTCTCATCGCTCAGGGAGTCAAGTGTGCAGAC
Tetraodon_nigroviridis|12063       TGTGAATATTGCGCAAACTTTATGTGGGGCCTCATTGCTCAAGGAGTCAAGTGTGCAGAT
Fugu_rubripes|12054                TGTGAATATTGTGCTAACTTTATGTGGGGCCTCATCGCTCAAGGAGTCAAGTGTGCAGAT
Microcebus_murinus|15358           TGTGAGTACTGTGCCAACTTCATGTGGGGTCTCATTGCTCAGGGAGTGAAGTGTGCAGAC
Danio_rerio|31268                  TGCGAGTACTGCGCCAACTTCATGTGGGGACTCATCGCTCAGGGAGTCAAATGTGCAGAT
Xenopus_tropicalis|6414            TGTGAATACTGTGCCAACTTCATGTGGGGACTCATCGCTCAGGGAGTCAAATGCGCAGAC
Cavia_porcellus|24636              TGTGAATACTGTGCCAACTTCATGTGGGGG---ACCGCTCAGGAAGTGAAATGTGCAGAC
Rattus_norvegicus|16671            TGTGAATATTGTGCCAACTTCATGTGGGGCCTCATTGCTCAGAGAGTGAAATGTGCAGAT
Myotis_lucifugus|15927             TGTGAGTACTGTGCCAACTTCATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Anolis_carolinensis|6157           ---------------------------------------------------------GAT
Gallus_gallus|18740                TGTGAGTACTGCGCCAACTTTATGTGGGGCCTCATTGCTCAGGGAGTCAAGTGTGCAGAT
Taeniopygia_guttata|13478          TGTGAATACTGTGCCAACTTCATGTGGGGCCTCATTGCTCAGGGAGTAAAATGTGCAGAT
Dipodomys_ordii|1968               TGTGAATATTGTGCCAACTTCATGTGGGGCCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Mus_musculus|22308                 TGTGAATACTGTGCCAACTTCATGTGGGGCCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Rattus_norvegicus|22026            TGTGAATACTGTGCCAACTTCATGTGGGGCCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Ornithorhynchus_anatinus|23474     TGTGAATACTGTGCCAACTTTATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Pan_troglodytes|24690              TGTGAATACTGTGCCAACTTTATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Monodelphis_domestica|19121        TGTGAATACTGTGCCAACTTTATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Echinops_telfairi|12695            TGTGAATACTGTGCCAACTTCATGTGGGGGCTCATTGCTCAGGGGGTGAAATGCGCAGAT
Cavia_porcellus|12568              TGTGAATACTGTGCCAACTTCATGTGGGGTCTCATCGCTCAGGGAGTGAAATGTGCAGAC
Bos_taurus|11426                   TGTGAATACTGTGCCAACTTCATGTGGGGGCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Vicugna_pacos|6873                 TGTGAATACTGTGCCAACTTCATGTGGGGGCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Pongo_abelii|18313                 TGTGAATACTGTGCCAACTTTATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Gorilla_gorilla|11189              TGTGAATACTGTGCCAACTTTATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Homo_sapiens|48422                 TGTGAATACTGTGCCAACTTTATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Callithrix_jacchus|22501           TGTGAATACTGTGCCAACTTTATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Rhesus_macaque|9284                TGTGAATACTGTGCCAACTTTATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Canis_familiaris|20431             TGTGAATACTGTGCTAACTTCATGTGGGGTCTCATTGCTCAGGGAGTAAAATGTGCAGAT
Choloepus_hoffmanni|3438           TGTGAGTACTGTGCCAACTTCATGTGGGGTCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Loxodonta_africana|14241           TGTGAATACTGTGCGAACTTCATGTGGGGGCTCATTGCTCAGGGAGTGAAATGTGCAGAT
Sorex_araneus|10550                TGTGAATACTGTGCCAACTTCATGTGGGGCCTCATTGCTCAGGGAGTGAAGTGTGCAGAT
Tursiops_truncatus|357             TGTGAATACTGTGCCAACTTCATGTGGGGACTCATTGCTCAGGGAGTGAGATGTGCAGAT
                                                                                               

Ixodes_scapularis|17566            ---------------CGCCACCAGCAGCAACACAAGGAGGAGCAGCCACAAGCCGCGTCG
Caenorhabditis_elegans|9662        ------TGTGGCTTCGCGGCTCACAAAAAATGCTCGGAAAAAACGCTTCACGACTGTGTG
Daphnia_pulex|23786                ------TGTGGAATTTCAGCTCATCGAAAGTGCTCAGAAAAAATTCCAGCTGACTGCTGT
Tribolium_castaneum|7722           ------TGTGGAATGATAGCTCATGTTCGCTGTTCTGAGAAATTCCCCAACGATTGTGTC
Bombyx_mori|1440                   ------TGCGGCTTCATAGCTCATTCGAAATGTTCGGAACGCGCTCCTAATCACTGCGTC
Culex_quinquefasciatus|8347        ------TGCGGTTTTGTAGCACACAACAAGTGCTCGGAACTGGTACCCGCGAAATGCGTG
Drosophila_willistoni|6759         ------TGTGGATTTGTGGCCCACAGCAAGTGCTCCGAATTGGTTCCGCCCAAATGTGTG
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------TGCGGCTTTGTGGCGCACAGCAAGTGCTCCGAACTGGTGCCGCCCAAGTGTGTG
Drosophila_simulans|12658          ------TGCGGCTTTGTGGCGCACAGCAAGTGCTCCGAACTGGTGCCGCCCAAGTGTGTG
Pediculus_humanus|1518             ------TGTGGATTCATAGCTCATAATAAATGCTCAGAAAAAGTTCCTAAAGATTGCTGT
Nematostella_vectensis|14687       ------TGTGGCTTTAATGCACACAAACAGTGCACAAAAGCGATCCCAAATAACTGCAAG
Callithrix_jacchus|17478           ---------------------------------------ATGGTCTCAAATGACTGGAAG
Otolemur_garnettii|5617            ------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Tarsius_syrichta|890               ------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Macropus_eugenii|10045             ------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Gasterosteus_aculeatus|27934       ------TGTGGGCTGAATGTACACAAACAGTGCTCCAAACTGGTTCCCAGCGACTGCCAG
Oryzias_latipes|7013               ------TGTGGGCTGAATGTACACAAACAGTGCTCCAAACTGGTTCCCAGTGACTGTCAG
Fugu_rubripes|14746                ------TGTGGGCTGAATGTACACAAACAGTGCTCCAAACTGGTTCCCAGTGACTGCCAG
Tetraodon_nigroviridis|16104       ------TGTGGACTGAATGTACACAAACAGTGCTCCAAACTGGTTCCCAGCGACTGCCAG
Spermophilus_tridecemlineatus|2344 ------TGTGGATGGAATGTGCACAAGCAGTGTTCCAAGCATGTGCCCAATGACTGCCAA
Danio_rerio|9306                   ------TGTGGACTCAATGTGCACAAGCAGTGCTCCAAACTGGTGCCCAGTGACTGTCAG
Choloepus_hoffmanni|11191          ------TGTGGGTTGAACGTACACAAACAGTGTTCCAAGCACGTTCCCAATGACTGCCAA
Felis_catus|38196                  ------TGTGGATTGAACGTACACAAACAGTGTTCCAAGCACGTTCCCAACGACTGTCAA
Dipodomys_ordii|13518              ------TGTGGGTTGAATGTACACAAGCAGTGTTCCAAGCATGTTCCCAACGACTGCCAA
Echinops_telfairi|2788             ------TGTGGATTGAACGTGCACAAGCAGTGTTCCAAGCACGTGCCCAACGACTGCCAG
Xenopus_tropicalis|20641           ------TGTGGGCTGAATGTACATAAGCAGTGTTCCAAATATGTACCCAACGACTGTCAG
Erinaceus_europaeus|7699           ------TGTGGATTGAATGTACACAAACAATGTTCCAAGTATGTGCCCAATGACTGCCAG
Vicugna_pacos|12004                ------TGTGGATTAAACGTGCACAAGCAGTGTTCCAAGCACGTTCCCAACGACTGCCAA
Dasypus_novemcinctus|12376         ------TGTGGGTTGAACGTACACAAACAGTGTTCCAAGCACGTTCCCAATGACTGTCAA
Myotis_lucifugus|13996             ------TGCGGGCTGAACGTACACAAGCAGTGCTCCAAGCACGGTCCCAACGACTGTCAG
Ochotona_princeps|1540             ------TGCGGGCTGAATGTGCACAAGCAGTGCTCCAAGCATGTGCCCAATGACTGCCAA
Anolis_carolinensis|11713          ------TGTGGACTCAACGTACATAAACAGTGTTCAAAATATGTTCCTAATGACTGTCAG
Gallus_gallus|8478                 ------TGTGGGTTGAACGTACACAAACAGTGCTCCAAGTACGTTCCCAACGACTGTCAG
Monodelphis_domestica|32218        ------TGTGGCCTCAACGTCCACAAGCAATGCTCCAAGCACGTTCCCAATGACTGTCAG
Ornithorhynchus_anatinus|18048     ------TGTGGATTGAATGTACACAAGCAATGTTCCAAGCACGTGCCCAATGACTGTCAA
Tursiops_truncatus|17458           ------TGTGGATTGAACGTACACAAACAGTGTTCCAAGCATGTTCCCAATGACTGCCAA
Bos_taurus|20383                   ------TGTGGATTGAACGTACACAAGCAGTGTTCCAAGCACGTTCCCAATGACTGCCAG
Loxodonta_africana|20466           ------TGTGGATTGAACGTACACAAGCAGTGTTCCAAGCATGTTCCCAACGACTGCCAA
Procavia_capensis|1128             ------TGTGGATTGAATGTACACAAGCAGTGTTCCAAGCATGTTCCCAACGACTGCCAA
Sorex_araneus|13650                ------TGTGGACTGAACGTACACAAGCAGTGTTCCAAGCACGTTTCCAACGACTGCCAG
Microcebus_murinus|8758            ------TGTGGATTGAATGTACACAAACAGTGTTCCAAGCACGTCCCCAACGACTGCCAA
Sus_scrofa|9306                    ------TGTGGGTTGAACGTACACAAACAGTGTTCCAAGCACGTTCCCAACGACTGCCAG
Tupaia_belangeri|17337             ------TGCGGGTTGAACGTCCACAAACAGTGTTCCAAGCACGTCCCCAATGACTGCCAA
Mus_musculus|35474                 ------TGTGGGTTAAACGTACACAAACAGTGCTCCAAGCACGTCCCCAATGACTGCCAG
Rattus_norvegicus|25044            ------TGTGGGTTAAACGTACACAAACAATGTTCCAAGCACGTCCCCAACGACTGCCAG
Cavia_porcellus|16884              ------TGTGGGTTGAATGTACACAAGCAGTGTTCCAAGCATGTTCCCAACGACTGCCAG
Callithrix_jacchus|16234           ------TGTGGACTGAACGTACACAAACAGTGTTCCAAGCACGTTCCCAATGACTGCCAA
Gorilla_gorilla|27910              ------TGTGGATTGAACGTACACAAACAGTGTTCCAAGCACGTTCCCAATGACTGCCAA
Pongo_abelii|25321                 ------TGTGGATTGAACGTACACAAACAGTGTTCCAAGCACGTTCCCAATGACTGCCAA
Pan_troglodytes|33528              ------TGTGGATTGAACGTACACAAACAGTGTTCCAAGCACGTTCCCAATGACTGCCAA
Rhesus_macaque|26807               ------TGTGGATTGAACGTACACAAACAGTGTTCCAAGCACGTTCCCAATGACTGCCAA
Canis_familiaris|5395              ------TGTGGATTGAATGTACACAAACAGTGTTCCAAGCACGTTCCCAACGACTGTCAA
Pteropus_vampyrus|4823             ------TGTGGGTTGAACGTGCACAAACAGTGTTCCAAGCACGTCCCGAATGACTGCCAG
Equus_caballus|20466               ------TGTGGATTGAACGTACACAAACAGTGTTCCAAGCACGTTCCAAACGACTGCCAA
Sus_scrofa|7275                    ATGATGTGTAGCATTTACATTTTGAAAGAGTGCAGGCCATCTATA------GAATGCAAA
Macropus_eugenii|8027              ------TGTGGCTTAAATGTTCATAAGCAGTGTTCCAAGATGGTCCCCAATGACTGTAAA
Branchiostoma_floridae|1548        ------TGTGGTCTAGCGACCCATAAGCAGTGTTCCAAGGTGGTTCCCAACGACTGCCAG
Ochotona_princeps|13791            ------TGTGGCTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCCAATGACTGTAAA
Tupaia_belangeri|12767             ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCTAACGACTGTAAA
Erinaceus_europaeus|11556          ------TGTGGCCTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Tarsius_syrichta|9123              ------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Pteropus_vampyrus|10445            ------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Felis_catus|45196                  ------TGTGGTTTGAATGTGGATAGGAAGTGTTCCAAGATGGTCCCCAACGACTGTCCC
Spermophilus_tridecemlineatus|4303 ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTTCCAAATGACTGTAAG
Procavia_capensis|2688             ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCGAATGACTGTAAG
Dasypus_novemcinctus|1164          ------TGTGGTTTGAATGTTCATAAACAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Otolemur_garnettii|929             ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTTCCAAATGACTGTAAG
Oryzias_latipes|10889              ------TGCGGGCTGAACGTCCACAAGCAGTGCTCCAAGGTGGTGCCCAACGACTGCCAG
Gasterosteus_aculeatus|1240        ------TGCGGGTTAAACGTCCACAAGCAGTGCTCCAAAGTCGTGCCCAACGACTGCCAG
Tetraodon_nigroviridis|12063       ------TGTGGCCTGAACGTGCACAAACAGTGCTCCAAAGTGGTGCCCAACGACTGCCAG
Fugu_rubripes|12054                ------TGTGGTCTGAATGTGCACAAACAGTGCTCCAAAGTTGTGCCCAATGACTGCCAG
Microcebus_murinus|15358           ------TGTGGTTTGAATGTTCACAAGCAGTGCTCCAAGATGGTTCCAAATGACTGTAAG
Danio_rerio|31268                  ------TGCGGGCTGAATGTTCATAAGCAGTGCTCAAAGATGGTGCCGAACGACTGTAAG
Xenopus_tropicalis|6414            ------TGTGGATTGAATGTTCACAAGCAGTGTTCCAAGATGGTTCCGAATGACTGCAAG
Cavia_porcellus|24636              ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGATCCCCAATGACTGCAAG
Rattus_norvegicus|16671            ------TGTGGGTTGAATGTTCACAAGCAGTGTTCCAAGATGGTCGCCAATGACTGTAAG
Myotis_lucifugus|15927             ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Anolis_carolinensis|6157           ------TGTGGTTTAAATGTTCATAAGCAATGTTCCAAGATGGTCCCAAACGACTGCAAG
Gallus_gallus|18740                ------TGTGGTTTAAATGTGCACAAGCAGTGTTCCAAGATGGTCCCAAATGACTGCAAG
Taeniopygia_guttata|13478          ------TGTGGTTTAAATGTGCACAAGCAATGTTCCAAGATGGTCCCAAATGACTGCAAG
Dipodomys_ordii|1968               ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAA
Mus_musculus|22308                 ------TGTGGGTTGAATGTTCACAAGCAGTGTTCCAAGATGGTCCCCAATGACTGTAAG
Rattus_norvegicus|22026            ------TGTGGGTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCCAATGACTGTAAG
Ornithorhynchus_anatinus|23474     ------TGTGGTTTAAATGTCCATAAACAATGTTCCAAGATGGTCCCAAATGACTGCAAA
Pan_troglodytes|24690              ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Monodelphis_domestica|19121        ------TGTGGTTTAAATGTTCATAAGCAGTGTTCCAAGATGGTCCCCAATGACTGCAAA
Echinops_telfairi|12695            ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Cavia_porcellus|12568              ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCCAATGACTGCAAG
Bos_taurus|11426                   ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Vicugna_pacos|6873                 ------TGCGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Pongo_abelii|18313                 ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Gorilla_gorilla|11189              ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Homo_sapiens|48422                 ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Callithrix_jacchus|22501           ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Rhesus_macaque|9284                ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAA
Canis_familiaris|20431             ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Choloepus_hoffmanni|3438           ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTGCCAAATGACTGTAAG
Loxodonta_africana|14241           ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Sorex_araneus|10550                ------TGTGGTTTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGTAAG
Tursiops_truncatus|357             ------TGTGGATTGAATGTTCATAAGCAGTGTTCCAAGATGGTCCCAAATGACTGCAAG
                                                                                               

Ixodes_scapularis|17566            CAGGAGCAGGAG---------------------------------------------GCC
Caenorhabditis_elegans|9662        CCCGACTCGAAATACGTGAAACGCATGTTCGGCGTCGACATTACCACCCTGTGCATGGCT
Daphnia_pulex|23786                CCGGATCTGAAACTTTTAAGAGGAGTTTTTGGCGTGGATTTGACTACCCTCAACAAAGCG
Tribolium_castaneum|7722           CCCGACTTGAAATATCTTCGTGGAGTGTTTGGTATTGAACTGACCACACTTTTAACAGCC
Bombyx_mori|1440                   CCCGATCTAAAGAAGCTACGCGGTGTCTTCGGCATAGATCTGACGACGCTCCTGAATGCG
Culex_quinquefasciatus|8347        CCCGATTTAAAGCGACTTCGTGGAATATTTGGCGTAGATTTGACACTGCTAATTACTGCA
Drosophila_willistoni|6759         CCCGATCTGAAGCGAATACGCGGTGTCTTTGGCACTGATCTGACCACCATGGTACAGTTG
Drosophila_persimilis|9372         ---------------------CGGGCCTTGTCGAATGAACTGGGGAAGACCAATGCCGCC
Drosophila_melanogaster|20217      CCGGATCTGAAGCGCATACGCGGCGTATTTGGCACGGATCTGACCACGATGGTGCAGCTG
Drosophila_simulans|12658          CCGGACCTGAAGCGCATACGCGGCGTATTTGGCACGGATCTGACCACCATGGTGCAGCTG
Pediculus_humanus|1518             CCAGATTTAAAACAAAGTAGAGGAGTTTTCGGAATTGATTTGGAAACTCTTGCCAAATCC
Nematostella_vectensis|14687       CCGGACAAAAAGTATATCAAAAGAGCCTTTGGCGTGGACCTCACTACACTCGTCAAACTT
Callithrix_jacchus|17478           CCAGGCTTGAGGCATGCCAAG---GTGTGCAGCTGTGACTTTACAATGCTTGTCAAA---
Otolemur_garnettii|5617            NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Tarsius_syrichta|890               NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Macropus_eugenii|10045             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Gasterosteus_aculeatus|27934       CCGGACCTGCGCAGGATAAAGAAAGTGTTCAGCTGTGACCTCACCACGCTTGTCAAAGCT
Oryzias_latipes|7013               CCTGACCTGCGCAGGATAAAGAAAGTGTTCAGCTGTGACCTCACCACGCTTGTCAAAGCT
Fugu_rubripes|14746                CCGGACCTGCGCAGGATTAAAAAAGTGTTCAGCTGTGACCTCACCACTCTTGTCAAAGCT
Tetraodon_nigroviridis|16104       CCGGACCTGCGCAGGATTAAAAAAGTGTTCAGCTGTGACCTCACCACGCTAGTCAAGGCT
Spermophilus_tridecemlineatus|2344 CCCGATCTCAAGAGGATCAAGAAAGTGTACTGTTGTGACCTCGCCACACTTGTAAAGGCT
Danio_rerio|9306                   CCAGACCTGCGCAGGATCAAGAAGGTTTTCAGCTGCGATCTCACCACACTGGTCAAAGCA
Choloepus_hoffmanni|11191          CCTGATCTCAAGCGGATCAAGAAAGTGTACTGTTGTGACCTAACCACACTTGTAAAGGCT
Felis_catus|38196                  CCTGATCTCAAGAGGATCAAGAAGGTGTACTGTTGTGACCTCACAACACTCGTAAAGGCT
Dipodomys_ordii|13518              CCTGATCTCAAGAGGATCAAGAAAGTGTATTGCTGTGACCTCACCACACTCGTAAAAGCC
Echinops_telfairi|2788             CCGGATCTCAAGAGGATCAAGAAAGTGTATTGCTGCGACCTCACCACACTCGTGAAAGCG
Xenopus_tropicalis|20641           CCGGACCTGAAGCGCATAAAGAAAGTCTACAGCTGCGACCTGACCACCCTAGTGAAAGCA
Erinaceus_europaeus|7699           CCCGATCTCAAGAGAATCAAGAAAGTGTACTGTTGTGATCTCACAACACTTGTGAAGGCT
Vicugna_pacos|12004                CCTGATCTCAAGAGGATCAAGAAAGTGTACTGCTGTGACCTCACGACGCTCGTGAAGGCT
Dasypus_novemcinctus|12376         CCTGATCTCAAGAGGATCAAGAAAGTGTACTGTTGTGACCTCACGACACTCGTGAAGGCT
Myotis_lucifugus|13996             CCGGACCTCAAGAAGATCAAGAAAGTGTACTGCTGTGACCTCACCACCCTGGTGAAGGCG
Ochotona_princeps|1540             CCTGACCTCAAGAGGATCAAGAAGGTGTACTGCTGTGACCTCACCACCCTCGTGAAGGCT
Anolis_carolinensis|11713          CCGGACCTCAAAAGGATCAAGCGAGTATACTGCTGCGATCTCACTACGCTGGTGAAAGCT
Gallus_gallus|8478                 CCCGACCTCAAGAGGATAAAGCGTGTCTACTGCTGTGATCTGACCACACTGGTGAAAGCC
Monodelphis_domestica|32218        CCGGACCTGAAGCGCATCAAGAAGGTGTACTGCTGTGATCTCACCACCCTGGTGAAGGCC
Ornithorhynchus_anatinus|18048     CCTGATCTGAAGAGGATCAAGAAGGTGTTCTGCTGTGACCTCACAACCCTAGTGAAGGCC
Tursiops_truncatus|17458           CCTGATCTCAAGAGGATCAAGAAGGTGTACTGTTGTGACCTGACAACACTCGTGAAGGCT
Bos_taurus|20383                   CCTGATCTCAAGAGGATCAAGAAGGTGTACTGCTGTGACCTCACGACACTTGTGAAGGCT
Loxodonta_africana|20466           CCAAATCTGAAAAGGATCAAGAAAGTGTATTGTTGTGACCTCACAACACTCGTGAAGGCT
Procavia_capensis|1128             CCGAATCTCAAAAGGATCAAGAAAGTCTACTGTTGTGACCTCACAACTCTCGTGAAGGCT
Sorex_araneus|13650                CCAGACCTCAAGCGAATCAAGAAGGTATACTGCTGTGACCTCACAACACTTGTGAAGGCT
Microcebus_murinus|8758            CCTGATCTCAAGCGGATCAAGAAAGTGTACTGTTGTGACCTCACAACACTCGTGAAGGCT
Sus_scrofa|9306                    CCTGATCTCAAGAGGATCAAGAAGGTGTACTGCTGTGACCTCACGACACTGGTGAAGGCT
Tupaia_belangeri|17337             CCCGATCTCAAGAGGATCAAGAAAGTGTACTGTTGTGACCTCACGACGCTTGTGAAGGCT
Mus_musculus|35474                 CCAGATCTCAAGAGGATCAAGAAAGTGTACTGCTGTGACCTCACCACGCTTGTCAAAGCT
Rattus_norvegicus|25044            CCCGATCTCAAGAGGATCAAGAAAGTATACTGTTGTGATCTCACCACACTTGTAAAAGCT
Cavia_porcellus|16884              CCTGATCTCAAGAGGATCAAGAAGGTGTACTGTTGTGACCTCACCACTCTCGTGAAAGCT
Callithrix_jacchus|16234           CCTGATCTCAAGAGGATCAAGAAGGTGTACTGTTGTGATCTCACAACACTTGTGAAGGCC
Gorilla_gorilla|27910              CCTGATCTCAAGAGGATCAAGAAAGTGTACTGTTGTGACCTCACAACACTTGTGAAGGCT
Pongo_abelii|25321                 CCTGATCTCAAGAGGATCAAGAAAGTGTACTGTTGTGACCTCACAACACTTGTGAAGGCT
Pan_troglodytes|33528              CCTGATCTCAAGAGGATCAAGAAAGTGTACTGTTGTGACCTCACAACACTTGTGAAGGCT
Rhesus_macaque|26807               CCTGATCTCAAGAGGATCAAGAAAGTATACTGTTGTGACCTCACAACACTTGTGAAGGCT
Canis_familiaris|5395              CCTGATCTCAAGAGGATTAAGAAGGTGTACTGTTGTGACCTCACAACACTTGTGAAGGCT
Pteropus_vampyrus|4823             CCTGATCTCAAGAGGATCAAAAAGGTTTACTGCTGCGACCTCACAACGCTCGTGAAGGCA
Equus_caballus|20466               CCTGATCTCAAAAGGATCAAGAAGGTGTACTGTTGTGACCTCACAACACTCGTGAAGGCT
Sus_scrofa|7275                    TTAAGAATTGAGAGAGAGAGAAAGAGAGCTTGCTTTGTTCTGGTTTCTTTTTTCAAAATG
Macropus_eugenii|8027              CCAGACCTGAAGCATGTCAAAAAAGTGTATAGCTGTGACCTTACAACACTAGTAAAAGCA
Branchiostoma_floridae|1548        CCGCACATGAAGTACATCAAGAAGGTTTACGGCATCGACCTGACAACCATCGTCAAGGCC
Ochotona_princeps|13791            CCAGACTTGAAGCACGTGAAGAAGGTGTACAGCTGTGACCTGACCACGCTCGTGAAAGCG
Tupaia_belangeri|12767             CCAGACCTGAAGCATGTGAAGAAGGTGTACAGCTGCGACCTGACCACGCTGGTGAAGGCG
Erinaceus_europaeus|11556          CCTGACTTGAAACATGTCAAGAAAGTGTATAGCTGTGACCTTACAACTCTGGTGAAAGCC
Tarsius_syrichta|9123              NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Pteropus_vampyrus|10445            NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Felis_catus|45196                  CCAGACTTGAAACATGTCAAGAACGTATACAGTTGTGACCTTACCACACTCCTGAAAACC
Spermophilus_tridecemlineatus|4303 CCAGACTTGAAGCATGTGAAGAAGGTGTACAGCTGTGACCTTACAACACTCGTGAAAGCC
Procavia_capensis|2688             CCAGACTTGAAACATGTCAAAAAGGTGTACAGCTGTGACCTCACAACACTTGTCAAAGCA
Dasypus_novemcinctus|1164          CCAGACTTGAAACATGTCAAGAAGGTGTACAGCTGTGACCTCACAACGCTGGTGAAAGCA
Otolemur_garnettii|929             CCAGACTTGAAGCACGTCAAGAAGGTGTACAGCTGTGACCTCACGACACTTGTGAAAGCG
Oryzias_latipes|10889              CCCGACCTCCGGCACGTCAAGAAGGTGTACAGCTGCGACCTGACCACGCTGGTGAAAGCC
Gasterosteus_aculeatus|1240        CCGGACCTGCGGCACGTGAAGAAGGTGTACAGCTGCGACCTGACCACGCTGGTGAAGGCC
Tetraodon_nigroviridis|12063       CCAGATCTGCGCCACGTTAAGAAGGTCTACAGCTGTGACCTCACCACACTGGTCAAAGCC
Fugu_rubripes|12054                CCAGATCTGCGCCACGTCAAGAAGGTATACAGCTGTGACCTCACCACACTGGTCAAAGCC
Microcebus_murinus|15358           CCAGACTTGAAGCACGTCAAGAAGGTGTACAGCTGTGACCTCACGACACTCGTGAAGGCG
Danio_rerio|31268                  CCGGACCTGAAGCACGTGAAGAAGGTTTACAGCTGTGATCTGACCACGCTGGTCAAAGCC
Xenopus_tropicalis|6414            CCAGACTTGAAGCATGTTAAGAAAGTTTACAGTTGTGATCTGACCACATTGGTAAAAGCA
Cavia_porcellus|24636              CCAGACTTGAAGCATGTGAAGAACGTGTACAGCTACGACCTCACGACACTCATGAAAGCG
Rattus_norvegicus|16671            CCAGACCTGAAGCACGTGAAGAAGGTGTACAGCTGTGACCTAACAACGCTCGTGAAAGCT
Myotis_lucifugus|15927             CCAGACTTGAAACATGTCAAGAAGGTGTATAGCTGTGACCTCACAACACTTGTGAAAGCC
Anolis_carolinensis|6157           CCAGACCTGAAGCATGTCAAAAAAGTTTATAGCTGTGATCTGACAACGCTAGTGAAAGCG
Gallus_gallus|18740                CCAGACCTGAAGCACGTCAAAAAAGTGTACAGCTGTGACCTTACCACACTAGTCAAAGCT
Taeniopygia_guttata|13478          CCAGACCTGAAGCATGTCAAAAAAGTGTACAGCTGTGACCTTACCACGCTAGTAAAAGCA
Dipodomys_ordii|1968               CCAGACTTGAAGCATGTGAAGAAG---TACAGCTGTGACCTAACAACGCTCGTGAAAGCA
Mus_musculus|22308                 CCAGATCTGAAGCACGTGAAGAAGGTGTACAGCTGTGACCTGACAACGCTCGTGAAAGCT
Rattus_norvegicus|22026            CCAGACCTGAAGCACGTGAAGAAGGTGTATAGCTGTGACCTGACAACACTCGTGAAAGCT
Ornithorhynchus_anatinus|23474     CCAGACCTAAAGCATGTCAAGAAGGTGTACAGCTGTGATCTTACAACACTAGTCAAAGCT
Pan_troglodytes|24690              CCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTTACGACGCTCGTGAAAGCA
Monodelphis_domestica|19121        CCAGACCTGAAGCATGTCAAAAAGGTGTATAGCTGTGACCTTACAACACTAGTAAAAGCA
Echinops_telfairi|12695            CCAGACTTGAAACATGTCAAAAAGGTGTACAGCTGTGACCTGACAACGCTCGTGAAGGCC
Cavia_porcellus|12568              CCAGACTTGAAGCATGTGAAGAAAGTGTACAGCTGCGACCTCACGACGCTCGTGAAAGCG
Bos_taurus|11426                   CCAGACTTGAAACATGTCAAGAAGGTGTACAGCTGTGACCTGACGACGCTCGTGAAAGCC
Vicugna_pacos|6873                 CCAGACTTGAAGCACGTCAAGAAGGTGTACAGTTGTGACCTTACAACACTTGTGAAAGCC
Pongo_abelii|18313                 CCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTTACGACGCTCGTGAAAGCA
Gorilla_gorilla|11189              CCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTTACGACGCTCGTGAAAGCA
Homo_sapiens|48422                 CCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTTACGACGCTCGTGAAAGCA
Callithrix_jacchus|22501           CCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTTACAACGCTCGTGAAAGCA
Rhesus_macaque|9284                CCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTTACAACGCTCGTGAAAGCA
Canis_familiaris|20431             CCAGACTTGAAACATGTCAAGAAGGTATACAGTTGTGACCTTACAACACTCGTGAAAGCC
Choloepus_hoffmanni|3438           CCAGACTTGAAACATGTCAAGAAGGTGTACAGCTGTGACCTTACGACACTCGTGAAAGCG
Loxodonta_africana|14241           CCAGACTTGAAGCATGTCAAAAAGGTGTACAGCTGTGACCTCACAACGCTCGTAAAAGCA
Sorex_araneus|10550                CCAGACTTGAAACATGTCAAGAAAGTATACAGCTGCGACCTTACGACACTGGTGAAAGCC
Tursiops_truncatus|357             CCAGACTTGAAACATGTCAAGAAGGTGTACAGTTGTGACCTGACAACACTCGTGAAAGCC
                                                                                               

Ixodes_scapularis|17566            CAC---GAGTACGACAAGCCC---------GACGAGATCGTAGAGCCGCTCAGGCTGCAA
Caenorhabditis_elegans|9662        CAC---GGAGCAGATTTGCCGCCAATCGTGCCACTTTGCATTGGAGAAGTCGAATCGAGG
Daphnia_pulex|23786                CATGGAAACACGCGTATTCCTTTTCTAGTTGACATGTGCGTTAAAGAAATTGAAAGACGA
Tribolium_castaneum|7722           CAC---AATGCCAAATTACCATTTGTGGTAACGAAATGTGTGGCTGAAGTTGAAGCTAGA
Bombyx_mori|1440                   CAT---TCCAGTACGATGCCGTTCGTTGTGACGAAGTGTGTGAACGAAATAGAATCTAGG
Culex_quinquefasciatus|8347        CAC---AAGTGCAAAATTCCGTTCATAGTGAAAAAGTGCGTCGAAGAGGTTGAACAACAT
Drosophila_willistoni|6759         GACGTACGCCATCAGATTCCGTTTGTGGTGCGACGATGTGTGGAGGAGGTGGAGGCCAGA
Drosophila_persimilis|9372         GCC---GCCACCGCTGCCGCTGCAGCAAAAGAT---------------------------
Drosophila_melanogaster|20217      GAGCCCCACCACCAGATACCCTTCGTGGTGCGCCGCTGCGTGGAGGAGGTGGAGGCCCGG
Drosophila_simulans|12658          GAGCCCCACCACCAGATACCCTTCGTGGTGCGCCGCTGCGTGGAGGAGGTGGAGGCCCGG
Pediculus_humanus|1518             CAC---CAAACCCTAAGGCCTTTCGTAATTGATAAATGCATACAAGAAATAGAAAGAAGA
Nematostella_vectensis|14687       CAT---AACACGAAAAGACCATTTGTAGTTGATATTTGCATAAACGAAGTCGAAAAGAGA
Callithrix_jacchus|17478           CAC---ACTGCTAAGCAGCCAAGGGTGGGGGACACGTGCAACAGGGAGACGGAGTCTGAA
Otolemur_garnettii|5617            NNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Tarsius_syrichta|890               NNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTGAAGCAAGA
Macropus_eugenii|10045             NNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Gasterosteus_aculeatus|27934       CAC---AACACAACGCGGCCCATGGTGGTGGACATGTGTATTCGAGAAATAGAGCTCAGA
Oryzias_latipes|7013               CAC---AACACCATGCGACCCATGGTGGTGGATATGTGCATTCGGGAGATAGAACTGAGA
Fugu_rubripes|14746                CAC---AACTCTACGCGTCCCATGGTGGTGGACATGTGCATTCAGGAAATAGAGCTGAGA
Tetraodon_nigroviridis|16104       CAC---AACGCCACGCGTCCAATGGTGGTGGACATGTGCATTCAGGAGATAGAGCTGAGA
Spermophilus_tridecemlineatus|2344 CAC---AACACACAGAGGCCCATGGTGGTTGGCATATGCATTCGGGAAATTGAAGCAAGA
Danio_rerio|9306                   CAC---AACACGCCGAGGCCCATGGTTCTGGACATGTGTATCAGAGAGATCGAACACAGA
Choloepus_hoffmanni|11191          CAC---AACACTCAGAGACCCATGGTGGTAGACTTATGCATTCGGGAAATTGAAGCAAGA
Felis_catus|38196                  CAC---AACACTCAGAGGCCCATGGTGGTGGACATATGCATACGGGAAATCGAAGCAAGA
Dipodomys_ordii|13518              CAC---AACACGCAGAGGCCCATGGTGGTTGACATATGTATCCGAGAAATTGAAGCAAGA
Echinops_telfairi|2788             CAC---AACAGCCAGAGGCCCATGGTGGTAGACATCTGCATCCGGGAAATTGAAGCGAGA
Xenopus_tropicalis|20641           CAC---AATACTCCCAGGCCTATGGTGGTGGATATGTGCATCCAGGAGATTGAAGGAAGA
Erinaceus_europaeus|7699           CAC---AATAGTCAGAGACCCATGGTGGTAGACATCTGCATTCGGGAAATTGAAGCAAGA
Vicugna_pacos|12004                CAC---AACGCTCAGAGACCTATGGTGGTGGACATATGCATTCGGGAAATTGAAGCGAGA
Dasypus_novemcinctus|12376         CAC---AACACTCAGAGACCCATGGTGGTGGACATATGCATTCGGGAAATTGAAGCAAGA
Myotis_lucifugus|13996             CAC---CAACGCCAGCGGCCCATTGTGGTGGACATCTGCATTCGGGAAATCGAAGCCAGA
Ochotona_princeps|1540             CAC---AATGCCCAGAGGCCCATGGTGGTGGACATGTGCATCCGGGAGATTGAAGCGAGA
Anolis_carolinensis|11713          CAC---AACACACAAAGACCCATGGTGGTGGATATTTGCATTCGGGAAATTGAAGAACGA
Gallus_gallus|8478                 CAC---AATACCCAGAGGCCAATGGTGGTGGATTCCTGCATCCGAGAGATTGAAGCAAGA
Monodelphis_domestica|32218        CAC---AACACCCAGAGGCCCATGGTGGTGGACATGTGCATTCGAGAGATCGAGGGAAGA
Ornithorhynchus_anatinus|18048     CAC---AACACACAGAGACCCATGGTTGTAGACATATGTATCCGAGAAATTGAAGCAAGA
Tursiops_truncatus|17458           CAC---AACATGCAGAGACCCATGGTGGTAGACATATGCATTCGGGAAATTGAAGCAAGA
Bos_taurus|20383                   CAC---AACACACAGAGACCCATGGTGGTAGACATCTGCATTCGGGAAATTGAAGCAAGA
Loxodonta_africana|20466           CAC---AACACTCAGAGGCCCATGGTGGTAGACATATGCATTCGGGAAATTGAAGCAAGA
Procavia_capensis|1128             CAT---AATACCCAGAGGCCCATGGTGGTGGACATATGCATTCGGGAGATTGAAGCAAGA
Sorex_araneus|13650                CAC---AACACACAGAGACCCATGGTCGTGGACATGTGCATTCGGGAAATTGAAGAAAGA
Microcebus_murinus|8758            CAC---AACACTCAGAGACCCATGGTGGTGGATATATGCATTCGGGAAATTGAAGCGAGA
Sus_scrofa|9306                    CAC---AACACGCAGAGACCCATGGTGGTAGACATATGCATTCGGGAAATTGAAGCAAGA
Tupaia_belangeri|17337             CAC---AACACTCAGAGACCCATGGTGGTGGACATATGCATTCGGGAAATTGAAGCAAGA
Mus_musculus|35474                 CAC---AACACTCAGAGACCCATGGTGGTGGACATATGTATTCGGGAAATTGAAGCAAGA
Rattus_norvegicus|25044            CAC---AACACTCAGAGACCCATGGTGGTGGACATATGTATTCGGGAAATTGAAGCAAGA
Cavia_porcellus|16884              CAC---AACACTCAGAGACCCATGGTGGTTGACATATGCATTCGGGAAATTGAAGCAAGA
Callithrix_jacchus|16234           CAC---AATACTCAGAGGCCCATGGTGGTGGACATATGCATTCGGGAAATTGAAGCAAGA
Gorilla_gorilla|27910              CAC---AACACTCAGAGACCCATGGTGGTAGACATATGCATTCGGGAAATTGAAGCAAGA
Pongo_abelii|25321                 CAC---AACACTCAGAGACCCATGGTGGTGGACATATGCATTCGGGAAATTGAAGCAAGA
Pan_troglodytes|33528              CAC---AACACTCAGAGACCCATGGTGGTAGACATATGCATTCGGGAAATTGAAGCAAGA
Rhesus_macaque|26807               CAC---AACACTCAGAGACCCATGGTGGTGGACATTTGCATTCGGGAAATTGAAGCAAGA
Canis_familiaris|5395              CAC---AATACTCAGAGACCCATGGTGGTAGACATATGCATACGGGAAATTGAAGCAAGA
Pteropus_vampyrus|4823             CAC---AACACCCAGAGGCCCATGGTGGTGGACATCTGCATCCGGGAAATCGAAGCAAGA
Equus_caballus|20466               CAC---AACACCCAGAGGCCCATGGTGGTGGACATATGCATTCGGGAAATCGAAGCAAGA
Sus_scrofa|7275                    CAC---CAAAGCAGAAGAGAACTTGCATTTGATAACTGCAAACATTCACTCAAAGGAAAA
Macropus_eugenii|8027              CAT---ATCACTAAAAGGCCAATGGTGGTTGACATGTGCATTCGAGAAATTGAATCTAGA
Branchiostoma_floridae|1548        CAC---AACACAACCCGCCCCGTCGTCGTGGACAACTGTGTGCAGGAGATCGAGAGAAGA
Ochotona_princeps|13791            CGT---ATCACCACACGGCCAATGGTGGTGGACATGTGCATCAGGGAGATCGAAGCCAGA
Tupaia_belangeri|12767             CAC---ATCACCAAGCGACCCATGGTGGTGGACATGTGCATCCGGGAGATCGAGGCCAGA
Erinaceus_europaeus|11556          CAT---ATCACTAAGCGGCCAATGGTGGTGGACATGTGTATCAGGGAAATTGAATCTAGA
Tarsius_syrichta|9123              NNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Pteropus_vampyrus|10445            NNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Felis_catus|45196                  CAT---AATGGACCGCGGCCAATGGTGGTGGACATGTGCATCATGGAAATTGAATCCAGA
Spermophilus_tridecemlineatus|4303 CAC---ATCACTAAGCGGCCAATGGTGGTGGACATGTGCATCAGGGAGATCGAGTCTAGA
Procavia_capensis|2688             CAT---ATCACCAAGCGGCCCATGGTGGTGGATATGTGTATCCGAGAGATTGAATCCAGA
Dasypus_novemcinctus|1164          CAC---ATCACTAAGCGGCCAATGGTGGTAGATATGTGCATCAGGGAAATTGAATCTAGA
Otolemur_garnettii|929             CAC---ACCACGAAGAGGCCCATGGTGGTGGACATGTGCGTCCGAGAGATCGAGTCTAGA
Oryzias_latipes|10889              CAC---AACACCAAGAGGCCCATGGTGGTGGACATGTGCATCCAGGAGATCGAGGCTAGA
Gasterosteus_aculeatus|1240        CAC---AACACCAAGCGGCCCATGGTGGTGGACATGTGCATACAGGAGATCGAGGCTCGG
Tetraodon_nigroviridis|12063       CAC---AACACCAAGAGACCCATGGTGGTGGACATGTGCAtacaggagctggaggctcga
Fugu_rubripes|12054                CAC---AACACCAAGAGGCCAATGGTGGTGGATATGTGCATACAGGAACTGGAGGCTAGA
Microcebus_murinus|15358           CAC---ACCACCAAGCGGCCCATGGTGGTGGACATGTGCGTCAGGGAGATCGAGTCTAGA
Danio_rerio|31268                  CAC---AACGCCAAACGACCCATGGTGGTGGACATGTGCATACGAGAGATCGAAGCACGA
Xenopus_tropicalis|6414            CAC---AACACGAAAAGGCCGATGGTCGTGGATATGTGTATAAGAGAAATAGAGTCTAGA
Cavia_porcellus|24636              CAC---ATCACTAAGCGGCCCATGGTGGTGGACATATGCGTCAGGGAGATTGAGTCTAGA
Rattus_norvegicus|16671            CAC---ATCACCAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAGATTGAGTCCAGA
Myotis_lucifugus|15927             CAC---ATCACCAAGCGGCCGATGGTGGTGGACATGTGCATCAGGGAAATTGAATCTAGA
Anolis_carolinensis|6157           CAC---TTCACGAAAAGACCAATGGTGGTAGACATGTGCATTAGGGAGATTGAATCTAGA
Gallus_gallus|18740                CAC---TTCACAAAAAGACCCATGGTGGTAGACATGTGCATTAGGGAGATTGAATCCCGA
Taeniopygia_guttata|13478          CAC---TTCACCAAGAGACCAATGGTGGTAGATATGTGCATTAGGGAAATTGAATCTAGA
Dipodomys_ordii|1968               CAT---ATCACTAAGCGGCCAATGGTGGTAGACATGTGTATCAGGGAGATCGAGTCTAGA
Mus_musculus|22308                 CAC---ATCACCAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAGATCGAGTCCAGA
Rattus_norvegicus|22026            CAC---ATCACCAAGAGGCCCATGGTGGTAGACATGTGCATCAGGGAGATCGAGTCCAGA
Ornithorhynchus_anatinus|23474     CAC---ATCACTAAGAGGCCAATGGTGGTAGACATGTGCATTAGGGAAATTGAATCTAGA
Pan_troglodytes|24690              CAT---ACCACTAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAGATTGAGTCTAGA
Monodelphis_domestica|19121        CAT---ATCACTAAAAGGCCAATGGTGGTCGACATGTGCATTCGAGAAATCGAATCTAGA
Echinops_telfairi|12695            CAC---ATCACAAAGCGGCCCATGGTGGTGGACATGTGCATCAGGGAAATCGAATCCAGA
Cavia_porcellus|12568              CAC---ATCACTAAGCGGCCCATGGTGGTGGACATGTGCATCAGGGAGATTGAGTCGAGA
Bos_taurus|11426                   CGC---ACCACCAAGCGGCCCATGGTGGTGGACATGTGCATCAGGGAGATCGAAGCTCGA
Vicugna_pacos|6873                 CAC---ATCGCTAAGCGGCCCATGGTGGTGGACATGTGCATCAGGGAAATTGAATCCAGA
Pongo_abelii|18313                 CAC---ACCACTAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAGATTGAGTCTAGA
Gorilla_gorilla|11189              CAT---ACCACTAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAGATTGAGTCTAGA
Homo_sapiens|48422                 CAT---ACCACTAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAGATTGAGTCTAGA
Callithrix_jacchus|22501           CAC---ACCACTAAGCGACCGATGGTGGTAGACATGTGCATCAGGGAGATTGAGTCTAGA
Rhesus_macaque|9284                CAC---ACCACTAAGCGGCCAATGGTAGTAGACATGTGCATCAGAGAGATTGAGTCTAGA
Canis_familiaris|20431             CAT---ATCACTAAGCGACCAATGGTGGTGGACATGTGCATCAGGGAAATTGAATCTAGA
Choloepus_hoffmanni|3438           CAT---ATCACTAAGCGGCCAATGGTGGTAGACATGTGCATCAGGGAAATTGAATCTAGA
Loxodonta_africana|14241           CAT---ATCACTAAGCGGCCTATGGTGGTGGACATGTGCATCAGAGAAATTGAATCCAGA
Sorex_araneus|10550                CAC---ATCACAAAGCGGCCAATGGTGGTGGACATGTGCATCCGGGAGATTGAATCTAGA
Tursiops_truncatus|357             CAC---ATCACTAAGCGGCCCATGGTGGTGGACATGTGCATCAGGGAGATTGAATCTCGA
                                                                                               

Ixodes_scapularis|17566            CACGGGTCCATAAGACCTGACGCTCTAAAAAAGATCCCC---------------------
Caenorhabditis_elegans|9662        ------GGTCTTGATGTGGAGGGGATTTATCGGGTTTCGGGATCCTATGATCATATGGAA
Daphnia_pulex|23786                ------GGCCTTAACTCCGAAGGAATTTACAGAGTCTCTGGTTTGAGAGATGACGTTGAA
Tribolium_castaneum|7722           ------GGACTTACAACGGAGGGAATTTATCGTTTGAGTGGTTTTGCTGAAGAAATTGAA
Bombyx_mori|1440                   ------GGAATGGACTCTGAAGGCATATACAGGGTGTCCGGTTTCGCTGACGAAATTGAG
Culex_quinquefasciatus|8347        ------GGAATGCTACAGGAGGGCATTTACCGAATCTCAGGGTTTGCTGACGAAATTGAA
Drosophila_willistoni|6759         ------GGAATGCTTCAGGAGGGTATATATCGTGTCTCTGGCTTTGCCGATGAAATCGAG
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      ------GGCATGCTGCAGGAGGGTATCTATCGGGTCTCCGGCTTTGCCGATGAGATCGAG
Drosophila_simulans|12658          ------GGCATGCTGCAGGAGGGTATCTACCGGGTCTCCGGCTTCGCCGATGAGATCGAG
Pediculus_humanus|1518             ------GGCGTTAATGTTGAAGGATTGTATAGAGTATCAGGATTTTCAGAAGAAGTCGAA
Nematostella_vectensis|14687       ------GGCCTGGACTCAGAGGGACTTTACCGAGTTTCTGGCTTCGCGGATGATATTGAA
Callithrix_jacchus|17478           ------AGTCCCAGTTCTGAAGGACTATCCCATGTATCAGGATCTAATGACTTAATT---
Otolemur_garnettii|5617            ------NGATTAAAATCAGAAGGCCTTTACAGAGTCTCTGGGTTCACCGAACACATTGAA
Tarsius_syrichta|890               ------GGATTAAAGTCAGAAGGCCTTTACAGAGTCTCCGGGTTCACTGAACACATTGAA
Macropus_eugenii|10045             ------NGTTTGAAGTCAGAAGGCCTCTACAGAGTCTCAGGCTTCACTGAACACATTGAA
Gasterosteus_aculeatus|27934       ------GGTATGCAATCTGAAGGTCTCTACCGAGTGTCTGGCTTCTCGGAGCACGTAGAG
Oryzias_latipes|7013               ------GGTATGAAATCTGAAGGTCTGTACAGAGTGTCTGGCTTCTCGGAACACATCGAG
Fugu_rubripes|14746                ------GGGATGAAATCTGAAGGCCTCTACCGAGTGTCTGGCTTCTCAGAGCACATCGAG
Tetraodon_nigroviridis|16104       ------GGGATGAAATCCGAAGGTCTCTACCGAGTGTCTGGCTTCTCGGAGCACATAGAG
Spermophilus_tridecemlineatus|2344 ------GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Danio_rerio|9306                   ------GGTTTGAAATCAGAGGGTCTGTACAGAGTGTCAGGCTTCACAGAACACATAGAA
Choloepus_hoffmanni|11191          ------GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Felis_catus|38196                  ------GGATTGAAGTCGGAAGGTCTTTACAGAGTCTCTGGGTTCACCGAACACATTGAA
Dipodomys_ordii|13518              ------GGATTAAAGTCAGAAGGGCTTTACCGAGTCTCTGGGTTCACAGAACACATCGAA
Echinops_telfairi|2788             ------GGATTGAAGTCAGAAGGCCTTTACCGAGTCTCTGGCTTCACTGAACACATAGAA
Xenopus_tropicalis|20641           ------GGTCTAAAGTCAGAGGGTCTGTACAGAGTCTCCGGATTTACTGAGCACATCGAA
Erinaceus_europaeus|7699           ------GGGTTAAAATCAGAAGGCCTTTACAGGGTGTCTGGATTCACTGAACACATTGAA
Vicugna_pacos|12004                ------GGATTAAAGTCAGAAGGCCTTTATAGAGTCTCTGGGTTCACTGAACACATTGAA
Dasypus_novemcinctus|12376         ------GGATTAAAGTCAGAAGGTCTTTACCGAGTCTCTGGGTTCACTGAACACATCGAA
Myotis_lucifugus|13996             ------GGATTAAAGTCGGAAGGTCTTTACAGGGTCTCCGGGTTCACCGAACACATCGAG
Ochotona_princeps|1540             ------GGATTAAAGTCAGAAGGACTGTACAGAGTCTCTGGGTTCACTGAGCACATCGAA
Anolis_carolinensis|11713          ------GGTTTGAAGTCAGAAGGGATTTACAGAGTCTCAGGGTTCACCGAACACATTGAA
Gallus_gallus|8478                 ------GGTTTGAAGTCTGAGGGCCTCTACAGAGTCTCAGGCTTCACTGAGCACATTGAA
Monodelphis_domestica|32218        ------GGTTTAAAGTCTGAGGGCCTCTACAGAGTCTCAGGGTTCACTGAACACATTGAA
Ornithorhynchus_anatinus|18048     ------GGTCTGAAGTCAGAGGGCCTTTACAGAGTCTCGGGGTTCACTGAACACATTGAA
Tursiops_truncatus|17458           ------GNNNNNNNNTCAGAAGGGCTTTATAGAGTGTCCGGGTTTACT---CACATCGAA
Bos_taurus|20383                   ------GGATTAAAGTCAGAAGGCCTTTATAGAGTCTCCGGGTTCACAGAACACATTGAA
Loxodonta_africana|20466           ------GGATTAAAGTCAGAAGGCCTTTACAGAGTCTCTGGATTCACTGAACACATTGAA
Procavia_capensis|1128             ------GGATTAAAGTCAGAAGGCCTTTACAGGGTCTCTGGATTCACTGAACACATTGAG
Sorex_araneus|13650                ------GGACTACAGTCAGAAGGCCTTTACAGAGTCTCTGGATTCACTGAACACATCGAA
Microcebus_murinus|8758            ------GGATTGAAGTCAGAAGGCCTTTACAGAGTCTCTGGGTTCACTGAGCACATTGAA
Sus_scrofa|9306                    ------GGATTAAAATCAGAAGGCCTTTATAGAGTCTCTGGATTCACTGAACACATCGAA
Tupaia_belangeri|17337             ------GGATTAAAGTCAGAAGGCCTGTACAGAGTCTCTGGGTTCACTGAACACATCGAA
Mus_musculus|35474                 ------GGATTAAAGTCAGAAGGGCTTTACAGAGTCTCTGGATTCACAGAACACATTGAA
Rattus_norvegicus|25044            ------GGATTAAAATCAGAAGGGCTTTACAGAGTCTCTGGGTTCACAGAACACATTGAA
Cavia_porcellus|16884              ------GGACTGAAGTCGGAAGGCCTGTACAGAGTCTCCGGATTCACAGAACACATCGAA
Callithrix_jacchus|16234           ------GGATTAAAATCAGAAGGCCTTTACAGAGTCTCTGGGTTCACCGAACACATTGAA
Gorilla_gorilla|27910              ------GGATTAAAATCGGAAGGCCTTTACAGAGTCTCTGGGTTCACTGAACACATTGAA
Pongo_abelii|25321                 ------GGATTAAAATCAGAAGGCCTTTACAGAGTCTCTGGGTTCACTGAACACATTGAA
Pan_troglodytes|33528              ------GGATTAAAATCAGAAGGCCTTTATAGAGTCTCTGGGTTCACTGAACACATTGAA
Rhesus_macaque|26807               ------GGATTAAAATCGGAAGGCCTTTACAGAGTCTCTGGGTTCACTGAACACATTGAA
Canis_familiaris|5395              ------GGATTGAAGTCAGAAGGCCTTTACAGAGTCTCTGGGTTCACTGAACACATCGAA
Pteropus_vampyrus|4823             ------GGATTAAAGTCAGAAGGCCTTTACAGAGTCTCTGGGTTCACCGAACACATCGAA
Equus_caballus|20466               ------GGATTAAAGTCAGAAGGCCTTTACAGAGTCTCTGGGTTCACGGAACACATCGAA
Sus_scrofa|7275                    ------AGTCTTAATTCTGAAGGACTGTACCGAGTTTCAGGATTTAGTGACCTCATTGAA
Macropus_eugenii|8027              ------GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTAGTGACCTTATTGAA
Branchiostoma_floridae|1548        AAAGACGGTTTATTGTCAGAAGGACTCTACAGAGTTTCTGGCTTTAACGATGACATAGAA
Ochotona_princeps|13791            ------GGTCTTAACTCTGAAGGACTGTACCGAGTATCAGGATTCAGTGACCTAATTGAA
Tupaia_belangeri|12767             ------GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Erinaceus_europaeus|11556          ------GGTCTTAATTCCGAAGGACTATACCGAGTATCGGGATTTAGTGACCTGATTGAA
Tarsius_syrichta|9123              ------NGTCTGAATTCTGAAGGACTGTACCGAGTATCAGGATTTAGTGACCTAATTGAA
Pteropus_vampyrus|10445            ------NGTCTTAATTCTGAAGGACTGTACCGAGTATCAGGATTTAGTGACCTAATTGAA
Felis_catus|45196                  ------GGTCTTAATTCTGAAGGTCTGTATCGAGTATCAGGATTCAGTGACTTAATTGAA
Spermophilus_tridecemlineatus|4303 ------GGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAATTGAA
Procavia_capensis|2688             ------GGTCTCAATTCTGAAGGACTATACCGAGTGTCAGGATTCAGTGACCTAATTGAA
Dasypus_novemcinctus|1164          ------GGTCTTAATTCTGAAGGACTATACCGAGTGTCAGGATTTAGTGACCTAATTGAA
Otolemur_garnettii|929             ------GGGCTTAATTCTGAAGGATTATACCGAGTCTCAGGATTTAGTGACCTAATTGAA
Oryzias_latipes|10889              ------GGTCTTCAGTCTGAAGGGTTGTACAGAATTTCCGGCTTCAGCGAGCTGATAGAG
Gasterosteus_aculeatus|1240        ------GGTCTGCAGTCGGAGGGCTTGTACAGGATATCTGGCTTCAGTGAGCTGATTGAA
Tetraodon_nigroviridis|12063       ------GGGCTACAGTCAGAAGGCCTGTACAGAATATCGGGCTTCAGCGAGCTAATTGAA
Fugu_rubripes|12054                ------GGTCTTCAGTCAGAAGGTTTGTACAGAATCTCAGGCTTCAGTGAGCTGATTGAA
Microcebus_murinus|15358           ------GGTCTTAATTCTGAAGGACTATACCGAGTGTCAGGATTTAGTGACCTAATTGAA
Danio_rerio|31268                  ------GGGTTGCAGTCGGAGGGTCTCTATCGCATCTCTGGATTCAGTGACTTGATTGAA
Xenopus_tropicalis|6414            ------GGTCTCTCGTCAGAAGGATTGTACAGAGTATCAGGTTTTACTGATCTAATTGAA
Cavia_porcellus|24636              ------GGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTCAGTGACCTAACTGAA
Rattus_norvegicus|16671            ------GGTCTGAAATCTGAAGGACTCTACCGAGTGTCGGGATTTAGTGACCTAATTGAA
Myotis_lucifugus|15927             ------GGTCTCAATTCTGAAGGACTGTACCGAGTGTCAGGATTTAGTGACCTCATTGAA
Anolis_carolinensis|6157           ------GGTCTCAATTCTGAAGGACTGTACAGAGTATCAGGATTCAGTGATTTAATTGAA
Gallus_gallus|18740                ------GGTCTTAATTCCGAAGGACTGTACAGAGTTTCAGGATTTAGTGATCTTATTGAA
Taeniopygia_guttata|13478          ------GGTCTTAATTCTGAAGGACTGTACCGAGTCTCAGGATTTAGTGATCTTATTGAA
Dipodomys_ordii|1968               ------GGTCTTAATTCAGAAGGATTATACCGAGTATCAGGATTTAGTGACCTAATTGAA
Mus_musculus|22308                 ------GGTCTTAATTCTGAAGGACTCTACCGAGTGTCAGGATTTAGTGACCTGATTGAA
Rattus_norvegicus|22026            ------GGTCTGAATTCTGAAGGACTCTACCGAGTGTCGGGATTTAGTGACCTAATTGAA
Ornithorhynchus_anatinus|23474     ------GGTCTTAATTCGGAAGGGTTATACAGGGTATCAGGATTTAGTGACTTGATTGAA
Pan_troglodytes|24690              ------GGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAATTGAA
Monodelphis_domestica|19121        ------GGTCTTAACTCTGAAGGACTGTATAGAGTCTCAGGATTTAGTGATCTTATTGAA
Echinops_telfairi|12695            ------GGTCTGAATTCGGAAGGGCTGTACCGAGTATCAGGATTCAGTGACTTAATTGAA
Cavia_porcellus|12568              ------GGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTCAGTGACCTAATTGAA
Bos_taurus|11426                   ------GGTCTTAATTCTGAAGGACTGTACCGAGTCTCAGGATTTAGTGACCTAATTGAA
Vicugna_pacos|6873                 ------GGTCTTAATTCTGAAGGACTATATCGAGTATCAGGATTCAGTGACCTAATTGAA
Pongo_abelii|18313                 ------GGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAATTGAA
Gorilla_gorilla|11189              ------GGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAATTGAA
Homo_sapiens|48422                 ------GGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAATTGAA
Callithrix_jacchus|22501           ------GGTCTTAATTCTGAAGGACTATACCGAGTGTCAGGATTTAGTGACCTAATTGAA
Rhesus_macaque|9284                ------GGTCTTAATTCTGAAGGACTATACCGAGTATCAGGATTTAGTGACCTAATTGAA
Canis_familiaris|20431             ------GGTCTTAATTCTGAAGGACTGTATCGAGTATCAGGATTTAGTGATTTAATTGAA
Choloepus_hoffmanni|3438           ------GGTCTTAATTCTGAAGGACTATACCGAGTGTCAGGATTTAGTGACCTAATCGAA
Loxodonta_africana|14241           ------GGTCTAAATTCTGAAGGACTATACCGAGTGTCAGGATTCAGTGACCTGATTGAA
Sorex_araneus|10550                ------GGTCTTAATTCTGAAGGACTATACCGAGTATCGGGATTTAGTGACCTGATTGAA
Tursiops_truncatus|357             ------GGTCTTAATTCTGAAGGACTGTACCGAGTCTCAGGATTTAGTGACCTAATTGAA
                                                                                               

Ixodes_scapularis|17566            ------TTCGTCATGCTTCAAAAG------------------------------------
Caenorhabditis_elegans|9662        AAGCTCAAGCAACAGTTTGATTCT------------------------------------
Daphnia_pulex|23786                GCATTAAGACTTGCTTTTGACAGA------------------------------------
Tribolium_castaneum|7722           GCGATTAAAATGGCTTTCGATAAA------------------------------------
Bombyx_mori|1440                   GCATTGAAATTGGCCTTTGATCGA------------------------------------
Culex_quinquefasciatus|8347        GCGTTAAAAATGGCTTTGGACAAG------------------------------------
Drosophila_willistoni|6759         GCCCTCAAATTGGCCCTTGATCGA------------------------------------
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      GCACTCAAACTCGCCCTGGATCGC------------------------------------
Drosophila_simulans|12658          GCACTCAAGCTCGCCCTGGATCGC------------------------------------
Pediculus_humanus|1518             TCATTAAAAATGGCTTTCGATAAA------------------------------------
Nematostella_vectensis|14687       GCACTCAAAAATTCATTTGACAAA------------------------------------
Callithrix_jacchus|17478           GATGTCAAGATGGCTTTTGACAGA------------------------------------
Otolemur_garnettii|5617            GATGTCAAAATGGCATTTGACAGA------------------------------------
Tarsius_syrichta|890               GATGTCAAAATGGCATTTGACAGA------------------------------------
Macropus_eugenii|10045             GACGTCAAGATGGCTTTTGACAGA------------------------------------
Gasterosteus_aculeatus|27934       GAAGTGAGGCTCGCCTTTGACCGA------------------------------------
Oryzias_latipes|7013               GATGTGAGGCTGTCCTTTGATCGA------------------------------------
Fugu_rubripes|14746                GACGTGAGGCTGGCCTTTGACCGA------------------------------------
Tetraodon_nigroviridis|16104       GACGTGAGGCTGGCCTTTGACCGA------------------------------------
Spermophilus_tridecemlineatus|2344 NNNNNNNNNNNNNNNNNNNNNNNN------------------------------------
Danio_rerio|9306                   GATGTCCGACTGTCCTTCGATAGA------------------------------------
Choloepus_hoffmanni|11191          NNNNNNNNNNNNNNNNNNNNNNNN------------------------------------
Felis_catus|38196                  GATGTCAAAATGGCATTTGACAGA------------------------------------
Dipodomys_ordii|13518              GATGTCAAAATGGCATTCGATAGA------------------------------------
Echinops_telfairi|2788             GACGTCAAAATGGCCTTTGACCGA------------------------------------
Xenopus_tropicalis|20641           GATGTAAAAATGTCCTTTGATCGA------------------------------------
Erinaceus_europaeus|7699           GATGTCAAAATGGCATTTGACAGA------------------------------------
Vicugna_pacos|12004                GATGTTAAAATGGCATTTGACAGA------------------------------------
Dasypus_novemcinctus|12376         GATGTCAAAATGGCATTTGACAGA------------------------------------
Myotis_lucifugus|13996             GATGTCAAAATGGCATTTGATAGA------------------------------------
Ochotona_princeps|1540             GATGTCAAAATGGCGTTTGACAGA------------------------------------
Anolis_carolinensis|11713          GATGTCAAAATGGCCTTTGATCGA------------------------------------
Gallus_gallus|8478                 GATGTGAAAATGGCCTTTGATCGA------------------------------------
Monodelphis_domestica|32218        GATGTCAAGATGGCTTTTGACAGA------------------------------------
Ornithorhynchus_anatinus|18048     GATGTTAAAATGGCTTTCGACCGA------------------------------------
Tursiops_truncatus|17458           GATGTCAAAATGGCATTTGACAGA------------------------------------
Bos_taurus|20383                   GATGTCAAAATGGCATTTGACAGA------------------------------------
Loxodonta_africana|20466           GATGTCAAAATGGCATTTGACAGA------------------------------------
Procavia_capensis|1128             GATGTGAAAATGGCATTTGACAGA------------------------------------
Sorex_araneus|13650                GATGTTAAAATGGCATTTGACCGA------------------------------------
Microcebus_murinus|8758            GATGTCAAAATGGCCTTTGACAGA------------------------------------
Sus_scrofa|9306                    GATGTCAAAATGGCATTTGACAGA------------------------------------
Tupaia_belangeri|17337             GATGTCAAAATGGCATTCGACAGA------------------------------------
Mus_musculus|35474                 GATGTCAAGATGGCGTTTGACAGA------------------------------------
Rattus_norvegicus|25044            GATGTCAAGATGGCGTTCGACAGA------------------------------------
Cavia_porcellus|16884              GATGTCAAGATGGCATTTGACAGA------------------------------------
Callithrix_jacchus|16234           GATGTCAAAATGGCATTTGACAGA------------------------------------
Gorilla_gorilla|27910              GATGTCAAAATGGCATTTGACAGA------------------------------------
Pongo_abelii|25321                 GATGTCAAAATGGCATTTGACAGA------------------------------------
Pan_troglodytes|33528              GATGTCAAAATGGCATTTGACAGA------------------------------------
Rhesus_macaque|26807               GATGTCAAAATGGCATTTGACAGA------------------------------------
Canis_familiaris|5395              GATGTCAAGATGGCATTTGACAGA------------------------------------
Pteropus_vampyrus|4823             GATGTCAAAATGGCATTTGACAGA------------------------------------
Equus_caballus|20466               GATGTCAAAATGGCATTTGACAGA------------------------------------
Sus_scrofa|7275                    GATGTCAAGATGGCTTTTGACAGA------------------------------------
Macropus_eugenii|8027              GATGTAAAAATGGCGTTTGACAGA------------------------------------
Branchiostoma_floridae|1548        GAAGTCAAGCTGTCATTTGACAAA------------------------------------
Ochotona_princeps|13791            GATGTCAAGATGGCTTTTGACAGA------------------------------------
Tupaia_belangeri|12767             NNNNNNNNNNNNNNNNNNNNNNNN------------------------------------
Erinaceus_europaeus|11556          GATGTCAAGATGGCTTTCGACAGA------------------------------------
Tarsius_syrichta|9123              GATGTCAAGATGGCTTTTGACAGA------------------------------------
Pteropus_vampyrus|10445            GATGTCAAGATGGCTTTTGACAGA------------------------------------
Felis_catus|45196                  GATGTCAAGATGGCTTTTGACAGA------------------------------------
Spermophilus_tridecemlineatus|4303 GATGTCAAGATGGCCTTTGACAGA------------------------------------
Procavia_capensis|2688             GATGTCAAGATGGCTTTTGACAGA------------------------------------
Dasypus_novemcinctus|1164          GATGTCAAGATGGCTTTTGACAGA------------------------------------
Otolemur_garnettii|929             GATGTCAAGATGGCTTTTGACAGA------------------------------------
Oryzias_latipes|10889              GACGTCAAGTTGGCCTTTGACAGAGGTGAgcggcgccccctgctggcttTTATGTGCTGT
Gasterosteus_aculeatus|1240        GACGTCAAGCTGGCGTTTGACAGA------------------------------------
Tetraodon_nigroviridis|12063       GACGTCAAGTTGGCGTTCGACAGA------------------------------------
Fugu_rubripes|12054                GATGTCAAGCTGGCGTTTGACAGA------------------------------------
Microcebus_murinus|15358           GATGTCAAGATGGCTTTTGACAGA------------------------------------
Danio_rerio|31268                  GACGTGAAGTTATCGTTTGACAGA------------------------------------
Xenopus_tropicalis|6414            GATGCCAAAATGGCTTTTGACAGA------------------------------------
Cavia_porcellus|24636              GATGTCAAGACGGCCTTTGATGGA------------------------------------
Rattus_norvegicus|16671            GACGTCAAGATGGCTTTTGATAGA------------------------------------
Myotis_lucifugus|15927             GATGTCAAGATGGCTTTTGACAGA------------------------------------
Anolis_carolinensis|6157           GATGTCAAAATGGCTTTTGATCGA------------------------------------
Gallus_gallus|18740                GATGTCAAAATGGCATTTGACAGA------------------------------------
Taeniopygia_guttata|13478          GATGTCAAAATGGCATTTGACAGA------------------------------------
Dipodomys_ordii|1968               GATGTCAAGATGGCATTTGACAGA------------------------------------
Mus_musculus|22308                 GATGTCAAGATGGCTTTTGATAGA------------------------------------
Rattus_norvegicus|22026            GACGTCAAGATGGCTTTTGATAGA------------------------------------
Ornithorhynchus_anatinus|23474     GATGTGAAAATGGCATTTGACAGA------------------------------------
Pan_troglodytes|24690              GATGTCAAGATGGCTTTCGACAGA------------------------------------
Monodelphis_domestica|19121        GATGTAAAAATGGCATTTGACAGA------------------------------------
Echinops_telfairi|12695            GATGTCAAGATGGCTTTTGACAGA------------------------------------
Cavia_porcellus|12568              GATGTCAAGATGGCCTTTGATAGA------------------------------------
Bos_taurus|11426                   GATGTCAAGATGGCTTTTGACAGA------------------------------------
Vicugna_pacos|6873                 GATGTCAAGATGGCTTTTGACAGA------------------------------------
Pongo_abelii|18313                 GATGTCAAGATGGCTTTTGACAGA------------------------------------
Gorilla_gorilla|11189              GATGTCAAGATGGCTTTCGACAGA------------------------------------
Homo_sapiens|48422                 GATGTCAAGATGGCTTTCGACAGA------------------------------------
Callithrix_jacchus|22501           GATGTCAAGATGGCTTTCGACAGA------------------------------------
Rhesus_macaque|9284                GATGTCAAGATGGCTTTCGACAGA------------------------------------
Canis_familiaris|20431             GATGTCAAGATGGCTTTTGACAGA------------------------------------
Choloepus_hoffmanni|3438           GATGTCAAGATGGCTTTTGACAGA------------------------------------
Loxodonta_africana|14241           GACGTCAAGATGGCTTTTGACAGA------------------------------------
Sorex_araneus|10550                GATGTAAAGATGGCTTTTGACAGA------------------------------------
Tursiops_truncatus|357             GATGTCAAGATGGCTTTTGACAGA------------------------------------
                                                                                               

Ixodes_scapularis|17566            ------------------------------AACGGAGAAGCTGCTCCCCTGAATGCCTCC
Caenorhabditis_elegans|9662        ---------------------------------------AATCAATATGTGGACTTGGCT
Daphnia_pulex|23786                ------------------------------GATGGCGACAAGACTGATCTTGGACCTTCG
Tribolium_castaneum|7722           ------------------------------GATGGCGATAAAGCCGATTTAAGTCAGGAA
Bombyx_mori|1440                   ------------------------------GACGGTGAAGCAACGGATCTCAGCGTG---
Culex_quinquefasciatus|8347        ------------------------------GATGGCGAGAAGGCAGACATGTCTGCTTTG
Drosophila_willistoni|6759         ------------------------------GATGGCGAGAAGACTGATATGACAGAGGCA
Drosophila_persimilis|9372         ------------------------------GACGCCTCTCCCAAGGATGTGGATGTGCCA
Drosophila_melanogaster|20217      ------------------------------GAGGGCGAGAAGACGGACATGTCGGAGACG
Drosophila_simulans|12658          ------------------------------GAGGGCGAGAAGACGGACATGTCGGAGACG
Pediculus_humanus|1518             ------------------------------GATGGAGAAAAGGCGGATTTAAGCCCTGCC
Nematostella_vectensis|14687       GGCAACACTCACACAACCGTTAATTACTCAGATGGCGAATCGGTGAACCTCTCCACG---
Callithrix_jacchus|17478           ------------------------------GATGGTGAGAAAGCA---GCTGAGAAAGCA
Otolemur_garnettii|5617            ------------------------------GATGGCGAGAAGGCAGATATATCTGCCAAC
Tarsius_syrichta|890               ------------------------------GNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Macropus_eugenii|10045             ------------------------------GNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Gasterosteus_aculeatus|27934       ------------------------------GATGGTGAAAAGGCTGACATCAGCGCCGTT
Oryzias_latipes|7013               ------------------------------GATGGCGAGAAGGTTGATATCAGTGCCAGT
Fugu_rubripes|14746                ------------------------------GATGGCGACAAGGCCGACATCAGTGCCAGT
Tetraodon_nigroviridis|16104       ------------------------------GATGGCGACAAGGCCGACATCAGTGCCAGT
Spermophilus_tridecemlineatus|2344 ------------------------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Danio_rerio|9306                   ------------------------------GATGGTGAGAAGGCAGACATCAGTGCCAAC
Choloepus_hoffmanni|11191          ------------------------------NATGGTGAAAAGGCAGATATATCTGCCAAC
Felis_catus|38196                  ------------------------------GACGGTGAAAAGGCAGATATATCTGCCAAC
Dipodomys_ordii|13518              ------------------------------GNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Echinops_telfairi|2788             ------------------------------GNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Xenopus_tropicalis|20641           ------------------------------GATGGTGATAGAGCCGACATCTCCAGTACT
Erinaceus_europaeus|7699           ------------------------------GATGGTGAAAAGGCAGACATATCTGCCAAC
Vicugna_pacos|12004                ------------------------------GATGGTGAAAAGGCAGATATATCTGCCAAC
Dasypus_novemcinctus|12376         ------------------------------GACGGTGAAAAGGCAGATATATCTGCCAAC
Myotis_lucifugus|13996             ------------------------------GATGGTGAAAAGGTAGACATATCTGCCAAC
Ochotona_princeps|1540             ------------------------------GATGGAGAAAAAGCAGATATTTCTGCCAAC
Anolis_carolinensis|11713          ------------------------------GATGGTGACAAGGCTGATGTTTCCGCCAAC
Gallus_gallus|8478                 ------------------------------GACGGTGACAAGGCTGATATTTCTGCCAGT
Monodelphis_domestica|32218        ------------------------------GATGGTGAGAAGGCAGATATTTCTGCCCAC
Ornithorhynchus_anatinus|18048     ------------------------------GATGGTGAAAAGGCTGACATATCTGCCAGC
Tursiops_truncatus|17458           ------------------------------GATGGTGAAAAGGCCGATATATCTGCCAAC
Bos_taurus|20383                   ------------------------------GATGGTGAAAAGGCAGATATATCTGCCAAC
Loxodonta_africana|20466           ------------------------------GATGGTGAAAAGGCAGATATATCTGCCAAC
Procavia_capensis|1128             ------------------------------GATGGTGAAAAGGTAGATATATCTGCCAAC
Sorex_araneus|13650                ------------------------------GATGGTGAAAAGGCAGATATATCTGCCAGC
Microcebus_murinus|8758            ------------------------------GATGGTGAAAAAGCAGATATATCTGCCAGC
Sus_scrofa|9306                    ------------------------------GACGGTGAAAAGGCAGATATATCTGCCAGC
Tupaia_belangeri|17337             ------------------------------GATGGTGAAAAGGCGGACATATCTGCCAAC
Mus_musculus|35474                 ------------------------------GATGGTGAAAAGGCGGATATCTCTGCCAAC
Rattus_norvegicus|25044            ------------------------------GATGGTGAAAAGGCGGATATCTCTGCTAAC
Cavia_porcellus|16884              ------------------------------GATGGAGAAAAGGCAGATATATCTGCCAAC
Callithrix_jacchus|16234           ------------------------------GATGGTGAAAAGGCTGATATATCTGCCAAT
Gorilla_gorilla|27910              ------------------------------GATGGTGAAAAGGCCGATATATCTGCCAAT
Pongo_abelii|25321                 ------------------------------GATGGTGAAAAGGCCGATATATCCGCCAAT
Pan_troglodytes|33528              ------------------------------GATGGTGAAAAGGCCGATATATCTGCCAAT
Rhesus_macaque|26807               ------------------------------GATGGTGAAAAGGCCGATATATCTGCCAAT
Canis_familiaris|5395              ------------------------------GATGGTGAAAAGGCAGATATATCTGCCAAC
Pteropus_vampyrus|4823             ------------------------------GATGGTGAAAAGGCAGATATATCTGCCAAC
Equus_caballus|20466               ------------------------------GATGGTGAAAAAGCAGATATATCTGCCAAC
Sus_scrofa|7275                    ------------------------------GATGGTGAGAAAGCAGATATTTCTGTGAAC
Macropus_eugenii|8027              ------------------------------GNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Branchiostoma_floridae|1548        ------------------------------GACGGAGCTCAGGCTGACATCTCGGAGTCT
Ochotona_princeps|13791            ------------------------------GATGGCGAGAAAGCAGATATTTCCGTGAAC
Tupaia_belangeri|12767             ------------------------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Erinaceus_europaeus|11556          ------------------------------GATGGTGAAAAAGCAGACATTTCTGTCAAC
Tarsius_syrichta|9123              ------------------------------GNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Pteropus_vampyrus|10445            ------------------------------GATGGTGAGAAAGCAGATATTTCCGTGAAC
Felis_catus|45196                  ------------------------------GNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Spermophilus_tridecemlineatus|4303 ------------------------------GATGGTGAGAAAGCAGATATTTCTGTGAAC
Procavia_capensis|2688             ------------------------------GNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Dasypus_novemcinctus|1164          ---------------------------------GNNNNNNNNNNNNNNNNNNNNNNNNNN
Otolemur_garnettii|929             ------------------------------GNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Oryzias_latipes|10889              TTTTCCTCATCGGCCTTTCCCACCTTGGCAGACGGAGAAAAAGCGGACATTTCCTCCAGC
Gasterosteus_aculeatus|1240        ------------------------------GATGGAGAGAAGGCGGACATTTCCTCAAAT
Tetraodon_nigroviridis|12063       ------------------------------GATGGGGAGAAGGCCGATATTTCTGCAAAT
Fugu_rubripes|12054                ------------------------------GATGGAGAGAAGGCTGACATTTCCACAAAT
Microcebus_murinus|15358           ------------------------------GATGGTGAGAAAGCAGATATTTCTGTGAAC
Danio_rerio|31268                  ------------------------------GATGGAGAGAAGGCCGACATCTCAGTGAAC
Xenopus_tropicalis|6414            ------------------------------GATGGGGAGAAGGCTGATATTTCTGTGAAT
Cavia_porcellus|24636              ------------------------------GATGGTGAGAAAGCAGATATTTCTGTGAAC
Rattus_norvegicus|16671            ------------------------------GACGGTGAAAAGGCAGATATTTCTGTGAAC
Myotis_lucifugus|15927             ------------------------------GATGGAGAGAAAGCAGATATTTCTGTGAAC
Anolis_carolinensis|6157           ------------------------------GATGGAGAAAAAGCAGATATTTCTGTTAAT
Gallus_gallus|18740                ------------------------------GATGGGGAGAAGGCTGATATTTCTGTGAAT
Taeniopygia_guttata|13478          ------------------------------GATGGGGAAAAAGCTGATATTTCTGTGAAT
Dipodomys_ordii|1968               ------------------------------GATGGTGAGAAAGCAGATATTTCTGTGAAC
Mus_musculus|22308                 ------------------------------GATGGTGAGAAGGCGGATATTTCTGTGAAC
Rattus_norvegicus|22026            ---------------------------GAAGACGGTGAAAAGGCGGATATTTCTGTGAAC
Ornithorhynchus_anatinus|23474     ------------------------------GATGGGGAGAAGGCAGATATTTCTGTGAAT
Pan_troglodytes|24690              ------------------------------GATGGTGAGAAGGCAGATATTTCTGTGAAC
Monodelphis_domestica|19121        ------------------------------GATGGTGAAAAGGCAGACATTTCTGTGAAC
Echinops_telfairi|12695            ------------------------------GATGGCGAGAAGGCAGATATTTCTGTGACC
Cavia_porcellus|12568              ------------------------------GATGGTGAGAAAGCAGATATTTCTGTGAAC
Bos_taurus|11426                   ------------------------------GATGGTGAGAAAGCAGATATTTCTGTGAAC
Vicugna_pacos|6873                 ------------------------------GATGGTGAGAAAGCAGATATTTCTGTGAAC
Pongo_abelii|18313                 ------------------------------GATGGTGAGAAGGCAGATATTTCTGTGAAC
Gorilla_gorilla|11189              ------------------GCATCCTTAAAAGATGGTGAGAAGGCAGATATTTCTGTGAAC
Homo_sapiens|48422                 ------------------------------GATGGTGAGAAGGCAGATATTTCTGTGAAC
Callithrix_jacchus|22501           ------------------------------GATGGTGAGAAGGCAGACATTTCTGTGAAC
Rhesus_macaque|9284                ------------------------------GATGGTGAGAAGGCAGATATTTCTGTGAAC
Canis_familiaris|20431             ------------------GCATCCTTCAAAGATGGCGAGAAAGCAGATATTTCCGTGAAC
Choloepus_hoffmanni|3438           ------------------------------GATGGTGAAAAAGCAGATATTTCTGTGAAC
Loxodonta_africana|14241           ------------------------------GATGGTGAGAAAGCAGATATTTCTGTGAAC
Sorex_araneus|10550                ------------------------------GACGGGGAGAAAGCAGATATTTCGGTGAAC
Tursiops_truncatus|357             ------------------------------GACGGTGAGAAAGCAGATATTTCTGTGAAC
                                                                                               

Ixodes_scapularis|17566            ACTTATGAAGACATTCATGTTATAGCTGGGGTTCTGAAACTGTTTCTGAGGTTGCTACCC
Caenorhabditis_elegans|9662        ACGGTTTGCGATATTCACACAGTTTGCGGGCTCTTGAAGCTCTACTTCCGCCTACTACCA
Daphnia_pulex|23786                TCCTGGGAAGACATCAATGTTGTCGCTGGTGTACTGAAATTATATTTTCGTCTTCTACCA
Tribolium_castaneum|7722           AAATACCCAAATGTTAATGTAATAACAGGGGCGTTAAAATCATATCTTAGACTTTTACCA
Bombyx_mori|1440                   ---TACAGCAACATAAACGTAATAGCGGGAACTCTGAAACTTTATTTACGGTTATTGCCC
Culex_quinquefasciatus|8347        GCTTACAGTAATGTAAACGTGATTTCGGGGGTGCTTAAAATGTACCTTAGACTTCTACCA
Drosophila_willistoni|6759         GCCTATGGCAATGTCAATGTCATTGCTGGCACACTGAAGCTCTATCTGAGATTATTACCA
Drosophila_persimilis|9372         TTGATGCCGACACAGCCCTTG------GGAACACTCAAACAG------------------
Drosophila_melanogaster|20217      GCGTATGGCAATGTGAATGTGATCGCCGGCACACTGAAGCTCTACCTGCGCCTACTGCCC
Drosophila_simulans|12658          GCGTACGGCAATGTGAATGTGATCGCCGGCACCCTGAAGCTCTACCTGCGCCTGCTGCCC
Pediculus_humanus|1518             GTTTATGACAACATTCACGTTTTGACCGGTGCTTTAAAATTGTATTTAAGATTATTGCCA
Nematostella_vectensis|14687       ---TACGACGATATCAACACTATCACAGGCGTGTGCAAGCTGTACTTCCGTCAACTGCCT
Callithrix_jacchus|17478           GCATATGAAGATATCAACGTTGTCACAGGTACTCCTAAACTGCGCTGCAGAGATTTGTCA
Otolemur_garnettii|5617            ATTTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTATTTCAGAGACTTACCC
Tarsius_syrichta|890               NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Macropus_eugenii|10045             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Gasterosteus_aculeatus|27934       GCCTATGCAGACATCAACATCATCGCTGGTGCTCTGAAGCTCTACTTAAGAGACCTTCCC
Oryzias_latipes|7013               GCCTATGCAGACATCAACATAATTGCGGGTGCTTTGAAACTCTACTTCAGAGATCTCCCC
Fugu_rubripes|14746                GCCTATGCGGACATCAACATCATCGCCGGTGCTTTGAAACTGTACCTGAGAGACCTCCCC
Tetraodon_nigroviridis|16104       GCCTATGCTGACATCAACATCATTGCCGGTGCTTTGAAACTGTACTTGAGAGACCTTCCC
Spermophilus_tridecemlineatus|2344 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Danio_rerio|9306                   ATCTACCCAGACATTAATATAATTGCTGGTGCTCTGAAGCTGTATTTGCGAGATCTGCCC
Choloepus_hoffmanni|11191          ATCTATCCAGACATAAACATCATTACGGGAGCCCTTAAACTGTACTTCAGAGACTTACCC
Felis_catus|38196                  ATCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTACTTCAGAGACTTACCC
Dipodomys_ordii|13518              NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Echinops_telfairi|2788             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Xenopus_tropicalis|20641           CTCTACCCCGACATCAACATCATAACTGGAGCACTGAAACTCTATTTTAGGGACCTGCCA
Erinaceus_europaeus|7699           ATCTACCCAGACATAAACATCATCACTGGAGCCCTCAAATTGTATTTCAGAGACTTACCA
Vicugna_pacos|12004                ATCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTATTTCAGAGACTTACCC
Dasypus_novemcinctus|12376         ATCTATCCAGACATAAACATCATCACGGGAGCCCTTAAACTGTACTTCAGAGACTTACCC
Myotis_lucifugus|13996             CTCTACCCAGACATAAACATCATCACTGGAGCCCTGAAACTGTATTTCAGAGACTTACCC
Ochotona_princeps|1540             ATATACCCAGACATCAACATCATCACTGGAGCCCTTAAACTGTACTTCAGAGACCTGCCC
Anolis_carolinensis|11713          CTATATCCAGATATAAATATCATTGCTGGAGCATTAAAGCTGTATTTCCGAGACTTGCCC
Gallus_gallus|8478                 ATTTATCCAGACATAAACATTATTGCTGGAGCACTGAAGCTGTATTTCAGAGACTTACCA
Monodelphis_domestica|32218        ACATATCCAGACATCAACATCATCACGGGGGCACTGAAACTGTACTTCCGAGACTTACCG
Ornithorhynchus_anatinus|18048     ATATATCCAGACATAAATATTATCACTGGAGCACTTAAATTATATTTCAGAGATTTACCA
Tursiops_truncatus|17458           ATCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTATTTCAGAGACTTACCC
Bos_taurus|20383                   ATCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTATTTCAGAGACTTACCC
Loxodonta_africana|20466           ATCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTATTTTAGAGACTTACCC
Procavia_capensis|1128             ATCTACCCAGACATAAACATCATCACTGGAGCCCTTAAACTATATTTTAGAGACTTACCC
Sorex_araneus|13650                ATTTACCCAGACATAAACATCATCACTGGAGCGCTCAAATTGTATTTCAGGGACTTACCT
Microcebus_murinus|8758            ATCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTATTTCAGAGACTTGCCC
Sus_scrofa|9306                    ATCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTACTTCAGAGACTTACCC
Tupaia_belangeri|17337             GTCTACCCAGACATCAACATCATCACTGGAGCCCTTAAACTGTACTTCAGAGACTTACCC
Mus_musculus|35474                 ATCTACCCAGACATAAACATCATCACTGGAGCCCTGAAACTGTACTTCCGAGACTTACCC
Rattus_norvegicus|25044            ATCTACCCAGACATAAACATCATCACCGGAGCCCTGAAACTGTACTTCAGAGACTTACCC
Cavia_porcellus|16884              ATCTATCCTGACATAAACATCATCACTGGAGCTCTGAAACTGTACTTCAGGGACTTACCT
Callithrix_jacchus|16234           GTCTATCCAGACATAAACATCATTACTGGAGCCCTTAAACTGTATTTCAGAGACTTACCC
Gorilla_gorilla|27910              GTCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTATTTCAGAGACTTACCC
Pongo_abelii|25321                 GTCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTATTTCAGAGACTTACCC
Pan_troglodytes|33528              GTCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTATTTCAGAGACTTACCC
Rhesus_macaque|26807               GTCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTATTTCAGAGACTTACCC
Canis_familiaris|5395              ATCTACCCAGACATAAACATCATCACTGGAGCCCTTAAACTATACTTCAGAGACTTACCC
Pteropus_vampyrus|4823             ATCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTATTTCAGAGACTTGCCC
Equus_caballus|20466               ATCTATCCAGACATAAACATCATCACTGGAGCCCTTAAACTGTATTTCAGAGACTTACCC
Sus_scrofa|7275                    ATGTATGAAGATATCAACATTATCACTGGTGCGCTGAAACTGTACTTCAGGGATTTACCA
Macropus_eugenii|8027              NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Branchiostoma_floridae|1548        ACATACGAGGACATCAACACGATAGCGGGCGCGCTGAAGCTCTACTTCCGCATGTTACCC
Ochotona_princeps|13791            NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Tupaia_belangeri|12767             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Erinaceus_europaeus|11556          ATGTATGAAGACATCAACATCATCACTGGAGCGTTGAAACTATACTTCAGGGATTTGCCA
Tarsius_syrichta|9123              NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Pteropus_vampyrus|10445            ATGTATGAAGATATCAACATTATCACTGGTGCGCTGAAACTCTACTTCAGGGATTTACCA
Felis_catus|45196                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Spermophilus_tridecemlineatus|4303 ATGTATGAAGATATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCA
Procavia_capensis|2688             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Dasypus_novemcinctus|1164          NNNNNNNNNNNNNNNNNNNNNNNNNNNACGGGTGCGCTTCTGTACTTCAGGGATTTGCCG
Otolemur_garnettii|929             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Oryzias_latipes|10889              GCGTATGAAGACATCAACATCATCACTGGAGCCCTGAAGCTGTACTTCCGGGACCTGCCC
Gasterosteus_aculeatus|1240        GCTTACGAGGACCTCAACATCATTGCCGGAGCCCTCAAGCTCTACTTCAGGGAGCTGCCT
Tetraodon_nigroviridis|12063       GCTTACGAGGACATCAACATCATCACCGGGGCCCTCAAACTCTATTTTAGAGAGCTGCCT
Fugu_rubripes|12054                GCTTACGAGGACATCAACATCATCACTGGGGCCCTCAAGCTCTATTTTAGAGAGCTGCCT
Microcebus_murinus|15358           ATGTATGAAGATATCAACATTATCACTGGTGCGCTTAAACTGTACTTCAGGGATTTGCCA
Danio_rerio|31268                  GTGTATGAAGACATTAACGTGATCAGCGGAGCTCTGAAACTGTACTTTAGGGACCTGCCG
Xenopus_tropicalis|6414            GTATATGAAGACATCAACATTATAACCGGTGCACTGAAACTATATTTCAGGGAACTTCCA
Cavia_porcellus|24636              ATGTATGAAGATATCAACATTATCACTGGTGCGCTTAAGCTGTACTTCAGGGATCTGTCA
Rattus_norvegicus|16671            GTGTATGAGGACATCAACATTATCACTGGGGCACTTAAACTGTACTTCAAGGACCTGCCA
Myotis_lucifugus|15927             GTATATGAAGATATCAACATCATCACTGGTGCGCTGAAACTCTACTTCAGGGACTTACCG
Anolis_carolinensis|6157           ATGTATGAAGATATCAATATTATCACAGGTGCTCTTAAACTGTACTTCAGGGATTTACCA
Gallus_gallus|18740                ATGTATGAAGATATCAATATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCA
Taeniopygia_guttata|13478          ATGTATGAAGATATCAATATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCA
Dipodomys_ordii|1968               ATGTATGAAGACATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCA
Mus_musculus|22308                 ATGTATGAGGACATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATCTGCCA
Rattus_norvegicus|22026            ATGTATGAGGACATCAACATTATCACTGGAGCGCTTAAACTGTACTTCAGGGATCTGCCA
Ornithorhynchus_anatinus|23474     ATGTATGAAGATATCAATATTATCACTGGTGCACTTAAACTGTACTTCAGGGACTTACCA
Pan_troglodytes|24690              ATGTATGAAGATATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCA
Monodelphis_domestica|19121        ATGTATGAAGATATCAATATCATCACTGGAGCTCTTAAACTGTACTTCAGGGATTTGCCA
Echinops_telfairi|12695            ATGTATGAAGACATCAACATTATCACTGGTGCGCTTAAGCTGTACTTCAGGGATTTGCCA
Cavia_porcellus|12568              ATGTATGAAGATATCAACATTATCACTGGTGCACTTAAGCTGTACTTCAGGGATCTGCCA
Bos_taurus|11426                   ATGTATGAAGATATCAACATTATCACTGGTGCACTGAAACTGTACTTCAGGGATTTGCCG
Vicugna_pacos|6873                 ATGTATGAAGACATCAACATCATCACGGGTGCGCTGAAACTGTACTTCAGGGATTTACCC
Pongo_abelii|18313                 ATGTATGAAGATATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCA
Gorilla_gorilla|11189              ATGTATGAAGATATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCA
Homo_sapiens|48422                 ATGTATGAAGATATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCA
Callithrix_jacchus|22501           ATGTATGAAGATATCAACATCATCACCGGTGCACTTAAACTGTACTTCAGGGATTTGCCA
Rhesus_macaque|9284                ATGTATGAAGATATCAACATTATCACTGGTGCACTTAAACTGTACTTCAGGGATTTGCCA
Canis_familiaris|20431             ATGTATGAAGATATCAACATTATCACCGGCGCACTGAAACTGTACTTCAGGGATCTACCA
Choloepus_hoffmanni|3438           ATGTATGAAGATATCAACATTATTACGGGTGCACTTAAACTGTACTTCAGGGATTTGCCA
Loxodonta_africana|14241           ATGTATGAAGATATCAACGTTATCACTGGTGCGCTCAAACTGTACTTCAGGGATTTGCCC
Sorex_araneus|10550                ATGTATGAAGACATCAACATTATTACTGGTGCACTGAAACTGTACTTCAGGGACTTACCG
Tursiops_truncatus|357             ATGTATGAAGATATCAACATTATCACTGGTGCACTGAAACTGTACTTCAGAGATTTACCA
                                                                                               

Ixodes_scapularis|17566            ATCCCCCTCATCACCTTTGACAGCTACACAAAGTTCTTCGATGCCGTCAAGAGCAACAAG
Caenorhabditis_elegans|9662        CAGCAACTGATCCCGTTCAGCGTCCATAAGCAGCTTCTCGTCGCCTACCAGGAGACGAAT
Daphnia_pulex|23786                ATTCCATTAATTGCCTTTCAGGTTTACCCGCTTGTGATGACAGCTGCAAAAGAGCCTGAT
Tribolium_castaneum|7722           ATTCCGCTTATTACATTTATCGTTCATCCACTTCTCATTGACGCCATGCAACATAAAAAT
Bombyx_mori|1440                   GTGCCGTTGATCACATACGAAGTCCACCCCAAGCTCGTAATGGCGATACAACCGAAGACT
Culex_quinquefasciatus|8347        GTCCCACTTATCACGTCCGACTGCTATCCGGCGTTTATGCAAGCTATGACTAATAAAAAT
Drosophila_willistoni|6759         GTACCATTGATCACATTCCAGGCTTATCCCAGTTTCATGAATGCTGGCCGTCAATCCAAT
Drosophila_persimilis|9372         ------------------------------------------------------------
Drosophila_melanogaster|20217      GTGCCGCTCATCACATTCCAGGCGTATCCCAGCTTTATGGCAGCAGGACGCACCGGCAAG
Drosophila_simulans|12658          GTGCCGCTCATCACATTCCAGGCGTATCCCAGCTTCATGGCAGCAGGACGTGACACCGGC
Pediculus_humanus|1518             ATACCTCTTGTTACTTATGATATTCATCCAATATTAATAAAAGCTTTAAAACAATCTTCG
Nematostella_vectensis|14687       CTACCCCTCATCACTTTCGAGACTTACAGTAAATTCATAGCCGCTGCAAAAACACAAGAC
Callithrix_jacchus|17478           GTTTCACTAATCATGCATGATATCTACCCTAAGTTTATAGAATCTGCCGGAACTATGGAT
Otolemur_garnettii|5617            ATCCCCCTCATCACATATGATACCTATTCCAAATTTATAGAAGCAGCAAAAATCTCCAAT
Tarsius_syrichta|890               NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATCTCCAAT
Macropus_eugenii|10045             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATCTCCAAT
Gasterosteus_aculeatus|27934       ATTCCAATCATTACGTTTGACTTGTACTCCAAATTTATTCAAGCTGCAAAAATTCCAAAT
Oryzias_latipes|7013               ATTCCAGTCATTACTTTTGACTTGTACTCCACATTTATTCAAGCTGCAAAAATTCCGAAT
Fugu_rubripes|14746                ATTCCCGTCATTACGTTCGAATTGTACTCTAAATTCATCCAAGCTGCGAGGATTCCAAAT
Tetraodon_nigroviridis|16104       ATTCCCGTCATTACATTTGAATTGTACACTAAATTTATCCAGGCTGCAAGAATTCCCAAT
Spermophilus_tridecemlineatus|2344 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTTATAGAAGCAGCAAAAATCTCCAAT
Danio_rerio|9306                   ATTCCAGTTATCACATACGACGTCTACTCCAGATTCATCCAAGCAGCGAAAATAACAGAC
Choloepus_hoffmanni|11191          ATTCCCGTCATCACTTATGATACCTACTCCAAATTTATAGAAGCAGCGAAAATCTCCAAT
Felis_catus|38196                  ATTCCTGTTATCACCTATGACACCTATCCCAAATTTATCGAAGCAGCGAAAATCTCCAAT
Dipodomys_ordii|13518              NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATCTCCAAT
Echinops_telfairi|2788             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATCCTCAAT
Xenopus_tropicalis|20641           ATTCCAGTGATTACCTATGACACGTATTACAAATTTATGGAGGCGACAAAGATATCCAAT
Erinaceus_europaeus|7699           ATACCTGTCATCACCTATGATACCTATTCTAAATTTATAGATGCTGCAANNNNNNNNNNN
Vicugna_pacos|12004                ATTCCCGTCATCACCTATGATACCTATTCCAAATTTATAGAAGCAGCAANNNNNNNNNNN
Dasypus_novemcinctus|12376         ATTCCCATCATCACATATGATACCTATTCCAAATTTATAGAAGCAGCAANNNNNNNNNNN
Myotis_lucifugus|13996             ATTCCTGTCATCACCTATGATACCTATTCCAAGTTTATAGAAGCAGCAAAAATCTCCAAC
Ochotona_princeps|1540             ATCCCTGTCATCACATACGACACCTATTCCAAATTCATAGAGGCAGCCAAAATCTCCAAT
Anolis_carolinensis|11713          ATTCCCATCATCACTTATGATACGTATTCCAAGTTTATAGATGCAGCAAAACTCTGCAAT
Gallus_gallus|8478                 ATTCCCGTGATCACCTATGACACCTATTCCAAGTTCATAGAGGCAGCAAAAATCTCCAAT
Monodelphis_domestica|32218        ATTCCTGTCATCACATATGACACATACGCCAGATTTATCGATGCAGCCAAAATCTCTAAT
Ornithorhynchus_anatinus|18048     ATTCCTGTCATCACATATGATACTTATTCCAAGTTTATAGATGCAGCAAAAATTTCTAAT
Tursiops_truncatus|17458           ATTCCTGTCATCACCTATGATACCTATTCCAAATTTATAGAAGCAGCAAAAATCTCCAGT
Bos_taurus|20383                   ATTCCTGTCATCACCTATGATACCTATTCCAAATTTATAGAAGCAGCAAAAATCTCCAAT
Loxodonta_africana|20466           ATTCCTGTCATCACATATGATACCTATTCCAAATTCATAGAAGCAGCAAAAGTCCCCAAC
Procavia_capensis|1128             ATTCCTGTCATCACATATGATACTTATTCCAAATTCATAGAAGCAGCA------------
Sorex_araneus|13650                ATCCCTGTCATCACCTATGACACCTATTCCAAATTTATAGAAGCAGCAAAAATCTCCAAC
Microcebus_murinus|8758            ATCCCCCTCATCACATATGATACCTATTCCAAATTTATAGAAGCAGCAAAAATCTCCAAT
Sus_scrofa|9306                    ATTCCTGTCATCACCTATGATACCTATTCTAAATTTATAGAAGCAGCAAAAATCTCCAAT
Tupaia_belangeri|17337             ATCCCTGTCATCACATATGATACCTATTCCAAATTCATAGAAGCAGCAAAGATCTCTAAC
Mus_musculus|35474                 ATCCCTATCATCACATATGACACCTACTCCAAATTTATAGAGGCAGCAAAAATCTCCAAT
Rattus_norvegicus|25044            ATCCCCATCATCACATATGACACCTATTCCAAGTTTATAGAGGCAGCAAaaatctccaat
Cavia_porcellus|16884              ATCCCTGTCATCACTTATGATACCTATTCCAAATTTATAGAAGCAGCAAAAATTTCCAAT
Callithrix_jacchus|16234           ATCCCTGTCATCACGTATGACACCTATTCCAAATTTATAGATGCAGCAAAAATCTCCAAT
Gorilla_gorilla|27910              ATCCCTGTCATCACATACGATACCTATTCCAAATTTATAGATGCAGCAAAAATCTCCAAT
Pongo_abelii|25321                 ATCCCTGTCATCACATATGATACCTATTCCAAATTTATAGATGCAGCAAAAATCTCCAAT
Pan_troglodytes|33528              ATCCCTGTCATCACATATGATACCTATTCCAAATTTATAGATGCAGCAAAAATCTCCAAT
Rhesus_macaque|26807               ATCCCTGTCATCACATATGATACCTACTCCAAATTTATAGATGCAGCAAAAATCTCCAAT
Canis_familiaris|5395              ATTCCTGTTATCACCTATGACACCTATCCCAAATTTATTGAGGCAGCAAAAATCTCCAAC
Pteropus_vampyrus|4823             ATTCCCGTCATCACCTACGATACCTATTCCAAATTTATAGAAGCAGCAAAAATCTCCAAT
Equus_caballus|20466               ATTCCTGTCATCACCTACGATACCTATTCCAAATTTATAGAAGTAGCAAAAATCTCCAAT
Sus_scrofa|7275                    ATTCCACTCATCACGTATGACGCCTACCCGAAGTTCATAGAGTCTGCCATAACCATGTCC
Macropus_eugenii|8027              NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACTTTGGAT
Branchiostoma_floridae|1548        ATTCCACTCATCACCTTCGACGTCTACCCAAAATTCATAGAGGCAGCCAAGATTGCCGAT
Ochotona_princeps|13791            NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATCATGGAT
Tupaia_belangeri|12767             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATCATGGAT
Erinaceus_europaeus|11556          ATCCCTCTCATCACGTATGACGCCTACCCTAAGTTTATCGAGTCTGCCANNNNNNNNNNN
Tarsius_syrichta|9123              NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTATGGAT
Pteropus_vampyrus|10445            ATTCCACTCATCACATATGACGCCTACCCTAAGTTCATAGAGTCCGCCAAAATTATGGAT
Felis_catus|45196                  NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTATGGAT
Spermophilus_tridecemlineatus|4303 ATTCCACTCATCACATATGATGCCTATCCTAAGTTCATAGAGTCTGCCANNNNNNNNNNN
Procavia_capensis|2688             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATAATGGAT
Dasypus_novemcinctus|1164          ATTCCACTCATCACGTACGACGCCTATCCTAAGTTTATAGAGTCTGCCAAAATTATGGAC
Otolemur_garnettii|929             NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTATGGAT
Oryzias_latipes|10889              ATTCCCCTCATCACCTACGACGCGTACCCCCGCTTCATTGAAGCTGCCAAGATTTCAGAT
Gasterosteus_aculeatus|1240        ATTCCGCTCATCACGTACGACGCCTACCCGCACTTCATCGAAACAGGAAAGATCGCAGAC
Tetraodon_nigroviridis|12063       ATTCCCTTGATCACATATGATGCCTACCCACGCTTCATAGAGGCTGCAAAGATCACAGAC
Fugu_rubripes|12054                ATTCCTTTGATCACATATGATGCCTACCCACGCTTCATAGAGGCTGCAAAGATCACAGAT
Microcebus_murinus|15358           ATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCANNNNNNNNNNN
Danio_rerio|31268                  ATCCCCGTCATCACCTACGACGCTTATCCTCGCTTCATCCAGGCTGCCAAGCTGACAGAT
Xenopus_tropicalis|6414            ATCCCAATCATTACATATGATGCCTACCCGAAATTCCTAGAGTCTGCAAAGGCTCCAGAC
Cavia_porcellus|24636              ATTCCACTCACTACATATGAGGCCTACCCTAAGTTCATCGAGTCTGCCAAAATTATGGAT
Rattus_norvegicus|16671            ATTCCCCTCATCACCTACGATGCCTACCCCAAGTTCATAGAGTCCGTCAAAATTATGGAC
Myotis_lucifugus|15927             ATTCCACTCATCACGTATGACGCCTACCCCAAGTTCATAGAGTCCGCC------------
Anolis_carolinensis|6157           ATTCCACTCATTACATATGATGCCTACCCCAAATTTATAGAATCTGCAAAATCCACGGAT
Gallus_gallus|18740                ATTCCACTCATCACGTATGATGCCTACCCAAAGTTTATAGAGTCCGCAAAAACCACCGAT
Taeniopygia_guttata|13478          ATTCCACTCATCACATATGATGCCTACCCAAAGTTCATAGAGTCTGCAAAAACCACGGAT
Dipodomys_ordii|1968               ATTCCACTCATCACATATGACGCCTACCCCAAGTTCATAGAGTCTGCCAAAATTATGGAT
Mus_musculus|22308                 ATTCCTCTCATCACATACGATGCCTACCCCAAGTTCATTGAGTCTGCCAAAATTATGGAC
Rattus_norvegicus|22026            ATTCCTCTCATCACCTACGATGCCTACCCCAAGTTCATAGAGTCTGCCAAAATTGTGGAC
Ornithorhynchus_anatinus|23474     ATCCCCCTCATCACATATGATGCCTACCCAAAATTTATAGATTCTGCAAAGACTATGGAT
Pan_troglodytes|24690              ATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGAT
Monodelphis_domestica|19121        ATACCACTCATCACATATGATGCCTACCCCAAATTTATAGATTCTGCAAAGACTTTGGAT
Echinops_telfairi|12695            ATTCCACTCATCACATACGACGCCTACCCTAAGTTTATAGAGTCTGCTAAAATTATGGAC
Cavia_porcellus|12568              ATTCCACTCATTACATATGAGGCCTACCCTAAGTTCATCGAGTCTGCCAAAATTATGGAT
Bos_taurus|11426                   ATTCCACTCATCACATATGACGCCTACCCTAAGTTTATAGAGTCCGCCAAAATTATGGAT
Vicugna_pacos|6873                 ATCCCACTCATCACGTATGACGCCTACCCTAAGTTTATAGAGTCTGCCAAAATGATGGAT
Pongo_abelii|18313                 ATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGAT
Gorilla_gorilla|11189              ATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGAT
Homo_sapiens|48422                 ATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGAT
Callithrix_jacchus|22501           ATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGAT
Rhesus_macaque|9284                ATTCCACTCATTACATATGATGCCTACCCTAAGTTTATAGAATCTGCCAAAATTATGGAT
Canis_familiaris|20431             ATTCCACTCATCACGTATGACGCCTACCCCAAGTTTATAGAGTCCGCCAAAATTCTGGAT
Choloepus_hoffmanni|3438           ATTCCACTCATCACGTATGATGCCTACCCTAAGTTTATCGAGTCTGCTAAAATTATGGAT
Loxodonta_africana|14241           ATCCCACTCATCACATATGATGCCTACCCTAAGTTCATAGAGTCTGCTAAAATTATGGAT
Sorex_araneus|10550                ATTCCACTCATCACATATGACGCTTACCCCAAGTTTATCGAGTCTGCCAAAATTATGGAT
Tursiops_truncatus|357             ATTCCACTCATCACATACGACGCCTACCCTAAGTTTATAGAGTCTGCCAAAATTATGGAC
                                                                                               

Ixodes_scapularis|17566            GTG---------GAAGAAAAGCTGGATGCCATGAAGGAAGCCGTCAAGTCACTGCCTCCT
Caenorhabditis_elegans|9662        CAACGATCTACACATGAGAGGGAGCGGCAGATAAGAAAAGTGATGATGGAGCTGTCCGAT
Daphnia_pulex|23786                GAA---------AACCGCCGTTTGCAACGAATAAAAGATGCCGTACATTTACTTCCACCT
Tribolium_castaneum|7722           CAC---------GATTTGAAAATGTCGTCAGTTAAGCACGCCCTTAAATCATTGCCGAAA
Bombyx_mori|1440                   ATC---------CCGCAGCAGATAATGATGCTGAGGCAGTGTCTGGAGCCGCTGCCGCCT
Culex_quinquefasciatus|8347        GTC---------GGAGAAAAAATCTTGGCGATGCGTGATGCACTGAAAAAATTGCCGGTG
Drosophila_willistoni|6759         CAA---------GTGGAGCAGATGCAGCTGATGTCAGAGGCAGTGCGTCATCTGCCTCCA
Drosophila_persimilis|9372         ------------GCGGAGCAGCTGCAGATGATGTCAGAGGCAGTGCGTCGTCTGCCTCCG
Drosophila_melanogaster|20217      CAG---------GCCGAGCAGCGCCAGCTCATGGCGGAGGCAGTGCGTCGCCTGCCGCCC
Drosophila_simulans|12658          AAG------CAGACGGAGCAGCGCCAGCTTATGGCGGAGGCAGTGCGTCGCCTGCCGCCC
Pediculus_humanus|1518             GAA---------AGTGAAGAAATAAAAACTATAAGAAACGCTTTAAATATGCTTCCTCCT
Nematostella_vectensis|14687       AAA---------CACCTAAGAATAGAAGAGCTATCCAAGGCGTTAGGGGAACTTCCACAG
Callithrix_jacchus|17478           CCT---------AATGAGAAACTGGAAACCCTTCATGAAGCAGTGAAACTGCTGGCACCT
Otolemur_garnettii|5617            CCA---------GATGAGAGGCTGGAAGCAGTCCATGAAGTGTTGCTGCTGCTGCCTCCT
Tarsius_syrichta|890               GCA------------GATGAGCTGGAAGCAGTCCAT---GTGCTGATGCTGCTGCCTCCT
Macropus_eugenii|10045             CCA---------GATGAGAGGTTAGAGGCCGTCCATGAAGTCTTAATGTTGCTGCCTCCT
Gasterosteus_aculeatus|27934       GCT---------GAATCCAGACTGGAGGGCATCCACGAGAGTTTGCTGCAGCTGCCCCCC
Oryzias_latipes|7013               GCT---------GAATGCAGACTGGAGGCCATCCATGAAGGGTTGCTTCAGCTCCCCCCA
Fugu_rubripes|14746                GCC---------GATACCAGACTGGAAGCCATCCACGACAGTTTACTCCAGCTGCCCCCC
Tetraodon_nigroviridis|16104       GCT---------GACACCAGACTGGAGGCCATCCACGAGGGTTTACTCCAGCTGCCGCCA
Spermophilus_tridecemlineatus|2344 GCG---------GATGAAAGGCTGGAAGCAGTCCACGAAGTGCTGATGCTACTGCCTCCC
Danio_rerio|9306                   CCT---------GATTCCAGACTGGAGGCAGTTCACGACGGTCTCCTCCAGCTTCCTCCA
Choloepus_hoffmanni|11191          GCG---------GACGAGAGGTTGGAAGCCGTCCATGAGGTGCTGCTGCTGCTCCCTCCT
Felis_catus|38196                  GCA---------GACGAGAGGCTGGAAGCCGTCCATGAAGTGCTGATGCTGCTGCCTCCT
Dipodomys_ordii|13518              GCT---------GATGAGAGGCTGGAAGCAGTTCACGAAGTGTTGCTGCTGCTGCCTCCT
Echinops_telfairi|2788             GCA---------GACGAGCGACTGGAAGCGGTCCACGAAGTGCTGCTGCTGCTGCCGCCT
Xenopus_tropicalis|20641           GCA---------GATGAGAGACTAGAGGCAATACATGAAGCGCTTATGCTCCTGCCACCC
Erinaceus_europaeus|7699           NNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Vicugna_pacos|12004                NNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Dasypus_novemcinctus|12376         NNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Myotis_lucifugus|13996             GCA---------GACGAGAGGCTGGAAGCCGTCCACGAGGTGTTGATGCTGCTGCCTCCC
Ochotona_princeps|1540             GCA---------GATGAGAGGCTGGAGGCTGTCCATGAAGTGCTGATGCTGCTGCCTCCT
Anolis_carolinensis|11713          CCC---------GATGAAAGGCTAGAAGCTGTTCATGAAGTGTTGCTGTTACTTCCTGCT
Gallus_gallus|8478                 CCT---------GATGAACGACTAGAAGCAATACATGAAGTGTTGATGTTACTCCCTGCT
Monodelphis_domestica|32218        CCG---------GATGAGAGATTAGAGGCTGTCCATGAAGTCTTAATGTTGCTGCCCCCT
Ornithorhynchus_anatinus|18048     CCA---------GATGAACGATTGGAGGCAGTTCATGAAGTCTTAATGTTACTGCCTCCA
Tursiops_truncatus|17458           GCG---------GATGAGAGGCTGGAAGCGGTCCACGAAGTGCTGATGCTGCTTCCTCCT
Bos_taurus|20383                   GCG---------GATGAGAGGCTGGAAGCGGTCCATGAAGTGCTGATGCTGCTTCCTCCT
Loxodonta_africana|20466           GCA---------GATGAGAGGTTGGAAGCGGTCCATGAAGTGCTGATGCTGCTGCCTCCT
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                CCA---------GATGAGAGGCTGGAAGCCGTCCATGAGGTGCTGCTGCTGCTGCCTCCT
Microcebus_murinus|8758            GCA---------GATGAGAGGCTGGAAGCAGTCCATGAAGTGCTGCTGCTGCTGCCTCCT
Sus_scrofa|9306                    GTG---------GATGAGAGGCTGGAAGCAGTCCATGAGGTGCTGATGCTGCTGCCACCT
Tupaia_belangeri|17337             GCA---------GATGAGAGGCTGGAAGCAGTCCACGACGTGCTGATGCTGCTGCCTCCT
Mus_musculus|35474                 GCG---------GATGAGAGGCTGGAAGCTGTCCATGAGGTCCTGATGCTGCTGCCTCCT
Rattus_norvegicus|25044            gca---------gatgagaggcttgaAGCTGTCCATGAGGTCCTGATGCTGCTGCCTCCT
Cavia_porcellus|16884              GCA---------GATGAGAGGCTGGAAGCAGTCCATGAAGTACTGATGTTACTGCCTCCC
Callithrix_jacchus|16234           GCA---------GATGAGAGGCTGGAAGCCGTCCATGAAGTACTGATGCTGCTGCCTCCT
Gorilla_gorilla|27910              GCA---------GATGAGAGGCTGGAAGCCGTCCATGAAGTGCTGATGCTGCTGCCTCCT
Pongo_abelii|25321                 GCA---------GATGAGAGGCTGGAAGCTGTCCATGAAGTGCTGATGCTGCTGCCTCCT
Pan_troglodytes|33528              GCA---------GATGAGAGGCTGGAAGCCGTCCATGAAGTGCTGATGCTGCTGCCTCCT
Rhesus_macaque|26807               GCA---------GATGAGAGGCTGGAAGCCGTCCATGAAGTGCTGATGCTGCTGCCTCCT
Canis_familiaris|5395              GCA---------GATGAGAGGCTGGAAGCCGTCCATGACGTGCTGATGCTGCTGCCCCCT
Pteropus_vampyrus|4823             GCA---------GATGAGAGGCTGGAAGCAGTCCATGAAGTGCTGATGCTGCTGCCTCCT
Equus_caballus|20466               GCG---------GATGAGAGGCTGGAAGCAGTCCATGAAGTACTGATGCTGCTGCCTCCT
Sus_scrofa|7275                    CCT---------------------------------------------------------
Macropus_eugenii|8027              CCT---------GATGAGCAGCTGGAAACACTTNNNNNNNNNNNNNNNNNNNNNNNNNNN
Branchiostoma_floridae|1548        GAC---------AAAGACTGCCTCAGGAAGATCCACGAGACACTAGACGAGCTGCCGCCT
Ochotona_princeps|13791            CCA---------GATGAGCAGCTGGAAACCCTTCACGAAGCCCTGAAACTACTGCCCCCT
Tupaia_belangeri|12767             CCT---------GACGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTACTGCCACCT
Erinaceus_europaeus|11556          NNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Tarsius_syrichta|9123              CCT---------GATGAGCAATTGGAAACTCTTCATGAAGCACTGAAACTGTTGCCACCT
Pteropus_vampyrus|10445            CCT---------GATGAGCAATTAGAAACCCTTCATGAAGCACTGAAACTGCTGCCGCCT
Felis_catus|45196                  CCC---------GATGAGCAATTAGAAACCCTTCACGAGGCACTGAAGCTCCTGCCGCCC
Spermophilus_tridecemlineatus|4303 NNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Procavia_capensis|2688             CCC---------GATGAGCAATTGGAAACTCTTCATGAAGCGCTGAAACTGCTGCCGCCT
Dasypus_novemcinctus|1164          CCC---------GATGAGCAATTGGAAACCCTTCACGAAGCACTAAAACTACTGCCACCT
Otolemur_garnettii|929             CCT---------GATGAGCAATTGGAAAACCTTCATGAGGCCCTGAAACTCCTGCCGCCT
Oryzias_latipes|10889              CCA---------GAGAAACTGCTGGAGTCTCTCCACGAAGCCTTAAAGCTGTTGCCGCCG
Gasterosteus_aculeatus|1240        GCC---------GAGAAGCGACTGGAGTCTCTGCACGAGGCCTTAAAGCTGCTGCCGCCG
Tetraodon_nigroviridis|12063       CCA---------GAAAAACGCCTGGAGTCTCTTCACGAGGCCTTgaagctgctgcctcca
Fugu_rubripes|12054                GCA---------GAAAAACGTCTGGAGTCTCTCCACGAGGCCTTGAAGCTGCTGCCTCCA
Microcebus_murinus|15358           NNN---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Danio_rerio|31268                  CCA---------GATGAGCGTCTGGAGGCTCTTCATGAAGCTCTGAAGCTGCTTCCTCCA
Xenopus_tropicalis|6414            CCT---------GATGCACAACTAGAAACCCTTCATGACGCTTTGAAGCTGCTGCCTCCA
Cavia_porcellus|24636              CCT---------GATGAGCAATTGGAAACCCTTCATGAAGTGCTGAAACTACTGCCGCCT
Rattus_norvegicus|16671            CCT---------GATGAGCAATTGGAGACCCTTCATGAAGCACTCAGATCTCTGCCGCCG
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           CAT---------GATGAACAGCTGGAAATACTTCATGAAGCACTGAACCTGCTGCCACCT
Gallus_gallus|18740                CCA---------GATGAACAGCTGGAAATTCTCCACGAGGCGCTGAAACTGCTGCCGCCT
Taeniopygia_guttata|13478          CCG---------GATGAACAGCTGGAAATTCTCCATGAGGCGCTGAAGCTGCTGCCGCCT
Dipodomys_ordii|1968               CCT---------GATGAGCAGTTAGAAACCCTTCATGAAGCATTGAAACTATTACCGCCT
Mus_musculus|22308                 CCT---------GACGAGCAATTGGAGACCCTTCACGAAGCACTGAGATCGCTGCCGCCT
Rattus_norvegicus|22026            CCT---------GATGAGCAACTGGAGACCCTTCATGAAGCACTGAGGTCTCTGCCGCCC
Ornithorhynchus_anatinus|23474     CCT---------GATGAACAGTTGGAAACCCTTCATGAAGCTCTGAAGCTGCTGCCTCCT
Pan_troglodytes|24690              CCG---------GATGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTACTGCCACCT
Monodelphis_domestica|19121        CCT---------GATGAACAGCTGGAAACTCTTCATGAAGCATTGAAACTACTGCCACCT
Echinops_telfairi|12695            CCC---------GACGAGCAGTTGGAAACCCTTCACGAAGCCCTGAAACTCCTGCCTCCT
Cavia_porcellus|12568              CCA---------GATGAGCAATTGGAAACCCTTCATGAAGCGCTGAAACTACTGCCGCCT
Bos_taurus|11426                   CCT---------GATGAGCAATTAGAAACCCTTCACGAAGCACTGAAACTGCTGCCGCCT
Vicugna_pacos|6873                 CCT---------GACGAGCAATTAGAAACCCTCCATGAAGCACTGAAACTGCTGCCGCCT
Pongo_abelii|18313                 CCG---------GATGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTACTGCCACCT
Gorilla_gorilla|11189              CCG---------GATGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTACTGCCACCT
Homo_sapiens|48422                 CCG---------GATGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTACTGCCACCT
Callithrix_jacchus|22501           CCT---------GATGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTGCTGCCACCT
Rhesus_macaque|9284                CCT---------GATGAGCAATTGGAAACCCTTCATGAAGCACTGAAACTACTGCCACCT
Canis_familiaris|20431             CCT---------GACGAGCAGTTGGAAACCCTTCACGAGGCACTGAAGCTGCTGCCCCCC
Choloepus_hoffmanni|3438           CCT---------GATGAGCAATTGGAAACCCTTCATGAAGCTCTGAAACTCCTGCCACCT
Loxodonta_africana|14241           CCC---------GATGAGCAATTGGAAACCCTTCACGAAGCACTGAAACTACTGCCGCCT
Sorex_araneus|10550                CCA---------GATGAGCAGTTAGAAACCCTTCATGAAGCACTGAAACTCCTGCCACCT
Tursiops_truncatus|357             CCC---------GATGAGCAATTAGAAACCCTTCATGAAGCACTGAAACTGCTGCCGCCC
                                                                                               

Ixodes_scapularis|17566            GCCCACTACCAATCCCTGAAGTACCTCATGAGCCATCTTCAGCGG---------------
Caenorhabditis_elegans|9662        GCGAACATAATCACACTTGGAGCAGTGTTGGCGCATTTGAAAAAG---------------
Daphnia_pulex|23786                GCTCACTATAACTCGTTGAAATATCTTATCTTTCATTTACATAGG---------------
Tribolium_castaneum|7722           GCACATTATGATACTTTGAAATACATGATTGAGCATTTACACAGG---------------
Bombyx_mori|1440                   GCTCACTTCAACTGTCTTCAGTACATGATGCAGCATTTACACAGG---------------
Culex_quinquefasciatus|8347        GCACACTTCAACTGTTTGAAGTACATCTTGGAACATTTAAATAGG---------------
Drosophila_willistoni|6759         GCTCATTATAGCTGTTTGCAATACATGCTAGAGCATTTGAAACGT---------------
Drosophila_persimilis|9372         GCCCACTACAGCTGCCTGCAGTACATGCTGGAGCACCTCAAGCGC---------------
Drosophila_melanogaster|20217      GCCCACCACAGCTGTCTGCAGTACATGCTGGAGCACCTGAAGCGA---------------
Drosophila_simulans|12658          GCCCACCACAGCTGTCTGCAGTACATGCTAGAGCATCTGAAACGG---------------
Pediculus_humanus|1518             GCTCATTATGAAACATTAAAGTACCTGATCAAACATCTACACAAA---------------
Nematostella_vectensis|14687       GCGCACTATGAGACGATGAAATTCTTAATGGGACATCTCCATAGG---------------
Callithrix_jacchus|17478           GCTCGCCGTGAAAGCCTCTGGTCCCTGGTGGCACGTCTAAAGAGA---------------
Otolemur_garnettii|5617            GCCCACTATGAGACCCTCAGATACCTGATGATCCACCTCAAAAAG---------------
Tarsius_syrichta|890               GCCCACTATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG---------------
Macropus_eugenii|10045             GCCCATTATGAGACGCTCAGATACCTAATGATTCATCTCAAG------------------
Gasterosteus_aculeatus|27934       GCCCACTTTGAGACCCTGCGTTACCTGATGGCTCATCTCAAGAGG---------------
Oryzias_latipes|7013               GCACACTATGAGACACTGCGCTACCTGATGGCCCACCTCAGAAGG---------------
Fugu_rubripes|14746                GCCCACTACGAGACCCTGCGTTACTTGATGGCTCACCTGAAGAGG---------------
Tetraodon_nigroviridis|16104       GCCCACTACGAGACCCTGCGTTACCTGATGGCTCACCTGAAGAGG---------------
Spermophilus_tridecemlineatus|2344 GCCCACTATGAGACCCTGCGGTACCTAATGATCCACCTCAAG------------------
Danio_rerio|9306                   GCCCACTATGAGACCCTGCGGTACTTGATGACACACCTGAAGAGA---------------
Choloepus_hoffmanni|11191          GCCCACTACGAGACCCTCCGATATCTAATGATCCACCTCAAGAAG---------------
Felis_catus|38196                  GCTCACTATGAGACCCTCCGGTACCTGATGATCCACCTCAAGAAN---------------
Dipodomys_ordii|13518              GCCCACTATGAGACCCTGCGATACCTAATGATCCACCTCAAGAAG---------------
Echinops_telfairi|2788             GCGCACTATGAGACGCTCCGGTACCTGATGATCCACCTCAAGAAG---------------
Xenopus_tropicalis|20641           GCACATTATGAGACTCTCAGGTTCCTGATGATCCATCTGAAGAAG---------------
Erinaceus_europaeus|7699           NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG---------------
Vicugna_pacos|12004                NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG---------------
Dasypus_novemcinctus|12376         NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG---------------
Myotis_lucifugus|13996             GCCCACTATGAGACCCTCCGGTACCTGATGATCCACCTGAAGAAG---------------
Ochotona_princeps|1540             GCCCACTATGAGACCCTGCGATACCTGATGATCCATCTCAAA------------------
Anolis_carolinensis|11713          GCACACTATGAGACTCTTCGATTTCTGATGATTCATCTCAAAAAG---------------
Gallus_gallus|8478                 GCTCACTATGAGACACTTAGATACCTAATGATTCATCTCAAAAAG---------------
Monodelphis_domestica|32218        GCACATTATGAGACGCTCAGATACCTAATGATTCACCTCAAGAAG---------------
Ornithorhynchus_anatinus|18048     GCACATTATGAGACACTCAGATACTTAATGATTCATCTCAAAAAG---------------
Tursiops_truncatus|17458           GCCCACTATGAGACCCTCCGGTACCTGATGATCCACCTAAAGAAG---------------
Bos_taurus|20383                   GCCCACTATGAGACCCTCCGATACCTGATGATCCACCTCAAGAAG---------------
Loxodonta_africana|20466           GCCCACTATGAGACTCTGCGATACCTAATGATCCACCTCAAGAAG---------------
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                GCCCACTACGAGACCCTCCGATACCTGATGATCCACCTTAAGAAG---------------
Microcebus_murinus|8758            GCCCACTATGAGACCCTCCGATACCTGATGATCCACCTCAAAAAG---------------
Sus_scrofa|9306                    GCCCACTATGAGACCCTCCGCTACCTAATGATCCACCTCAAGAAG---------------
Tupaia_belangeri|17337             GCCCACTACGAGACCCTGCGGTACCTAATGATCCATCTCAAAAAG---------------
Mus_musculus|35474                 GCCCACTATGAGACCCTGCGCTACCTGATGATCCACCTGAAAAAG---------------
Rattus_norvegicus|25044            GCCCACTATGAGACCCTGCGCTACCTGATGATCCATCTCAAAAAG---------------
Cavia_porcellus|16884              GCTCACTATGAGACTCTGCGCTACCTAATGATCCATCTCAAAAAA---------------
Callithrix_jacchus|16234           GCCCACTATGAAACCCTCCGGTACCTAATGATCCATCTCAAAAAG---------------
Gorilla_gorilla|27910              GCCCACTATGAAACCCTCCGGTACCTAATGATCCACCTCAAAAAG---------------
Pongo_abelii|25321                 GCCCACTATGAAACCCTCCGGTACCTAATGATCCACCTCAAAAAG---------------
Pan_troglodytes|33528              GCCCACTATGAAACCCTCCGGTACCTAATGATCCACCTCAAAAAG---------------
Rhesus_macaque|26807               GCCCACTATGAAACCCTCCGGTACCTAATGATCCACCTCAAAAAG---------------
Canis_familiaris|5395              GCCCACTATGAGACCCTCCGATACCTGATGATCCACCTCAAGAAG---------------
Pteropus_vampyrus|4823             GCCCACTATGAGACCCTCCGATACTTGATGATTCACCTCAAGAAG---------------
Equus_caballus|20466               GCCCACTATGAGACCCTCAGATACCTAATGATCCACCTCAAGAAA---------------
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG---------------
Branchiostoma_floridae|1548        GCACACTTTCAAACTCTCAGCTTCCTCATGGCGCATTTACACAGA---------------
Ochotona_princeps|13791            GCTCACTGCGAAACCCTCCGCTACCTCATGGCGCATCTTAAAAGA---------------
Tupaia_belangeri|12767             GCTCACTGCGAAACCCTCCGGTACCTCATGGCACATCTAAAGAGGCAAGTTGTAGACTCT
Erinaceus_europaeus|11556          NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Tarsius_syrichta|9123              GCTCACTGCGAAACCCTCCGGTACCTCATGGCGCATCTCAAGAGA---------------
Pteropus_vampyrus|10445            GCTCACTGCGAAACCCTCCGGTACCTCATGGCGCATCTGAAGAGA---------------
Felis_catus|45196                  GCTCACTGCGAAACCCTGCGGTACCTCATGGCGCATCTAAAGAGA---------------
Spermophilus_tridecemlineatus|4303 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Procavia_capensis|2688             GCGCACTGCGAGACCCTCCGGTACCTCATGGCGCATCTAAAGAGA---------------
Dasypus_novemcinctus|1164          GCTCACTGCGAAACTCTTCGGTACCTCATGGCGCACCTAAAGAGA---------------
Otolemur_garnettii|929             GCTCACTGCGAGACCCTTCGGTACCTCATGGCACATCTAAAGAGGCAAGTGACAGACCCA
Oryzias_latipes|10889              GCGCACTGCGAGACGCTGCGATACCTCATGGGTCACCTCAAGAGA---------------
Gasterosteus_aculeatus|1240        GCCCACTGCGAGACGCTGCGATACCTCATGGCTCACCTCAAGAGG---------------
Tetraodon_nigroviridis|12063       gctcaCTATGAGACACTGCGATACCTCATGGCTCATCTGAAGCGG------------TCC
Fugu_rubripes|12054                GCTCACTATGAGACACTGCGATACCTCATGGCTCATCTTAAGAGA------------TCC
Microcebus_murinus|15358           NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Danio_rerio|31268                  GCTCACTGTGAAACACTGCGATACCTCATGGCACACTTGAAAAGG---------------
Xenopus_tropicalis|6414            GCTCACTGTGAAACACTACGGTATCTCATGGCCCATTTGAAAAGG---------------
Cavia_porcellus|24636              GCTCACTGCGAGACCCTGCTGTACCTCATGGCGCATCTAAAGAGA---------------
Rattus_norvegicus|16671            GCCCACTGCGAGACGCTTCGGTACCTCATGGCACACCTCAAGAGA---------------
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           GCACACTGTGAAACCTTACATTACCTCATGGCACATTTAAAGAGG---------------
Gallus_gallus|18740                GCACACTGTGAAACACTGAGGTATCTCATGGCACATTTGAAGAGA---------------
Taeniopygia_guttata|13478          GCACACTGTGAAACATTACGGTATCTCATGGCACATCTGAAGAGA---------------
Dipodomys_ordii|1968               GCTCACTGCGAAACCCTCCGGTACCTGATGGCACATCTAAAGAGA---------------
Mus_musculus|22308                 GCCCACTGCGAGACGCTCCGGTACCTCATGGCGCATCTCAAGAGA---------------
Rattus_norvegicus|22026            GCCCACTGCGAGACGCTCCGGTACCTCATGGCACACCTCAAGAGA---------------
Ornithorhynchus_anatinus|23474     GCACACTGTGAAACCCTCAGATATCTCATGGCACATTTAAAGAGG---------------
Pan_troglodytes|24690              GCTCACTGCGAAACCCTCCGGTACCTCATGGCACATCTAAAGAGA---------------
Monodelphis_domestica|19121        GCACACTGTGAAACGCTCCGGTATCTCATGGCACATTTAAAGAGG---------------
Echinops_telfairi|12695            GCGCACTGCGAAACCCTGCGCCACCTCATGGGGCATCTGAAGAGG---CAAGTCACACGC
Cavia_porcellus|12568              GCTCACTGCGAGACCCTGCGGTACCTCATGGCGCATCTAAAGAGA---------------
Bos_taurus|11426                   GCTCACTGCGAAACCCTCCGGTACCTCATGGCGCATCTGAAGAGA---------------
Vicugna_pacos|6873                 GCTCACTGCGAGACCCTCCGGTACCTCATGGCGCATCTGAAGAGA---------------
Pongo_abelii|18313                 GCTCACTGCGAAACCCTCCGGTACCTCATGGCACATCTAAAGAGA---------------
Gorilla_gorilla|11189              GCTCACTGCGAAACCCTCCGGTACCTCATGGCACATCTAAAGAGA---------------
Homo_sapiens|48422                 GCTCACTGCGAAACCCTCCGGTACCTCATGGCACATCTAAAGAGA---------------
Callithrix_jacchus|22501           GCTCACTGCGAAACCCTCCGATACCTCATGGCACATCTAAAGAGA---------------
Rhesus_macaque|9284                GCTCACTGCGAAACCCTCCGGTACCTCATGGCACATCTAAAGAGA---------------
Canis_familiaris|20431             GCTCACTGCGAGACGCTGCGGTACCTCATGGCGCACCTCAAGAGA---------------
Choloepus_hoffmanni|3438           GCTCACTGCGAAACGCTTCGGTACCTCATGGCGCATCTAAAGAGA---------------
Loxodonta_africana|14241           GCTCACTGCGAAACCCTCCGGTACCTCATGGCGCATCTGAAGAGA---------------
Sorex_araneus|10550                GCCCACTGCGAGACCCTCCGGTACCTCATGGCGCATCTAAAGAGGCAAGTCACAGGCTTT
Tursiops_truncatus|357             GCTCACTGCGAAACCCTCCGGTATCTCATGGCGCATCTAAAGAGA---------------
                                                                                               

Ixodes_scapularis|17566            ---GTGTCGGAGCACCAGAAGAAGAACCTCATGTCCCCGAAGAACCTGAGCACGGTGTTC
Caenorhabditis_elegans|9662        ---GTGGCAGATCACAGTGCAAAAAACAAGATGACCGTCGAAAATCTGGCGACAATTTTC
Daphnia_pulex|23786                ---ATAGCAGAGAACAAAGAAAAGAATAAGATGTCGTCTCTGAATTTGAGTACGGTTTGG
Tribolium_castaneum|7722           ---GTGTCTTTACATTCGGCAATAAATAAAATGAATTCTCACAACTTGGCAACTGTTTTT
Bombyx_mori|1440                   ---GTGTCCCAACAAGCAGAGGTTAATAAGATGAGCGCTCACAATTTGAGTACCGTTTTC
Culex_quinquefasciatus|8347        ---ATCTCTTCACACCATGCAATCAACAAGATGAATGAACAGAATCTGGCCACGGTGTTT
Drosophila_willistoni|6759         ---GTGGCCTCCCATTACGCCGTAAATAAAATGAATGAGCACAATTTGGCTACTGTATTT
Drosophila_persimilis|9372         ---GTGGCCTCCCACTATGCCGTCAACAAGATGAACGAGCACAATCTGGCCACTGTGTTC
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          ---GTGGCCTCCCACTACGCCGTGAACAAGATGAACGAGCACAACCTGGCCACCGTGTTT
Pediculus_humanus|1518             ---GTTGTCGAAAGACACGAGTTTACTAAAATGACGACTTTAAACATGGCGACGGTTTTC
Nematostella_vectensis|14687       ---GTGTCACAAAGGCGCAGTAAAAACATGATGACGGAAGAGAACCTTTCCATCGTGTTT
Callithrix_jacchus|17478           ---GTGACACTCCATGAAAAGGAGAATCTTATGAACGCGGATTATGCTGGAATTGTCTTT
Otolemur_garnettii|5617            ---GTTACTAAGAATGAAAAGGACAATTTAATGAATGCCGAAAATCTGGGGATCGTGTTT
Tarsius_syrichta|890               ---GTTACTATGAATGAAAAGGAT---TTCATGAATGCGGAAAACCTGGGGATCGTGTTT
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       ---GTGACGCAGTTTGAAAAGGACAATTTCATGAATGCCGAGAACCTGGGGATCGTCTAT
Oryzias_latipes|7013               ---GTAACTATGTTTGAAAAGTACAATTTAATGAGTGCTGAGAACCTGGGGATCGTTTTC
Fugu_rubripes|14746                ---GTGACGCTGTTTGAAAAGTACAATTTAATGAACGCTGAGAACCTGGGCATCGTCTTC
Tetraodon_nigroviridis|16104       TTTTGTGTGTTGCAGGGTGACCATGACGCCGAGACCTGGGATCGTCTTGGT---------
Spermophilus_tridecemlineatus|2344 ---GTTACTATGAATGAAAAAGACAATTTCATGAATGCAGAAAATCTGGGGATCGTGTTT
Danio_rerio|9306                   ---GTCACAATGTACGAGAAGGACAATTACATGAATTCAGAGAACCTCGGAATCGTTTTT
Choloepus_hoffmanni|11191          ---GTAACTATGAATGAAAAGGACAATTTCATGAATGCAGAAAATCTTGGGATCGTGTTC
Felis_catus|38196                  ---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Dipodomys_ordii|13518              ---GTGACTATGAATGAAAAGGACAATTTCATGAATGCAGAAAATCTGGGGATAGTGTTT
Echinops_telfairi|2788             ---GTGACCGTGAACGAAAAGGACAATTTCATGAATGCAGAAAACCTGGGCATTGTGTTT
Xenopus_tropicalis|20641           ---GTTGCACTGAATGAGAAGGATAACTTGATGGGATCAGAGAACCTGGGGATAGTGTTT
Erinaceus_europaeus|7699           ---GTGACCATGAATGAGAAGGATAATCTCATGAATGCCGAAAATTTGGGGATTGTGTTT
Vicugna_pacos|12004                ---GTGACTCTGAATGAAAAGGACAATTTAATGAATGCTGAAAATCTGGGGATCGTGTTC
Dasypus_novemcinctus|12376         ---GTGACCCTGAATGAAAAGGACAATTTCATGAATGCAGAAAACCTGGGGATCGTGTTT
Myotis_lucifugus|13996             ---GTGACCATGAATGAAAAGGACAATTTCATGAACGCCGAGAACCTGGGGATCGTGTTT
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          ---ATTACAATGAATGAAAAAGATAATTTTATGAGTGCTGAAAATCTGGGAATTGTGTTT
Gallus_gallus|8478                 ---GTTACTTTGCATGAAAAGGAGAATTTTATGAATGCTGAAAACCTGGGAATAGTGTTT
Monodelphis_domestica|32218        ---GTGACGCTGAATGAGAAGGAGAACTTCATGAACGCGGAGAACCTGGGGATCGTGTTT
Ornithorhynchus_anatinus|18048     ---GTCACCTTGAATGAAAAAGAGAATTTCATGAATGCTGAAAACCTCGGAATCGTATTT
Tursiops_truncatus|17458           ---GTGACTCTGAATGAAAAGGACAATTTCATGAATGCTGAAAATCTGGGGATCGTATTT
Bos_taurus|20383                   ---GTGACTATGAATGAAAAGGACAATTTCATGAATGCTGAAAATCTGGGGATCGTGTTT
Loxodonta_africana|20466           ---GTGACTATGAATGAAAAGGACAATCTCATGAATGCAGAAAACCTGGGCATCGTGTTT
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                ---GTGACGATGAATGAAAAGGACAATTTCATGAATGCTGAAAACCTGGGGATCGTGTTT
Microcebus_murinus|8758            ---GTGACTATGAATGAAAAGGACAATTTAATGAATGCAGAGAATCTGGGGATCGTGTTC
Sus_scrofa|9306                    ---GTGACTCTGAATGAAAAGGACAATTTCATGAATGCTGAAAACCTGGGGATCGTGTTC
Tupaia_belangeri|17337             ---GTGACCATGAATGAAAAGGACAATTTCATGAATGCGGAAAATCTGGGGATCGTGTTT
Mus_musculus|35474                 ---GTTACCATGAATGAAAAGGACAATTTAATGAATGCCGAAAATCTGGGGATCGTGTTT
Rattus_norvegicus|25044            ---GTTACCATGAATGAAAAGGACAATTTAATGAACGCAGAAAATCTGGGGATCGTGTTT
Cavia_porcellus|16884              ---GTTACTATGAATGAAAAGGACAATTTAATGAATGCAGAAAACCTGGGAATTGTGTTT
Callithrix_jacchus|16234           ---GTTACTATGAATGAAAAAGATAATTTTATGAATGCAGAAAATCTGGGGATCGTGTTT
Gorilla_gorilla|27910              ---GTTACTATGAATGAAAAAGACAATTTCATGAATGCAGAAAATCTGGGGATCGTGTTT
Pongo_abelii|25321                 ---GTTACTATGAATGAAAAAGACAATTTCATGAATGCAGAAAATCTGGGGATCGTGTTT
Pan_troglodytes|33528              ---GTTACTATGAATGAAAAAGACAATTTCATGAATGCAGAAAATCTGGGGATCGTGTTT
Rhesus_macaque|26807               ---GTTACTATGAATGAAAAAGACAATTTCATGAATGCAGAAAATCTGGGGATCGTGTTT
Canis_familiaris|5395              ---GTGACTATGAATGAGAAGGACAATTTCATGAATGCTGAAAATCTGGGGATCGTGTTT
Pteropus_vampyrus|4823             ---GTGACTATGAATGAAAAGGACAATTTTATGAATGCTGAAAATCTGGGGATTGTGTTT
Equus_caballus|20466               ---GTGACTATGAATGAAAAAGACAATTTCATGAACGCTGAAAATCTGGGGATCGTGTTT
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              ---GTAACCCTTCATGAAAAGGAGAACCTCATGAATGCTGAGAATCTTGGAATTGTCTTT
Branchiostoma_floridae|1548        ---GTTGCAAAATGTGAGAAGTTTAATCTGATGACTGCAGAGAACCTGGGGATGGTGTGG
Ochotona_princeps|13791            ---GTGACCCTACATGAAAAGGAGAACCTTATGAATGCAGAGAACCTTGGAATTGTTTTC
Tupaia_belangeri|12767             GAAGTGACCCTGCATGAGAAAGAGAACCTGATGAACGCAGAGAACCTCGGGATCGTCTTT
Erinaceus_europaeus|11556          NNAGTGACTCTCCACAAAAAGGAG---CTCATAAATGCAGAGAACCTTGGAATTGTGTTC
Tarsius_syrichta|9123              ---GTGACCCTCCACGAAAAGGAGAATCTTATGAATGCAGAGAACCTTGGCATCGTCTTT
Pteropus_vampyrus|10445            ---GTCACCCTCCATGAAAAGGAGAATCTTATGAATGCAGAAAACCTTGGAATTGTTTTT
Felis_catus|45196                  ---GTGACCCTCCACGAGAAGGAGAATCTTATGAATGCAGAGAACCTCGGCATTGTTTTC
Spermophilus_tridecemlineatus|4303 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Procavia_capensis|2688             ---GTGACGCTTCATGAAAAGGAGAACCTTATGAATGCAGAAAACCTTGGAATTGTTTTT
Dasypus_novemcinctus|1164          ---GTGACCCTCCACGAAAAGGAGAATCTCATGAATGCAGAGAACCTTGGAATTGTTTTT
Otolemur_garnettii|929             CAAGTGACCCTCCATGAGAAGGAGAACCTTATGAACGCAGAGAACCTTGGCATTGTCTTT
Oryzias_latipes|10889              ---GTCACCCAGTACGAGAAGGAAAACCTGATGTCCAGCGAGAACCTGGGGATCGTCTTC
Gasterosteus_aculeatus|1240        ---GTGACCGAGTACGAGAAGGAGAACCTCATGTCCAGCGAGAACCTGGGAATCGTCTTC
Tetraodon_nigroviridis|12063       AGAGTGGTCCAGCATGAAAAAGACAACCTGATGTCCAGTGAGAACCTGGGCATCGTGTTC
Fugu_rubripes|12054                AGGGTGATCCACTGTGAGAAAGAGAACCTCATGTCCAGCGAGAACTTGGGCATCGTGTTT
Microcebus_murinus|15358           NNAGTGACCCTCCATGAAAAGGAGAATCTTATGAACGCGGAGAATCTTGGAATCGTCTTT
Danio_rerio|31268                  ---GTCACTCAGAATGAGAAGGATAACCTGATGAACGCCGAAAACCTCGGGATCGTCTTC
Xenopus_tropicalis|6414            ---GTGACTCTACATGAGAAGGACAATTTAATGAGTGCAGAGAACCTTGGTATTGTGTTC
Cavia_porcellus|24636              ---GTGACTCTCCACGAAAAGGAGAATCTCATGAATGCAGAGAACCTTGGAATCGTCTTC
Rattus_norvegicus|16671            ---GTGACCCTTCACGAGAAGGAGAATCTGATGAGTGCAGAGAACCTTGGGATTGTGTTT
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           ---GTAACACTCCATGAAAAAGAGAATCTCATGAACTCGGAGAACCTTGGCATCGTTTTT
Gallus_gallus|18740                ---GTAACGCTTCACGAAAAGGAAAATCTGATGAGTGCAGAGAACCTGGGCATCGTGTTT
Taeniopygia_guttata|13478          ---GTAACGCTCCATGAAAAGGAAAACCTGATGAGTGCAGAAAACCTGGGCATAGTTTTT
Dipodomys_ordii|1968               ---GTGACCCTCCATGAGAAGGAGAATCTGATGAGTGCAGAGAACCTTGGGATAGTGTTT
Mus_musculus|22308                 ---GTGACCCTTCATGAGAAGGAGAATCTGATGAGTGCAGAGAACCTTGGGATCGTGTTT
Rattus_norvegicus|22026            ---GTGACCCTTCACGAGAAGGAGAATCTGATGAGTGCAGAGAACCTTGGGATCGTGTTT
Ornithorhynchus_anatinus|23474     ---GTAACCCTTCATGAAAAGGAGAATCTCATGAATGCAGAGAACCTTGGGATAGTGTTT
Pan_troglodytes|24690              ---GTGACCCTCCACGAAAAGGAGAATCTTATGAATGCAGAGAACCTTGGAATCGTCTTT
Monodelphis_domestica|19121        ---GTAACTCTTCATGAAAAGGAGAACCTCATGAATGCCGAGAATCTTGGAATTGTCTTT
Echinops_telfairi|12695            CGAGTGACCCTTCACGAGAAGGAGAATCTTATGAATGCAGAGAACCTTGGGATCGTTTTT
Cavia_porcellus|12568              ---GTGACTCTCCACGAAAAGGAGAATCTCATGAATGCAGAGAACCTGGGAATCGTCTTC
Bos_taurus|11426                   ---GTCACCCTCCATGAAAAGGAGAATCTGATGAATGCAGAGAACCTTGGGATTGTTTTC
Vicugna_pacos|6873                 ---GTGACCCTCCACGAAAAGGAGAACCTGATGAAC------------------------
Pongo_abelii|18313                 ---GTGACCCTCCACGAAAAAGAGAATCTTATGAATGCAGAGAACCTTGGAATTGTCTTT
Gorilla_gorilla|11189              ---GTGACCCTCCATGAAAAGGAGAATCTTATGAATGCAGAGAACCTTGGAATCGTCTTT
Homo_sapiens|48422                 ---GTGACCCTCCACGAAAAGGAGAATCTTATGAATGCAGAGAACCTTGGAATCGTCTTT
Callithrix_jacchus|22501           ---GTGACCCTCCATGAAAAGGAGAATCTTATGAATGCAGAGAACCTTGGAATCGTCTTT
Rhesus_macaque|9284                ---GTGACCCTCCACGAAAAGGAGAATCTTATGAATGCAGAGAACCTTGGAATCGTCTTT
Canis_familiaris|20431             ---GTGACCCTCCACGAGAAGGAGAACCTTATGAACGCAGAGAACCTCGGCATCGTGTTC
Choloepus_hoffmanni|3438           ---GTGACCCTCCATGAGAAAGAGAATCTCATGAATGCAGAGAACCTTGGAATTGTTTTT
Loxodonta_africana|14241           ---GTGACCCTTCATGAAAAGGAGAATCTTATGAATGCAGAGAACCTTGGAATTGTTTTT
Sorex_araneus|10550                GAAGTGACCCTCCACGAAAAGGAGAATCTCATGAACGCAGAGAACCTGGGGATTGTTTTT
Tursiops_truncatus|357             ---GTGACCCTTCACGAAAAGGAGAATCTGATGAATGCAGAGAACCTTGGGATTGTTTTC
                                                                                               

Ixodes_scapularis|17566            TCTCCAACGGTGATGCGCACTCCGGAC---ATCATGGGCATGGGGCTGGACCAGATGAGT
Caenorhabditis_elegans|9662        TCGCCGACACTCTTCTGCTCG------------------GGCTCCATACCCGCCATGCCG
Daphnia_pulex|23786                TGCCCCACCTTATTTCCTGGACCTGATTTGCAAGAAATTAACAGTACCGGATCAATACCC
Tribolium_castaneum|7722           GCCCCAACTCTGATTGGACCAAGCGAA------------TCTGCAAGCGACGTAATGCCT
Bombyx_mori|1440                   GCGCCAACACTAGTAGCTACTCCGCCC------------------------GCCATCACC
Culex_quinquefasciatus|8347        GCCCCAACGCTCATAGAAACTCCGCCG------------------------CACATGACC
Drosophila_willistoni|6759         GCGCCCACATTGATAGCCACACCACAG------------------------CATATGACA
Drosophila_persimilis|9372         GCCCCCACTTTGATAGCCACGCCGCAG------------------------CACATGACA
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          GCGCCGACCCTGATTGCCACGCCCCAG------------------------CACATGACC
Pediculus_humanus|1518             GCTCCGACATTAATGCCGGTACCTGAT---------------CTCAGTAAAGGTATCCCA
Nematostella_vectensis|14687       GGGCCGACGCTTATGCGTGCCCCAGAA---------GGCGACTCCCTTGACTCACTGGTG
Callithrix_jacchus|17478           GTCCCAACCTTTCTGAGATCTCCAGAC---------CAAAACACCATGGCTGCACTGAAC
Otolemur_garnettii|5617            GGGCCCACCTTGATGAGGCCCCCCGAG---------GACAGCACCCTGACCACCCTCCAC
Tarsius_syrichta|890               GGG---ACCCTGATGAGGCCC---------------GAGGACAGCACCCTCACCCTTCAT
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       GGTCCAACGCTCATGCAGCCACCAGAG---------CAGAATGCCTTGACAACCCTGAAT
Oryzias_latipes|7013               GGCCCAACTCTGATGCAGGCGCCGGAG---------CAGAACGCCCTGACAACCCTGAAT
Fugu_rubripes|14746                GGTCCCACGCTGATGCAGCCGCCGGAG---------ATGAACGCACTGACGACCCTGAAT
Tetraodon_nigroviridis|16104       ---CCCACGCTCATGCAGCCACCGGAG---------ATGAATGCTCTGACATCCCTGAAT
Spermophilus_tridecemlineatus|2344 GGGCCCACCTTGATGAGGCCCCCTGAG---------GACAGCACTCTCACCACCCTCCAT
Danio_rerio|9306                   GGCCCAACGCTCATGAGGCCACCAGAC---------CTGAACACACTCACCACTCTCAAC
Choloepus_hoffmanni|11191          GGGCCCACCCTAATGAGGCCCCCTGAA---------GACAGTACCCTCACCACCCTCCAT
Felis_catus|38196                  NNNNNNNNNNNNNNNNNNNNNNNNNNN---------NNNNNNNNNNNNNNNNNNNNNCAG
Dipodomys_ordii|13518              GGGCCCACGCTGATGAGGCCTCCCGAG---------GACAGCACCCTCACCACGCTCCAT
Echinops_telfairi|2788             GGGCCTACCCTGATGCGGCCCCCGGAG---------GACAGCACCCTGACCACCCTGCAC
Xenopus_tropicalis|20641           GGCCCAACACTGATGAGGCCTCCAGAA---------GAGAATGCACTCGCCTCTCTAAAT
Erinaceus_europaeus|7699           GGCCCCACCTTAATGAGACCCCCTGAG---------GACAGCACCCTCACCACCCTCCAT
Vicugna_pacos|12004                GGGCCCACTCTGATGAGGCCCCCTGAG---------GACAGCACCCTCACCACCCTCCAT
Dasypus_novemcinctus|12376         GGGCCCACCTTAATGAGGCCCCCTGAG---------GACAGCACCCTCACCACCCTCCAC
Myotis_lucifugus|13996             GGGCCCACCCTGATGAGGCCGCCGGAG---------GACAGCATGCTCACCACCCTCCAT
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          GGACCCACTTTAATGAGACCTCCAGAA---------GACAGCACCCTTGCTACTCTCAAT
Gallus_gallus|8478                 GGGCCTACTTTAATGAGACCTCCAGAG---------GACAGTACCTTGGCTACTCTGAAT
Monodelphis_domestica|32218        GGCCCCACCTTGATGCGGCCCCCGGAG---------GAGAGCACCCTCGCCACCCTCAAC
Ornithorhynchus_anatinus|18048     GGGCCCACCTTAATGCGGCCCCCCGAG---------GACAGCACCTTGGCCACCCTCAAC
Tursiops_truncatus|17458           GGGCCCACCCTGATGAGGCCCCCTGAG---------GACAGTACCCTCACCACCCTCCAT
Bos_taurus|20383                   GGGCCCACCCTGATGAGACCTCCTGAG---------GACAGCACCCTCACCACCCTCCAT
Loxodonta_africana|20466           GGGCCCACCCTGATGAGGCCCCCGGAG---------GACAGCACCCTGACCACCCTCCAT
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                GGGCCCACGCTGATGAGACCCCCCGAG---------GACAGCACCCTCACTACCCTCCAC
Microcebus_murinus|8758            GGGCCCACCTTGATGAGGCCCCCCGAG---------GACAGCACTCTGACCACCCTCCAC
Sus_scrofa|9306                    GGGCCCACCTTGATGAGGCCCCCCGAG---------GACAGCACCCTCACCACCCTCCAC
Tupaia_belangeri|17337             GGACCCACTCTGATGAGGCCCCCCGAG---------GACAGCACCCTGACCACCCTCCAC
Mus_musculus|35474                 GGGCCCACCCTGATGAGACCCCCTGAG---------GACAGCACCCTCACCACCCTCCAT
Rattus_norvegicus|25044            GGGCCCACCCTGATGAGACCCCCTGAA---------GACAGCACCCTCACCACCCTCCAT
Cavia_porcellus|16884              GGGCCCACCCTGATGAGACCACCCGAG---------GACAGCACACTTACAACCCTCCAC
Callithrix_jacchus|16234           GGGCCCACGCTGATGAGGCCCCCCGAG---------GATAGCACCCTTACCACCCTGCAC
Gorilla_gorilla|27910              GGGCCCACTCTGATGAGGCCCCCTGAG---------GACAGCACCCTTACCACCCTGCAT
Pongo_abelii|25321                 GGGCCCACTCTGATGAGGCCCCCTGAG---------GACAGCACCCTTACCACCCTGCAT
Pan_troglodytes|33528              GGGCCCACTCTGATGAGGCCCCCTGAG---------GACAGCACCCTTACCACCCTGCAT
Rhesus_macaque|26807               GGGCCCACTCTGATGAGGCCCCCTGAG---------GACAGCACCCTTACCACCCTGCAT
Canis_familiaris|5395              GGGCCCACACTGATGAGGTCCCCTGAG---------GACAGCACCCTCACCACCCTCCAT
Pteropus_vampyrus|4823             GGGCCCACCCTGATGAGACCCCCTGAG---------GACAGCACACTCACCACTCTCCAC
Equus_caballus|20466               GGGCCCACCCTGATGAGGCCCCCTGAG---------GACAGCACCCTTACCACCCTCCAC
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              GGACCCACCCTCATGAGATCCCCAGAA---------TTAGATGCAATGGCGGCCCTGAAT
Branchiostoma_floridae|1548        GGCCCGACGCTCATGAGACTCGCAGAC---------ACGAACTCACTAGCCGGGCTCACG
Ochotona_princeps|13791            GGCCCAACCCTCATGAGGTCTCCCGAG---------CTGGACGCAATGGCCGCCTTGAAT
Tupaia_belangeri|12767             GGCCCTACCCTCATGAGATCTCCAGAA---------CTAGACGCGATGGCTGCATTGAAT
Erinaceus_europaeus|11556          TGCCCAACCCTCATG---TCTCCGGAA------------------CTCGGCGCGATTGCT
Tarsius_syrichta|9123              GGCCCAACCCTCATGAGGTCTCCAGAA---------CTAGACGCCATGGCTGCACTGAAC
Pteropus_vampyrus|10445            GGCCCAACCCTCATGAGATCTCCAGAA---------CTAGACGCGATGGCTGCATTGAAT
Felis_catus|45196                  GGCCCGACCCTTATGAGATCTCCAGAA---------CTAGACGCGATGGCCGCGTTGAAC
Spermophilus_tridecemlineatus|4303 NNNNNNNNNNNNNNNNNNNNNNNNNNN---------NTAGACGCAATGGCGGCA---AAC
Procavia_capensis|2688             GGGCCCACTCTAATGAGATCTCCAGAG---------CTGGACGCCATGGCTGCGCTGAAT
Dasypus_novemcinctus|1164          GGCCCAACCCTTATGAGATCTCCAGAA---------CTAGATGCAATGGCTGCATTGAAT
Otolemur_garnettii|929             GGCCCAACCCTCATGAGATCTCCGGAA---------CTAGATGCCATGGCTGCATTGAAC
Oryzias_latipes|10889              GGCCCCACGCTGATGCGGGCCCCCGGC---------CTGGACGCCATGACGGCGCTCAAC
Gasterosteus_aculeatus|1240        GGCCCGACCCTGATGAGGGCCCCCGGG---------CTGGACGCCATGACGGCGCTCAAC
Tetraodon_nigroviridis|12063       GGCCCGACGCTGATGAGGGCCCCAGAC---------CTGGACGCCATGACAGCCCTTAAC
Fugu_rubripes|12054                GGCCCGACCCTGATGAGGGCCCCAGAC---------CTGGATGCCATGACAGCCCTTAAC
Microcebus_murinus|15358           GGCCCAACCCTCATGAGATCTCCGGAA---------CTAGACGCCATGGCCGCACTGAAT
Danio_rerio|31268                  GGGCCGACTTTAATGCGGGCTCCAGAC---------CTGGACGCCATGACGGCTCTAAAC
Xenopus_tropicalis|6414            GGCCCAACTCTCATGCGAGCCCCGGAA---------CAAGATGCCATGGCGGCACTGAAT
Cavia_porcellus|24636              GGTCCGACCCTCATGAGGTCCCCAGAA---------CAAGACGTGATGGCTGCTTTGAAT
Rattus_norvegicus|16671            GGTCCAACCCTCATGAGATCACCAGAG---------TTAGACCCCATGGCCGCCCTGACT
Myotis_lucifugus|15927             ------------------------------------------------------------
Anolis_carolinensis|6157           GGGCCGACACTAATGCGAGCACCAGAG---------CTTGATGCAATGGCTGCCCTGAAT
Gallus_gallus|18740                GGACCAACTCTTATGAGAGCGCCAGAA---------CTGGATGCGATGGCTGCGCTGAAC
Taeniopygia_guttata|13478          GGACCAACTCTTATGAGAGCGCCGGAG---------CTGGACGCGATGGCTGCGCTGAAC
Dipodomys_ordii|1968               GGTCCAACTCTTATGAGATCCCCAGAA---------CTAGACGCCATGGCTGCACTGAAT
Mus_musculus|22308                 GGACCAACCCTCATGAGATCCCCAGAG---------CTCGACCCCATGGCCGCCCTGAAC
Rattus_norvegicus|22026            GGTCCAACCCTCATGAGATCACCAGAG---------CTAGACCCCATGGCCGCCCTGAAC
Ornithorhynchus_anatinus|23474     GGACCGACCCTCATGAGATCCCCGGAA---------CAAGATGCGATGGCAGCACTCAAT
Pan_troglodytes|24690              GGACCCACCCTTATGAGATCTCCAGAA---------CTAGACGCTATGGCTGCATTGAAT
Monodelphis_domestica|19121        GGACCCACCCTCATGAGATCCCCAGAA---------CTAGATGCAATGGCAGCCTTGAAT
Echinops_telfairi|12695            GGACCAACCCTGATGAGATCTCCGGAA---------CTAGACGCCATGGCAGCGCTGAAC
Cavia_porcellus|12568              GGTCCGACCCTCATGAGGTCCCCAGAA---------CAAGACGCGATGGCTGCTTTGAAT
Bos_taurus|11426                   GGCCCGACACTCATGAGATCTCCAGAG---------CTAGACGCCATGGCTGCCCTGAAC
Vicugna_pacos|6873                 ------------------------------------------------------------
Pongo_abelii|18313                 GGACCCACCCTTATGAGATCTCCAGAA---------CTAGACGCCATGGCTGCATTGAAT
Gorilla_gorilla|11189              GGACCCACCCTTATGAGATCTCCAGAA---------CTAGACGCCATGGCTGCATTGAAT
Homo_sapiens|48422                 GGACCCACCCTTATGAGATCTCCAGAA---------CTAGACGCCATGGCTGCATTGAAT
Callithrix_jacchus|22501           GGACCAACCCTTATGAGATCTCCAGAA---------CTAGACGCCATGGCTGCATTGAAT
Rhesus_macaque|9284                GGACCCACCCTTATGAGATCTCCAGAA---------CTAGATGCCATGGCTGCATTGAAT
Canis_familiaris|20431             GGCCCGACCCTTATGAGATCTCCAGAG---------CTGGACGCGATGGCCGCGTTGAAC
Choloepus_hoffmanni|3438           GGCCCAACCCTTATGAGGTCTCCAGAA---------CTAGATGCAATGGCTGCATTGAAT
Loxodonta_africana|14241           GGACCAACTCTTATGAGATCCCCAGAA---------CTAGACGCGATGGCTGCGTTGAAT
Sorex_araneus|10550                GGTCCGACCCTCATGCGGTCTCCAGAG---------CAGGACGCCATGGCAGCCCTGAAT
Tursiops_truncatus|357             GGCCCAACCCTCATGAGATCTCCCGAA---------CTAGACGCCATGGCTGCCCTGAAC
                                                                                               

Ixodes_scapularis|17566            GCCTGGCACACGGAGAGTGCCGTCGTGGAGCTGCTCATCAGCTACAATCGGACTGTGTTC
Caenorhabditis_elegans|9662        AAC------------CATCAGCTGCTCCATTTTCTGATCAATAATCCACGTGTCGTGCCG
Daphnia_pulex|23786                GACTTTCACCTTGAAGCTACTTCACTGGACGTCATGATCAGACAACCCCATTTGATTTTT
Tribolium_castaneum|7722           GATATGACAAGTGATATTTTATTAATTGAAACTCTCATCACACATTGTGAACGTATTTTT
Bombyx_mori|1440                   GACCTAGCCTTCGAGATTCGAGCTCTTCAGATATTGATTGAGCACTGTCCACAAATATAC
Culex_quinquefasciatus|8347        GATTTGTCTCAGGAAATTAATATGCTTACTGCCTTAATTACGCACTGTCACGCTGTTTTC
Drosophila_willistoni|6759         AATCTCACGGAGGAGATATTCATGCTATCCTCATTGATTCAACATTGTGAGACAATATTT
Drosophila_persimilis|9372         AACCTGACCGAGGAAATATTCATGCTCTCCTCGCTGATCACCCACTGCAAGATTATATTT
Drosophila_melanogaster|20217      ------------------------------------------------------------
Drosophila_simulans|12658          AACCTGACGGAGGAGATCTTCATGCTCTCCTCGCTCATCACCCACTGCAAGACTATATTC
Pediculus_humanus|1518             TCGGTGGTAAACGAAATAACCACATTGGAAAAA---------------------------
Nematostella_vectensis|14687       GACATGAAGTTCCAGAGACTCGCCGTGGAGCTTCTAATATCACATCAACACGTGCTCTTC
Callithrix_jacchus|17478           CACATGCGGTATCAGCAGCTGCTGGTGAAACTGCCTGTCAAAAACAGAGACGTTTTACCT
Otolemur_garnettii|5617            GACATGCGGTACCAAAAGCTCATTGTGCAGATCCTAATCGAAAATGAAGATGTTTTGTTT
Tarsius_syrichta|890               GACATGCGGTACCAAAAGCTG---------------------------------------
Macropus_eugenii|10045             ------------------------------------------------------------
Gasterosteus_aculeatus|27934       GACATGCGGCAGCAGAAACTAGTGGTGCAGCTCATGATAGAGCATGAAGACGTCTTATTC
Oryzias_latipes|7013               GACATGAGGCAGCAAAAACTTGTGGTGCAGCTTATGATAGAGCATGAAGATGTCTTATTT
Fugu_rubripes|14746                GACATGAGACTGCAGAAGCTGGTGGTGCAGCTCATGATCGAGCACGAAGACGTCTTGTTC
Tetraodon_nigroviridis|16104       GACATGAGGCTGCAGAAGCTGGTGGTGCAGCTCATGATCGAGCATGAAGACGTCTTGTTC
Spermophilus_tridecemlineatus|2344 GACATGCGGTACCAAAAGCTGATTGTGCAAATTTTAATAGAAAACGAAGATGTTTTGTTC
Danio_rerio|9306                   GACATGAGATACCAAAAACTGATAGTTCAGCTCCTCATCGAGCACGAGGACATCTTGTTT
Choloepus_hoffmanni|11191          GACATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAACGAAGATGTTTTGTTT
Felis_catus|38196                  GACATGCGGTACCAAAAGTTGATTGTGCAGATTTTAATAGAAAATGAAGATGTTTTGTTT
Dipodomys_ordii|13518              GACATGCGGTACCAGAAGCTTATCGTGCAGATTTTAATAGAAAATGAAGATGTTTTGTTC
Echinops_telfairi|2788             GACATGCGGTACCAGAAGCTGATTGTGCAGCTGCTGATAGAAAACGAGGATGTTTTGTTT
Xenopus_tropicalis|20641           GACATGAGACACCAGAAGCAAATCGTGCAACTTCTAATACAGAATGAAGACGTTTTGTTC
Erinaceus_europaeus|7699           GACATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAATGAAGATGTTTTGTTC
Vicugna_pacos|12004                GACATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAACGAAGATGTTCTGTTT
Dasypus_novemcinctus|12376         GACATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAACGAAGATGTTTTGTTT
Myotis_lucifugus|13996             GACATGCGGTACCAGAAGCTGATTGTGCAGATTCTAATAGAAAACGAAGATGTTTTGTTT
Ochotona_princeps|1540             ------------------------------------------------------------
Anolis_carolinensis|11713          GACATGCGGTACCAGAAGCTGATTGTACAGATATTAATAGAAAATGAAGATGTTTTGTTT
Gallus_gallus|8478                 GACATGCGGTACCAGAAGCTAATTGTGCAAATTTTAATAGAAAATGAAGATGTTCTCTTT
Monodelphis_domestica|32218        GACATGCGGTACCAGAAGCTCATCGTACAGATCTTAATAGAGAATGAAGATGTGTTGTTC
Ornithorhynchus_anatinus|18048     GACATGAGGCACCAGAAGCTGATCGTGCAGATTTTAATAGAAAACGAAGATGTTTTGTTT
Tursiops_truncatus|17458           GACATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAACGAAGATGTTTTGTTT
Bos_taurus|20383                   GACATGCGGTACCAAAAGCTGATTGTGCAGATCTTAATAGAAAATGAAGATGTTTTGTTT
Loxodonta_africana|20466           GACATGCGGTACCAGAGGCTGATCGTGCAGATTTTAGTAGAGAACGAAGATGTTTTGTTT
Procavia_capensis|1128             ------------------------------------------------------------
Sorex_araneus|13650                GATATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAACGAAGATGTTTTGTTT
Microcebus_murinus|8758            GACATGCGGTACCAAAAGCTGATTGTGCAGATTCTAATAGAAAATGAAGATGTTTTGTTT
Sus_scrofa|9306                    GACATGCGGTACCAAAAGCTAATTGTGCAGATTTTAATAGAAAACGAAGATGTTTTGTTC
Tupaia_belangeri|17337             GACATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAACGAAGATGTGTTGTTT
Mus_musculus|35474                 GACATGCGGTACCAAAAGCTGATCGTGCAGATTTTAATAGAAAACGAAGATGTTCTGTTT
Rattus_norvegicus|25044            GACATGCGGTACCAAAAGCTGATCGTGCAGATTTTAATAGAAAACGAAGATGTTCTGTTT
Cavia_porcellus|16884              GACATGCGGTACCAAAAGCTGATTGTGCAGATTTTGATAGAAAACGAAGATGTTTTGTTT
Callithrix_jacchus|16234           GACATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAACGAAGATGTTTTGTTT
Gorilla_gorilla|27910              GATATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAACGAAGACGTTTTATTC
Pongo_abelii|25321                 GATATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAACGAAGATGTTTTATTC
Pan_troglodytes|33528              GATATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAACGAAGATGTTTTATTC
Rhesus_macaque|26807               GATATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAACGAAGACGTTTTATTC
Canis_familiaris|5395              GATATGCGGTACCAAAAGCTGATCGTGCAGATTTTAATAGAAAATGAAGATGTTTTGTTT
Pteropus_vampyrus|4823             GACATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATCGAAAATGAAGATGTTTTGTTT
Equus_caballus|20466               GACATGCGGTACCAAAAGCTGATTGTGCAGATTTTAATAGAAAATGAAGATGTTTTGTTT
Sus_scrofa|7275                    ------------------------------------------------------------
Macropus_eugenii|8027              GATATACGGTATCAGAGACTGGTGGTGGAGATGCTTATCAAAAATGAAGACATTTTATTT
Branchiostoma_floridae|1548        GATCTCAAGTTCCAGAGGAGGGCCGTCGAACTCATGATCAAGTTTCAGGATGCGCTATTC
Ochotona_princeps|13791            GATATCCGGTATCAGAGACTGGTGGTGGAGCTGCTAATCAAAAATGAAGACATTTTATTT
Tupaia_belangeri|12767             GACATACGGTATCAGAGACTGGTGGTGGAGCTGCTGATCAAAAATGAAGACATTTTATTT
Erinaceus_europaeus|11556          GCACTGCCATATCAG---CTGGTGGTAGAGCTGCTTATCAAAAATGAAGACATTTTATTT
Tarsius_syrichta|9123              GATATACGATATCAGAGACTGGTAGTGGAGCTGCTTATC---AATGAAGACATTTTATTT
Pteropus_vampyrus|10445            GATATACGATATCAGAGACTGGTGGTAGAGCTGCTTATCAAAAACGAAGATATTTTATTT
Felis_catus|45196                  GATATACGATACCAGAGACTGGTGGTGGAGCTGCTTATCAAAAACGAAGACATTTTATTT
Spermophilus_tridecemlineatus|4303 GATATACGATACCAGAGACTGGTGGTGGAGCTGCTTATCAAAAATGAAGACATTTTATTT
Procavia_capensis|2688             GACATCCGGTACCAGAGACTGGTGGTGGAGCTGCTCATCAAAAATGAAGACATTTTATTT
Dasypus_novemcinctus|1164          GATATACGATATCAGAGACTGGTGGTGGAGCTCCTTATCAAAAATGAAGACATTTTATTT
Otolemur_garnettii|929 &n