Orthologs Set ID: EOG4006BX

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Apis mellifera 32002 918, 1873, 2373, 2490
Bombyx mori 9277 1071, 1226, 1551, 1749, 1873, 2095, 2286, 2424, 2515, 2589, 2664, 2786, 3307
Bos taurus 9094 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2853
Branchiostoma floridae 16299 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2649
Caenorhabditis elegans 33787 912, 993, 1071, 1131, 1694, 1873, 1945, 2108, 2196, 2286, 2465, 2589, 2688
Callithrix jacchus 28531 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2207, 2224, 2248, 2465, 2589, 2853
Canis familiaris 1414 112, 912, 993, 1074, 1188, 1740, 2174, 2465, 2589, 2941, 2985, 3045, 3144, 3233, 3459, 3555
Cavia porcellus 22880 912, 993, 1074, 1188, 1698, 1873, 1945, 2014, 2095, 2174, 2286, 2334, 2465, 2589, 2853
Culex quinquefasciatus 18189 938, 1077, 1709, 1873, 2286, 2500
Daphnia pulex 29407 993, 1071, 1685, 1749, 1873, 1945, 2095, 2286, 2465, 2497, 2589
Dipodomys ordii 14456 993, 1074, 1188, 1740, 1872, 2465, 2589
Equus caballus 2636 912, 993, 1074, 1188, 1690, 1716, 1850, 1910, 1921, 2010, 2095, 2174, 2286, 2465, 2589, 2853
Erinaceus europaeus 5811 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2192, 2286
Fugu rubripes 44613 2014, 2095, 2174, 2286, 2465, 2589
Fugu rubripes 48313 993, 1074, 1188
Gasterosteus aculeatus 27444 993, 1074, 1188, 1704, 1873, 1945, 2014, 2095, 2337, 2589, 2841
Gorilla gorilla 8768 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2853
Homo sapiens 40066 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2853
Ixodes scapularis 14498 1857
Linepithema humile 1725 1873, 2490
Loxodonta africana 17334 45, 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2619, 2643, 2721, 2853, 3045, 3138, 3244, 3459
Microcebus murinus 16331 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2853, 3042, 3098, 3144, 3282, 3570, 3571, 3642
Monodelphis domestica 33177 1872, 1945, 2014, 2095, 2174, 2286, 2465, 2589
Mus musculus 37917 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2853
Myotis lucifugus 16909 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2631, 2655, 2674, 2712, 2726, 2853, 3042, 3120, 3159, 3228, 3241, 3294, 3459, 3486, 3609, 3630
Nasonia vitripennis 11239 25, 185, 376, 535, 700, 918, 1873, 2490
Nematostella vectensis 15736 993, 1074, 1678, 1749
Nematostella vectensis 15754 1097
Nematostella vectensis 18340 1873, 1945, 2014, 2174, 2253, 2286, 2364, 2397, 2465, 2532, 2589
Ornithorhynchus anatinus 5033 909, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2345, 2465
Oryctolagus cuniculus 22996 129, 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2180, 2286, 2465, 2589, 2856, 2982, 3075
Oryzias latipes 7372 912, 993, 1074, 1188, 1698, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589
Otolemur garnettii 401 2465, 2505, 2565, 2589, 2853, 2919, 3014, 3153, 3546, 3552
Pan troglodytes 19164 993, 1074, 1188, 1698, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2853
Pediculus humanus 10257 912, 1071, 1749, 1873, 2095, 2286, 2465, 3175
Pogonomyrmex barbatus 16523 909, 1931, 2490
Pongo abelii 14165 912, 993, 1074, 1188, 1698, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2853
Procavia capensis 2396 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2853
Pteropus vampyrus 1344 84, 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2853
Rattus norvegicus 1248 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2853
Rhesus macaque 21005 993, 1074, 1188, 1698, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2853
Sorex araneus 9626 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2292, 2468, 2589, 2850, 3018, 3129, 3234, 3239, 3254, 3258, 3285, 3297, 3310, 3327, 3328, 3484, 3494, 3522, 3533, 3552, 3555, 3560, 3582, 3605
Sus scrofa 15748 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2853, 2982
Sus scrofa 15761 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465
Tarsius syrichta 7605 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2853, 2901, 2928, 2961
Tetraodon nigroviridis 15792 993, 1074, 1188
Tetraodon nigroviridis 15797 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589
Tribolium castaneum 9466 912, 1071, 1154, 1873, 2589, 3007
Xenopus tropicalis 9257 912, 993, 1074, 1188, 1740, 1873, 1945, 2014, 2095, 2174, 2286, 2465, 2589, 2862

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Apis mellifera 32002 GB11267-PA apiMel3
Bombyx mori 9277 BGIBMGA011187-TA v2.0
Bos taurus 9094 ENSBTAT00000056129 513015 ENSBTAG00000039015 TMEM145 bosTau4
Branchiostoma floridae 16299 e_gw.38.180.1 braFlo1
Caenorhabditis elegans 33787 C15A7.2, NM_077616 182623 WBGene00007595 C15A7.2 ce6
Callithrix jacchus 28531 ENSCJAT00000025039 100386878 ENSCJAG00000012919 TMEM145 calJac3
Canis familiaris 1414 ENSCAFT00000007792 ENSCAFG00000004834 TMEM145 canFam2
Cavia porcellus 22880 ENSCPOT00000013099 100722600 ENSCPOG00000012974 TMEM145 cavPor3
Culex quinquefasciatus 18189 CPIJ007964-RA 6040534 CPIJ007964 CpipJ1
Daphnia pulex 29407 e_gw1.39.103.1 1.1
Dipodomys ordii 14456 ENSDORT00000007941 ENSDORG00000007941 Tmem145 dipOrd1
Equus caballus 2636 ENSECAT00000001280 ENSECAG00000000962 TMEM145 equCab2
Erinaceus europaeus 5811 ENSEEUT00000005250 ENSEEUG00000005242 TMEM145 eriEur1
Fugu rubripes 44613 ENSTRUT00000003280 101067435 ENSTRUG00000001417 tmem145 (1 of 2) fr2
Fugu rubripes 48313 ENSTRUT00000004233 ENSTRUG00000001825 tmem145 (2 of 2) fr2
Gasterosteus aculeatus 27444 ENSGACT00000004242 ENSGACG00000003235 tmem145 gasAcu1
Gorilla gorilla 8768 ENSGGOT00000030306 101144469 ENSGGOG00000024254 TMEM145 gorGor3
Homo sapiens 40066 ENST00000406159 ENSG00000167619 TMEM145 hg19,GRCh37
Ixodes scapularis 14498 ISCW017640-RA ISCW017640 IscaW1
Linepithema humile 1725 LH23868-RA 1.2
Loxodonta africana 17334 ENSLAFT00000021666 100662455 ENSLAFG00000023281 TMEM145 loxAfr3
Microcebus murinus 16331 ENSMICT00000015212 ENSMICG00000015206 TMEM145 micMur1
Monodelphis domestica 33177 ENSMODT00000024560 100020607 ENSMODG00000019338 TMEM145 monDom5
Mus musculus 37917 ENSMUST00000108409, NM_183311 330485 ENSMUSG00000043843 Tmem145 mm9
Myotis lucifugus 16909 ENSMLUT00000016700 102424465 ENSMLUG00000016682 TMEM145 myoLuc1
Nasonia vitripennis 11239 NV21673-RA 1.2
Nematostella vectensis 18340 gw.194.24.1 Nemve1
Nematostella vectensis 15736 e_gw.194.26.1 Nemve1
Nematostella vectensis 15754 e_gw.185.58.1 Nemve1
Ornithorhynchus anatinus 5033 ENSOANT00000020368 ENSOANG00000012875 TMEM145 ornAna1
Oryctolagus cuniculus 22996 ENSOCUT00000029144 ENSOCUG00000004380 TMEM145 oryCun2.0
Oryzias latipes 7372 ENSORLT00000016988 101158229 ENSORLG00000013550 tmem145 oryLat2
Otolemur garnettii 401 ENSOGAT00000000388 ENSOGAG00000000387 TMEM145 otoGar1
Pan troglodytes 19164 ENSPTRT00000020537 ENSPTRG00000011054 TMEM145 panTro2
Pediculus humanus 10257 PHUM596180-RA 8239626 PHUM596180 PhumU1
Pogonomyrmex barbatus 16523 PB22245-RA 1.2
Pongo abelii 14165 ENSPPYT00000011680 100445416 ENSPPYG00000010044 TMEM145 ponAbe2
Procavia capensis 2396 ENSPCAT00000017019 ENSPCAG00000017017 TMEM145 proCap1
Pteropus vampyrus 1344 ENSPVAT00000016808 ENSPVAG00000016808 TMEM145 pteVam1
Rattus norvegicus 1248 ENSRNOT00000027783 ENSRNOG00000020489 Tmem145 rn4
Rhesus macaque 21005 ENSMMUT00000017047 709268 ENSMMUG00000012170 TMEM145 rheMac2
Sorex araneus 9626 ENSSART00000009482 ENSSARG00000009458 TMEM145 sorAra1
Sus scrofa 15761 ENSSSCT00000003369 100513091 ENSSSCG00000003022 TMEM145 susScr2
Sus scrofa 15748 ENSSSCT00000003356 100513091 ENSSSCG00000003022 TMEM145 susScr2
Tarsius syrichta 7605 ENSTSYT00000008140 ENSTSYG00000008141 TMEM145 tarSyr1
Tetraodon nigroviridis 15792 ENSTNIT00000023016 ENSTNIG00000019546 tmem145 (2 of 2) tetNig2
Tetraodon nigroviridis 15797 ENSTNIT00000011204 ENSTNIG00000008196 tmem145 (1 of 2) tetNig2
Tribolium castaneum 9466 GLEAN_06129 Tcas3.0
Xenopus tropicalis 9257 ENSXETT00000026317 100497950 ENSXETG00000012053 tmem145 xenTro2

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Apis mellifera 1266 GB11267 apiMel3
Bombyx mori 11187 BGIBMGA011187-PA v2.0
Bos taurus 21458 ENSBTAP00000052283 513015 ENSBTAG00000039015 TMEM145 bosTau4
Branchiostoma floridae 5657 e_gw.38.180.1 braFlo1
Caenorhabditis elegans 25453 C15A7.2 182623 WBGene00007595 C15A7.2 ce6
Callithrix jacchus 20556 ENSCJAP00000023669 100386878 ENSCJAG00000012919 TMEM145 calJac3
Canis familiaris 11112 ENSCAFP00000007224 ENSCAFG00000004834 TMEM145 canFam2
Cavia porcellus 18075 ENSCPOP00000011681 100722600 ENSCPOG00000012974 TMEM145 cavPor3
Culex quinquefasciatus 5029 CPIJ007964 CpipJ1
Daphnia pulex 10805 JGI_V11_54015 1.1
Dipodomys ordii 13583 ENSDORP00000007448 ENSDORG00000007941 Tmem145 dipOrd1
Equus caballus 862 ENSECAP00000000996 ENSECAG00000000962 TMEM145 equCab2
Erinaceus europaeus 4780 ENSEEUP00000004781 ENSEEUG00000005242 TMEM145 eriEur1
Fugu rubripes 4210 ENSTRUP00000004210 ENSTRUG00000001825 tmem145 (2 of 2) fr2
Fugu rubripes 3261 ENSTRUP00000003261 101067435 ENSTRUG00000001417 tmem145 (1 of 2) fr2
Gasterosteus aculeatus 4078 ENSGACP00000004228 ENSGACG00000003235 tmem145 gasAcu1
Gorilla gorilla 7553 ENSGGOP00000018376 101144469 ENSGGOG00000024254 TMEM145 gorGor3
Homo sapiens 27443 ENSP00000383957 ENSG00000167619 TMEM145 hg19,GRCh37
Ixodes scapularis 14499 ISCW017640-PA ISCW017640 IscaW1
Linepithema humile 13677 LH23868-PA 1.2
Loxodonta africana 1711 ENSLAFP00000016717 100662455 ENSLAFG00000023281 TMEM145 loxAfr3
Microcebus murinus 13869 ENSMICP00000013877 ENSMICG00000015206 TMEM145 micMur1
Monodelphis domestica 5453 ENSMODP00000024132 100020607 ENSMODG00000019338 TMEM145 monDom5
Mus musculus 9434 ENSMUSP00000104046 330485 ENSMUSG00000043843 Tmem145 mm9
Myotis lucifugus 15204 ENSMLUP00000015219 102424465 ENSMLUG00000016682 TMEM145 myoLuc1
Nasonia vitripennis 10836 NV21673-PA 1.2
Nematostella vectensis 10227 e_gw.185.58.1 Nemve1
Nematostella vectensis 10325 e_gw.194.26.1 Nemve1
Nematostella vectensis 1279 gw.194.24.1 Nemve1
Ornithorhynchus anatinus 4641 ENSOANP00000020365 ENSOANG00000012875 TMEM145 ornAna1
Oryctolagus cuniculus 6791 ENSOCUP00000024060 ENSOCUG00000004380 TMEM145 oryCun2.0
Oryzias latipes 16123 ENSORLP00000016987 101158229 ENSORLG00000013550 tmem145 oryLat2
Otolemur garnettii 344 ENSOGAP00000000345 ENSOGAG00000000387 TMEM145 otoGar1
Pan troglodytes 18966 ENSPTRP00000018984 ENSPTRG00000011054 TMEM145 panTro2
Pediculus humanus 10066 PHUM596180-PA 8239626 PHUM596180 PhumU1
Pogonomyrmex barbatus 12245 PB22245-PA 1.2
Pongo abelii 18000 ENSPPYP00000011242 100445416 ENSPPYG00000010044 TMEM145 ponAbe2
Procavia capensis 2261 ENSPCAP00000015927 ENSPCAG00000017017 TMEM145 proCap1
Pteropus vampyrus 1266 ENSPVAP00000015855 ENSPVAG00000016808 TMEM145 pteVam1
Rattus norvegicus 26339 ENSRNOP00000027783 ENSRNOG00000020489 Tmem145 rn4
Rhesus macaque 35581 ENSMMUP00000015966 709268 ENSMMUG00000012170 TMEM145 rheMac2
Sorex araneus 8555 ENSSARP00000008579 ENSSARG00000009458 TMEM145 sorAra1
Sus scrofa 3270 ENSSSCP00000003273 100513091 ENSSSCG00000003022 TMEM145 susScr2
Sus scrofa 3283 ENSSSCP00000003286 100513091 ENSSSCG00000003022 TMEM145 susScr2
Tarsius syrichta 6964 ENSTSYP00000007469 ENSTSYG00000008141 TMEM145 tarSyr1
Tetraodon nigroviridis 1520 ENSTNIP00000022775 ENSTNIG00000019546 tmem145 (2 of 2) tetNig2
Tetraodon nigroviridis 1554 ENSTNIP00000011022 ENSTNIG00000008196 tmem145 (1 of 2) tetNig2
Tribolium castaneum 5987 GLEAN_06129 Tcas3.0
Xenopus tropicalis 3904 ENSXETP00000026317 100497950 ENSXETG00000012053 tmem145 xenTro2

multiple sequence alignment in CLUSTALW format

Caenorhabditis_elegans|33787  ---------------------------------------------------ATGAAATTC
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ---------------------ATGTGCGGAGGAACCGTCGCACGAGCGTCGCGGAACTCG
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------ATGATAAAAAAA
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ---------cttgcacgcggatctgtacccttttttcaccccacg---------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ---------------------------------------------------ATGGAGTTG
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ---------ATGGGGCCCCAGGCG------------------------------------
Tarsius_syrichta|7605         ---------ATGGAGCCCCCGCGCGCGCCCGCGTTGCGCCACCTG---------------
Canis_familiaris|1414         ---------TCGCAGCGCCCGGCGGCCCCTTTAATCGTGGGCGCT---------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ---------ATGGAGCCCCCGCGCGCGCCCGCGCTGCGCCGAATG---------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ---------ATGGAGCCCCCGCGTGCGCCCGCTCTGCGCCGCCTG---------------
Oryctolagus_cuniculus|22996   ---------GCGCAGCGCCCGGCGGCCCCTTTAATCGGGGACGCG---------------
Procavia_capensis|2396        ---------ATGGAGCCTCTGCGCGCGCCCGCTCTGCACCGCCTG---------------
Rattus_norvegicus|1248        ---------ATGGAGCCTTCGCGCGCGCCCGCGCTGCGCCGCctg---------------
Mus_musculus|37917            ---------ATGGAGCCCTCCCGCGCGCCCGtgctgcgccgcctg---------------
Callithrix_jacchus|28531      ---------ATGGAGACCCCGCGCGCGCCCGCGCTGCGCCGCCTG---------------
Bos_taurus|9094               ---------ATGGAGCCCCCGCGCGCGCCCGCTCTGCGCCGCCTG---------------
Cavia_porcellus|22880         ---------ATGGAGCCCCGGTGCACGCCTGCGTTGCGCCGCCTG---------------
Homo_sapiens|40066            ---------ATGGAGCCCCTGCGCGCGCCCGCGCTGCGCCGCctg---------------
Gorilla_gorilla|8768          ---------ATGGAGCCCCTGCGCGCGCCCGCGCTGCGCCGCCTG---------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ---------ATGGAgcccccgcgcgcgcccgcgctgcgccgcctg---------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ---------ATGAAGCCCCCGCGCGCGCCCAGTCTGCGCCGCCTG---------------
Sus_scrofa|15761              ---------ATGGAgcccccgcgcgcgcccgctctgcgccgcctg---------------
Sus_scrofa|15748              ---------ATGGAGCCCCCGCGCGCGCCCGCTCTGCGCCGCCTG---------------

Apis_mellifera|32002          ---------------------------------------------------------ATG
Linepithema_humile|1725       ------------------------------------------------------------
Nematostella_vectensis|15754  ---------------------------------------------------------ATA
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------ATGTTTTTTCTTCTGTTCCAG---------------
Daphnia_pulex|29407           ---------------------------ATGTTTAGTCTATTTAATTACGTTTGTCAACAG
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ---------------------gcacctgtccgtaacttattttactgtctccccctcaag
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------GGCCCCGGGATGCTACTGCTTCTCCTCGGCTTTCTGCGGATA
Tarsius_syrichta|7605         ------------------CTGCCGCCGCTGCTACTCTTACTGCTGCCGCTGCCCCCCCGC
Canis_familiaris|1414         ------------------CGCTGGCCGGCCCGCACGCTCTCGCCGCCGTCGCCCCCCCGC
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ---------------------CCGCCGCTGATGCTCCTCCTGCTACAGCTGCTCCCCCGC
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------CTGCCGCCGCTGCTGCTCCTGTTGCTGCCTCTGCCCCCCCGC
Oryctolagus_cuniculus|22996   ------------------CGCTGTCCGGCCCGCGCGCTCTCGCCTCCGTCGCCGGCCGGA
Procavia_capensis|2396        ------------------CTGCCGCCACTGCTGCTCCTCCTGCTACAGCTGCCGCTCCGC
Rattus_norvegicus|1248        ------------------ctgccgccactgctgctcttgctgctgccactgTACCCCCGC
Mus_musculus|37917            ------------------ctgccgccgctactgctcttgctgctgccactgTACCCCCGC
Callithrix_jacchus|28531      ------------------CTGCCGCCGCTGCTGCTCCTGCTGTTGTCACTGCCCCCCCGC
Bos_taurus|9094               ------------------CTGCCGCCGCTGCTGCTCCTAATGCTGCCGCTGCCCCCCCGC
Cavia_porcellus|22880         ------------------CTACCGCCGCTTCTGCTCCTGCTGCTGCCACTGTCCCCGCGC
Homo_sapiens|40066            ------------------ctgccgccgctgctgctcctgctgctgTCACTGCCCCCCCGC
Gorilla_gorilla|8768          ------------------CTGCCACCGCTGCTGCTCCTGCTGCTGTCACTGCCCCCCCGC
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------ctgccgccgctgctgctcctgctgctgTCACTGCCCCCCCGC
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------CTGCCACCGCTGCTGCTCCTGCTGCTGCCACTGCCCCCCCGT
Sus_scrofa|15761              ------------------ctgccgtcgctgctgctcctgctgctgccgctgcccccccgc
Sus_scrofa|15748              ------------------CTGCCGTCGCTGCTGCTCCTGCTGCTGCCGCTGCCCCCCCGC

Caenorhabditis_elegans|33787  GCTCAGGGAAAGCGTGCTCAAGGG------------------------------------
Apis_mellifera|32002          CATAGTTCTAAATGGCTACGA---------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   GCCGATGCCAGGATACTCCAGGGC------------------------------------
Nematostella_vectensis|15754  ACCGGAAGCGTATACACCGCGCGC------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      TGTCAATGCAAATATCTAGAAGGC------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ATTTATGGAAAATACGTTCAAGGA------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 accgcaagctctctgcggtcaggg------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          GTGTTCGGGAAATATGTCAGAGGC------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ---------------------GGC------------------------------------
Equus_caballus|2636           ------GCCAAGTACGTGCGGGGC------------------------------------
Xenopus_tropicalis|9257       AGTGCGGCCAAATATGTGCGGGGC------------------------------------
Tarsius_syrichta|7605         GCCCGGGCCAAGTACGTGCGGGGC------------------------------------
Canis_familiaris|1414         GCCCGGGCCAAGTACGTGCGGGGC------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      GCCCGGTCCAAGTATGTGCGGGGC------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      GTCCGGGCCAAGTACGTGCGGGGC------------------------------------
Oryctolagus_cuniculus|22996   GCGGGAGCTAAGTACGTGCGGGGC------------------------------------
Procavia_capensis|2396        GCCCGGGCCAAGTACGTGCGGGGC------------------------------------
Rattus_norvegicus|1248        ACCCGGGCCAAGTACGTGCGGGGC------------------------------------
Mus_musculus|37917            ACCCGGGCCAAGTACGTGCGGGGC------------------------------------
Callithrix_jacchus|28531      GCCCGGGCCAAGTACGTGCGGGGC------------------------------------
Bos_taurus|9094               GCCCGGGCTAAGTACGTGCGGGGC------------------------------------
Cavia_porcellus|22880         GCTCGGGCCAAGTACGTGCGGGGC------------------------------------
Homo_sapiens|40066            GCCCGGGCCAAGTACGTGCGGGGC------------------------------------
Gorilla_gorilla|8768          GCCCGGGCCAAGTACGTGCGGGGC------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            GCCCGGGCCAAGTACGTGCGGGGC------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        GCCCGGGCCAAGTACGTGCGGGGC------------------------------------
Sus_scrofa|15761              gcccgggccAAGTACGTGCGGGGC------------------------------------
Sus_scrofa|15748              GCCCGGGCCAAGTACGTGCGGGGC------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ---------------------------------------------------ATTCTTAGC
Apis_mellifera|32002          ---------------------------------------------------AATATTGAT
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ---------------------------------------------------AACTTGACA
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ---------------------------------------------------GAGATACAC
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ---------------------------------------------------CATTTAGTA
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ---------------------------------------------------aacttgtct
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ---------------------------------------------------GTGGTGAAC
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ---------------------------------------------------AACCTCAGC
Equus_caballus|2636           ---------------------------------------------------ACCCTCAGC
Xenopus_tropicalis|9257       ---------------------------------------------------AACCTGACC
Tarsius_syrichta|7605         ---------------------------------------------------AACCTTAGC
Canis_familiaris|1414         ---------------------------------------------------AACCTCAGC
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ---------------------------------------------------AACCTCAGC
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ---------------------------------------------------AACCTCAGC
Oryctolagus_cuniculus|22996   ---------------------------------------------------AACCTCAGC
Procavia_capensis|2396        ---------------------------------------------------AACCTCAGC
Rattus_norvegicus|1248        ---------------------------------------------------AACCTCAGC
Mus_musculus|37917            ---------------------------------------------------AACCTCAGC
Callithrix_jacchus|28531      ---------------------------------------------------AACCTTAGC
Bos_taurus|9094               ---------------------------------------------------AACCTCAGC
Cavia_porcellus|22880         ---------------------------------------------------AACCTCAGC
Homo_sapiens|40066            ---------------------------------------------------AACCTCAGT
Gorilla_gorilla|8768          ---------------------------------------------------AACCTTAGT
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ---------------------------------------------------AACCTCAGT
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ---------------------------------------------------AACCTCAGC
Sus_scrofa|15761              ---------------------------------------------------AACCTCAGC
Sus_scrofa|15748              ---------------------------------------------------AACCTCAGC

Linepithema_humile|1725       ------------------AACTGGGCTTTTCTTGCGAGATTCTGTTTTCTAACGGAGCGT
Nematostella_vectensis|15754  ------------------AAATGGTACTTCCTCGAGCGATTTGCGTTCCGTGATATCGGG
Culex_quinquefasciatus|18189  ---------------------ATGATGCCGAAATTTGTGTTCTGTTTCCTGTCCTATCAT
Bombyx_mori|9277              ------------------AACTGGGCGTTCCTTTCGCGTTTCTGCTTCCTATCACTGGAC
Daphnia_pulex|29407           ------------------AGGTGGACGTTTCTTGCTCGGTTTTGTTTTCTCTCGATGGAA
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------GACTGGGTGTTCCTGACAAGATTTTGCTTCCTCTCGGATTAC
Sorex_araneus|9626            ---------------------TGGGTGTTCCTGACAAGGTTCTGCTTCCTCTCGGACTAT
Ornithorhynchus_anatinus|5033 tccaactcc---------GACTGGGTGTTCCTGACACGGTTCTGCTTTCTCTCTGACTAT
Nematostella_vectensis|15736  ------------------GACTGGCAATTTGTTGCACGATTTTGCTTCAAAGATTCTTAT
Nematostella_vectensis|18340  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ACCAAA---GAG------GATTGGGTATTCCTCACACgcttttgttttcttactgacTTT
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Pan_troglodytes|19164         ------------------GACTGGGTGTTCCTGACAAGATTTTGTTTCCTCTCGGATTAC
Dipodomys_ordii|14456         ------------------GACTGGGTGTTCCTGACGAGATTTTGTTTCCTCTCGGATTAT

Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------

Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ---------------------------------------------------------ATG
Nematostella_vectensis|18340  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------

Nematostella_vectensis|15754  TGCTCTAACAAGATGGACGTGTGTACA------AGCTCGGCC------------------
Branchiostoma_floridae|16299  TGTGTG------------TTGTTACAG---------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------

Nasonia_vitripennis|11239     TCA---------CCATACTCCACCTATACCTCAGTATCTGGATGTTACTTC---------
Apis_mellifera|32002          TCT---------------ACAGTAACATTTGAAGAATCGGGATGCATCGAA---------
Linepithema_humile|1725       AAT---------------ACATCGATAGATTTCTTCTCGGGATGC---GTA---------
Pogonomyrmex_barbatus|16523   AAC------------------ACGTCGGAGCCCTTTTCGGGATGC---GTG---------
Nematostella_vectensis|15754  ------------------------------------------------------------
Daphnia_pulex|29407           ACC---------------------------------------------------------
Pediculus_humanus|10257       ACA---------------ACGAAAGGTTTATTCGATAACGGTTGTAATAAA---------
Ixodes_scapularis|14498       GTC---------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ACT------------------ACCCAGTATGCCTGGTCAGGCTGTCAGNNN---------
Sorex_araneus|9626            ACC------------------ACTCAGTACGCATGGTCCGGCTGTCAGGTG---------
Ornithorhynchus_anatinus|5033 ACC------------------ACCCAGTACGCCTGGTCCGGCTGTCAGGTG---------
Nematostella_vectensis|15736  ACA------------------ACCTCCTTTATGTGGTCTGGTTGTAAGAGA---------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ACG------------------ACGCGCTACACCTGGTCAGGCTGTGTGGTG---------
Fugu_rubripes|48313           ACC------------------ACGCGCTACACGTGGTCCGGCTGCATGGTN---------
Tetraodon_nigroviridis|15792  ACC------------------ACGCACTACACATGGTCAGGCTGCGTGGTG---------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ACC------------------ACACATTACACCTGGTCAGGATGCGTGGTG---------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ACC------------------ACCCAGTACGCCTGGTCAGGCTGCCAGGTG---------
Equus_caballus|2636           ACC------------------ACCCAGTATGCTTGGTCAGGCTGTCAGGTG---------
Xenopus_tropicalis|9257       ACA------------------ACGCAGTATGTTTGGTCTGGATGCCAGGTG---------
Tarsius_syrichta|7605         ACC------------------ACCCAGTATGCCTGGTCAGGATGTCAGGTG---------
Canis_familiaris|1414         ACC------------------ACCCAGTACGCCTGGTCAGGCTGTCAGGTA---------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ACC------------------ACCCAGTACGCCTGGTCAGGCTGTCAGGTG---------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ACC------------------ACCCAGTACGCTTGGTCAGGCTGCCAGGTG---------
Oryctolagus_cuniculus|22996   ACC------------------ACCCAGTACGCCTGGTCAGGCTGTCAGGTA---------
Procavia_capensis|2396        ACC------------------ACGCAGTATGCCTGGTCAGGCTGTCAGGTG---------
Rattus_norvegicus|1248        ACC------------------ACCCAGTACGCCTGGTCGGGCTGTCAGGTG---------
Mus_musculus|37917            ACC------------------ACTCAGTACGCCTGGTCGGGCTGTCAGGTG---------
Callithrix_jacchus|28531      ACC------------------ACACAGTATGCCTGGTCCGGCTGTCAGGTG---------
Bos_taurus|9094               ACT------------------ACCCAGTATGCCTGGTCAGGCTGTCAGGTG---------
Cavia_porcellus|22880         ACC------------------ACCCAGTATGCCTGGTCAGGCTGTCAGGTG---------
Homo_sapiens|40066            ACC------------------ACCCAGTATGCCTGGTCCGGCTGTCAGGTG---------
Gorilla_gorilla|8768          ACC------------------ACCCAGTATGCCTGGTCCGGCTGTCAGGTG---------
Rhesus_macaque|21005          ACC------------------ACCCAGTATGCCTGGTCCGGCTGTCAGGTG---------
Pan_troglodytes|19164         ACC------------------ACCCAGTATGCCTGGTCCGGCTGTCAGGTG---------
Pongo_abelii|14165            ACC------------------ACCCAATATGCCTGGTCCGGCTGTCAGGTG---------
Dipodomys_ordii|14456         ACC------------------ACCCAGTATGCCTGGTCAGGCTGTCAGGTG---------
Pteropus_vampyrus|1344        ACC------------------ACCCAGTATGCTTGGTCAGGCTGTCAGGTG---------
Sus_scrofa|15761              ACC------------------ACCCAGTATGCCTGGTCAGGCTGTCAGGTG---------
Sus_scrofa|15748              ACC------------------ACCCAGTATGCCTGGTCAGGCTGTCAGGTG---------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------CATTCT
Nasonia_vitripennis|11239     ------------------------------------------------------ACTTCA
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------GAGGGT
Pogonomyrmex_barbatus|16523   ------------------------------------------------------GAGGGC
Nematostella_vectensis|15754  ------------------------------------------------------ATCAGC
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------GAAAATGGACGATCATCA
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------NNNNNN
Sorex_araneus|9626            ------------------------------------------------------GTGTCA
Ornithorhynchus_anatinus|5033 ------------------------------------------------------GTGCCC
Nematostella_vectensis|15736  ------------------------------------------------------GTAATT
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------GAGGAC
Fugu_rubripes|48313           ------------------------------------------------------GAGGGA
Tetraodon_nigroviridis|15792  ------------------------------------------------------GAGGGA
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------GAAGGC
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------GTGTCA
Equus_caballus|2636           ------------------------------------------------------GTGTCA
Xenopus_tropicalis|9257       ------------------------------------------------------ATAAAG
Tarsius_syrichta|7605         ------------------------------------------------------GTGTCA
Canis_familiaris|1414         ------------------------------------------------------GTGTCA
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------GTGTCG
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------GTGTCT
Oryctolagus_cuniculus|22996   ------------------------------------------------------GTGTCA
Procavia_capensis|2396        ------------------------------------------------------GTATCA
Rattus_norvegicus|1248        ------------------------------------------------------GTGTCA
Mus_musculus|37917            ------------------------------------------------------GTGTCA
Callithrix_jacchus|28531      ------------------------------------------------------GTGTCA
Bos_taurus|9094               ------------------------------------------------------GTGTCA
Cavia_porcellus|22880         ------------------------------------------------------GTGTCA
Homo_sapiens|40066            ------------------------------------------------------GTATCA
Gorilla_gorilla|8768          ------------------------------------------------------GTATCA
Rhesus_macaque|21005          ------------------------------------------------------GTATCA
Pan_troglodytes|19164         ------------------------------------------------------GTATCA
Pongo_abelii|14165            ------------------------------------------------------GTATCA
Dipodomys_ordii|14456         ------------------------------------------------------GTGTCA
Pteropus_vampyrus|1344        ------------------------------------------------------GTGTCA
Sus_scrofa|15761              ------------------------------------------------------GTGTCA
Sus_scrofa|15748              ------------------------------------------------------GTGTCA

Caenorhabditis_elegans|33787  GATGGGCTTGGACAACAATGGATA------------------------------------
Nasonia_vitripennis|11239     GAAGAT---AAGAATCAAGTT---------------------------------------
Apis_mellifera|32002          ---------AAAGATGCTATAATA------------------------------------
Linepithema_humile|1725       GACGAT---GGT------ATAATT------------------------------------
Pogonomyrmex_barbatus|16523   GACGAC---GGTACAGTT------------------------------------------
Nematostella_vectensis|15754  GACAATGGCACCACCACGCGCCTG------------------------------------
Culex_quinquefasciatus|18189  ACCAAC---ACTAGCGAGTTTAGC------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       TCTAGAAAAAATACAGGAATGATT------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        NNNNNN---NNNNNNNNNNNNNNN------------------------------------
Sorex_araneus|9626            AAGGAG---GGGACCCGCTACCTG------------------------------------
Ornithorhynchus_anatinus|5033 GAGGGG---GGAACCCGCTACCTG------------------------------------
Nematostella_vectensis|15736  GTGGAC---AACAAAGATATGCTC------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  GACGGG---GACGAGGAGGTTCTG------------------------------------
Fugu_rubripes|48313           AAGGGA---GACCAGCAGGNTTTA------------------------------------
Tetraodon_nigroviridis|15792  GAAGGA---GATGAGGAGGTTCTG------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          GATGGC---AACGAGGAGGTGCTG------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      GAGGAG---GGAACCCACTACCTG------------------------------------
Equus_caballus|2636           GAGGAG---GGGACGCGCTACCTG------------------------------------
Xenopus_tropicalis|9257       GAGGCC---GGACAGAGCTATTTG------------------------------------
Tarsius_syrichta|7605         GAAGAG---GGAACCCGCTACCTG------------------------------------
Canis_familiaris|1414         GAGGAG---GGAACTCGTTACCTG------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      GAAGAG---GGAACTCGCTACCTG------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      GAGGAG---GGCACCCACTACCTG------------------------------------
Oryctolagus_cuniculus|22996   GAGGCC---GGGACCCGTTACCTG------------------------------------
Procavia_capensis|2396        GAGGAA---GGAACCCGCTACCTG------------------------------------
Rattus_norvegicus|1248        GAGGAG---GGAACCCGCTACCTG------------------------------------
Mus_musculus|37917            GAGGAG---GGAACTCGCTACCTG------------------------------------
Callithrix_jacchus|28531      GAGGAG---GGAACCCGCTACCTG------------------------------------
Bos_taurus|9094               GAGGAG---GGAACTCGCTACCTG------------------------------------
Cavia_porcellus|22880         GAGGAG---GGAACACGTTACCTG------------------------------------
Homo_sapiens|40066            GAGGAG---GGAACCCGCTACCTG------------------------------------
Gorilla_gorilla|8768          GAGGAG---GGAACTCGCTACCTG------------------------------------
Rhesus_macaque|21005          GAGGAG---GGAACCCGCTACCTG------------------------------------
Pan_troglodytes|19164         GAGGAG---GGAACCCGCTACCTG------------------------------------
Pongo_abelii|14165            GAGGAG---GGAACCCGCTACCTG------------------------------------
Dipodomys_ordii|14456         GAGGAG---GGAACCCGCTACCTG------------------------------------
Pteropus_vampyrus|1344        GAGGAG---GGAACCCGCTATCTG------------------------------------
Sus_scrofa|15761              GAGGAG---GGAACTCGCTACCTG------------------------------------
Sus_scrofa|15748              GAGGAG---GGAACTCGCTACCTG------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------------------
Sorex_araneus|9626            ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------GCATGCTCTGGG
Nasonia_vitripennis|11239     ------------------------------------------------CGATGCAAGAGT
Apis_mellifera|32002          ------------------------------------------------CGATGTTCCAGT
Linepithema_humile|1725       ------------------------------------------------CGATGCGACAGT
Pogonomyrmex_barbatus|16523   ------------------------------------------------CGATGCGACAGT
Nematostella_vectensis|15754  ------------------------------------------------CGCTGCACTGGT
Tribolium_castaneum|9466      ------------------------------------------------ATGTGTCACAAC
Daphnia_pulex|29407           ------------------------------------------------------TCAGCA
Pediculus_humanus|10257       ------------------------------------------------TATTGTAATAAT
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Myotis_lucifugus|16909        ------------------------------------------------NNNNNNNNNNNN
Sorex_araneus|9626            ------------------------------------------------AGCTGCTCCAGT
Ornithorhynchus_anatinus|5033 ------------------------------------------------AGCTGCTCCAGT
Nematostella_vectensis|15736  ------------------------------------------------CACTGCACTAGT
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------AGCTGCGTGGGC
Fugu_rubripes|48313           ------------------------------------------------AGCTTTTTGGGT
Tetraodon_nigroviridis|15792  ------------------------------------------------AGCTGCGTGGGT
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------AGCTGTGTGGGT
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Microcebus_murinus|16331      ------------------------------------------------AGTTGCTCCAGT
Equus_caballus|2636           ------------------------------------------------AGTTGCTCCAGC
Xenopus_tropicalis|9257       ------------------------------------------------AGCTGTAATAGC
Tarsius_syrichta|7605         ------------------------------------------------AGCTGCTCCAGT
Canis_familiaris|1414         ------------------------------------------------AGCTGCTCCAGT
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------ACCTGCTCTAGT
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------AGCTGTTCCAGT
Oryctolagus_cuniculus|22996   ------------------------------------------------AGCTGCTCTAGC
Procavia_capensis|2396        ------------------------------------------------AGCTGCTCCAGT
Rattus_norvegicus|1248        ------------------------------------------------AGCTGCTCCAGT
Mus_musculus|37917            ------------------------------------------------AGCTGCTCCAGT
Callithrix_jacchus|28531      ------------------------------------------------AGCTGTTCCAGT
Bos_taurus|9094               ------------------------------------------------AGCTGCTCCAGT
Cavia_porcellus|22880         ------------------------------------------------AGCTGCTCCAGC
Homo_sapiens|40066            ------------------------------------------------AGCTGCTCCAGT
Gorilla_gorilla|8768          ------------------------------------------------AGCTGCTCCAGT
Rhesus_macaque|21005          ------------------------------------------------AGCTGCTCCAGT
Pan_troglodytes|19164         ------------------------------------------------AGCTGCTCCAGT
Pongo_abelii|14165            ------------------------------------------------AGCTGCTCCAGT
Dipodomys_ordii|14456         ------------------------------------------------AGCTGCTCCAGC
Pteropus_vampyrus|1344        ------------------------------------------------AGCTGCTCCAGT
Sus_scrofa|15761              ------------------------------------------------AGCTGCTCTAGT
Sus_scrofa|15748              ------------------------------------------------AGCTGCTCTAGT

Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  GCCCGCAGTTCCCGCTCGAGGAGGGGCGAA------------------------------
Fugu_rubripes|48313           GGCCGGNGTTTCCGCTCG------------------------------------------
Tetraodon_nigroviridis|15792  GGTCGCAGTTTCCGCTCA------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          GGTCGCAGTTTCCGCTCA------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Cavia_porcellus|22880         GGTAGAAGCTTCCGCTCT------------------------------------------
Rhesus_macaque|21005          GGCCGCAGCTTCCGCTCA------------------------------------------
Pan_troglodytes|19164         GGCCGCAGCTTCCGCTCA------------------------------------------
Pongo_abelii|14165            GGCCGCAGCTTCCGCTCA------------------------------------------

Nasonia_vitripennis|11239     AATGATAAA------------------------------------GGACTCAATATTAGT
Apis_mellifera|32002          TCAAAAAGC------------------------------------GGATTAAATATCTCA
Linepithema_humile|1725       TCCACGAAA---------------------------------------------------
Pogonomyrmex_barbatus|16523   TCCAAGAAA------------------------------------GGCCTGAATGTCACT
Nematostella_vectensis|15754  GCGGAT---------------------------------------GTTCTGGATATGGAT
Culex_quinquefasciatus|18189  AGTAACAAA------------------------------------GGTCTTGACATTGTT
Bombyx_mori|9277              TCTTCAAAG------------------------------------GGCTTGGACGTGAGT
Tribolium_castaneum|9466      GGAACGAGA------------------------------------GGAATTCACGTCAAG
Daphnia_pulex|29407           TCTTCAAAG------------------------------------GGGTTGTCTCTCAAG
Pediculus_humanus|10257       TCTACAAAA------------------------------------GGTTTAAATGTTAAA
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ---------------------------------------------GGCCTCAACATCCAG
Myotis_lucifugus|16909        NNNNNN---------------------------------------NNNNNNNNNNNNNNN
Sorex_araneus|9626            NNNNNN---------------------------------------NNNNNNNNNNNNNNN
Ornithorhynchus_anatinus|5033 GGGGAC---------------------------------------GGGCTGCAGTTGGAG
Nematostella_vectensis|15736  GGAACCAAG------------------------------------GGGCTTAAACTGAAG
Nematostella_vectensis|18340  ---------------------------------------------GGGCTTAAACTGAAG
Gasterosteus_aculeatus|27444  ---------------------------------------------GGCTTGCAGCTGGAG
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          GGCGAC---------------------------------------GGCCTACAGCTGGAG
Tetraodon_nigroviridis|15797  GGCGAT---------------------------------------GGCCTGCAGCTGGAG
Microcebus_murinus|16331      GGAGAT---------------------------------------GGACTGCAGCTGGAG
Equus_caballus|2636           GGAGGG---------------------------------------GCCTGGGAGCCCAGA
Xenopus_tropicalis|9257       GGGGAT---------------------------------------GGGCTGCAGTTGGAA
Tarsius_syrichta|7605         GGAGAT---------------------------------------GGACTGCAGCTGGAG
Canis_familiaris|1414         GGAGAT---------------------------------------GGGCTACAGCTGGAG
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      GGAGAT---------------------------------------GGGCTGCAGCTGGAG
Otolemur_garnettii|401        ------------------------------------------------------------
Erinaceus_europaeus|5811      GGAGAT---------------------------------------GGGCTGCAGCTGGAG
Oryctolagus_cuniculus|22996   GGAGAT---------------------------------------GGGCTGCAGCTGGAG
Procavia_capensis|2396        GGAGAT---------------------------------------GGGCTGCAGCTGGAG
Rattus_norvegicus|1248        GGAGAT---------------------------------------GGGCTACAGTTGGAA
Mus_musculus|37917            GGAGAC---------------------------------------GGGCTGCAGTTGGAG
Callithrix_jacchus|28531      GGAGAT---------------------------------------GGACTGCAGCTGGAG
Bos_taurus|9094               GGAGAT---------------------------------------GGGCTGCAGCTGGAG
Cavia_porcellus|22880         GGAGAG---------------------------------------GGACTGCAGCTGGAG
Homo_sapiens|40066            GGTGAT---------------------------------------GGATTGCAGCTGGAG
Gorilla_gorilla|8768          GGTGAT---------------------------------------GGATTGCAGCTGGAG
Rhesus_macaque|21005          GGTGAT---------------------------------------GGATTGCAGCTAGAG
Pan_troglodytes|19164         GGTGAT---------------------------------------GGATTGCAGCTGGAG
Pongo_abelii|14165            GGTGAT---------------------------------------GGATTGCAGCTGGAG
Dipodomys_ordii|14456         GGAGAT---------------------------------------GGGCTGCAGCTGGAG
Pteropus_vampyrus|1344        GGAGAT---------------------------------------GGGCTGCAGCTGGAA
Sus_scrofa|15761              GGAGAT---------------------------------------GGACTGCAGCTGGAG
Sus_scrofa|15748              GGAGAT---------------------------------------GGACTGCAGCTGGAG

Linepithema_humile|1725       ------------------------------------------------------------
Ixodes_scapularis|14498       ---------------------------------------------------GCCTTT---
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          TATGAGATGAAGCTGACCAATGGGCAG------TCTTTCTGgacgcag---catttctct
Monodelphis_domestica|33177   ------------------------------------TTCTGGACCCGC---CACTTTTCC
Otolemur_garnettii|401        ------------------------------------------------------------

Apis_mellifera|32002          GCAGATGAATTTTCTATG------------------------------------------
Pogonomyrmex_barbatus|16523   GCGGACGAATTC------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Nematostella_vectensis|15736  GCAGATGAA---------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Canis_familiaris|1414         GCTGATGAGTTTGGT---------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Oryctolagus_cuniculus|22996   GCCGATGAGTTTGGGATCCTGGAGACAGATGTGACcttcctcctcatcttcatcctcatc
Homo_sapiens|40066            GCTGATGAGTTTGGGATCCTGGAGACAGATGTGACcttcctcctcatcttcatcctcatc
Pan_troglodytes|19164         GCTGATGAGTTTGGGATCCTGGAGACAGATGTGACcttcctcctcatcttcatcctcatc
Dipodomys_ordii|14456         GCAGATGAATTT------------------------------------------------

Apis_mellifera|32002          ---------------------------CAACTAAGAGCAAGAAGATTATTACATATATCT
Ixodes_scapularis|14498       ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ---------------------GCAGATCATCTGAAGGGACGGCAGCTTCTTCACACCACC
Canis_familiaris|1414         ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------

Ixodes_scapularis|14498       ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------

Ixodes_scapularis|14498       ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Canis_familiaris|1414         ---------------------GAGCATAGGGGGACCCAGAAGCCAGGATCTTTGAGGGAC
Otolemur_garnettii|401        ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------

Ixodes_scapularis|14498       ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Canis_familiaris|1414         GTCAGAGTGGAATGC------------------------------CTGCTGAGGGATGGC
Otolemur_garnettii|401        ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------

Apis_mellifera|32002          TTTACAGTAACTAAA---------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 TTCTCCGCCACACAg---cgagggacctgggttctaatgccgcctccgccacttgcctgc
Nematostella_vectensis|15736  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Canis_familiaris|1414         TATCCTGACCTACCC---------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------

Apis_mellifera|32002          ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Sorex_araneus|9626            NNNNNNNNNNNN------------------------NNNNNNNNNNNNNNNNNNNNNNNN
Ornithorhynchus_anatinus|5033 cgtgcaaccttgggcaagtcatttaacctctct---gtgcctgtttctctaaaatggaga
Nematostella_vectensis|15736  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------
Otolemur_garnettii|401        ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------

Apis_mellifera|32002          ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ttaaatacctattctccctcccttcctcttaggatgcgagccccatgtcctacagggatt
Nematostella_vectensis|15736  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------------------

Apis_mellifera|32002          AGTGTTTTAACATCAAAACAAATTCGATGGCTT---------------------------
Ornithorhynchus_anatinus|5033 gtcctggccgggcacgagacttctctgggcctcagttccctcctctgtcaaatgggg---
Nematostella_vectensis|15736  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Canis_familiaris|1414         ------------------------------------------------GTGCTCATC---

Ornithorhynchus_anatinus|5033 atgaagaccgggagccccacgtgggacaacccgatgagcccgtatctcccccagcgtcca
Nematostella_vectensis|15736  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------

Culex_quinquefasciatus|18189  ------------------------------ACACTGCTAGAGCAAATAAAAGTTTCCCGT
Ixodes_scapularis|14498       ATCTGG------------------------------------------------------
Ornithorhynchus_anatinus|5033 gaacaT---GCTTACCAGATTCCATTTTTTTTTTTAATTTCT---------TTACCATCA
Nematostella_vectensis|15736  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Erinaceus_europaeus|5811      CTC---------------------------------------------------------

Culex_quinquefasciatus|18189  ACCATGTGCGAACAAATCACGTCG------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 TCGACACCCCCTCCCGCCCCCGATGAC---------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------

Culex_quinquefasciatus|18189  GTGTTTCGACTGTTGACGATGAAG------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Sus_scrofa|15761              GTGTTCCTGGTG------------------------------------------------

Nasonia_vitripennis|11239     ACTTGTCAGGTAGTTCCGATAGGA------------------GGTGAAGGCCAA------
Apis_mellifera|32002          ACATGTCAAGTTATGCCAATTGGT------------------GGTGAAGGACAA------
Linepithema_humile|1725       ACATTCCGAGTTGTGCCTATAGGT------------------GGTCACGGGCAG------
Pogonomyrmex_barbatus|16523   ACATTTCAAGTTGTGCCTATAGGT---------------------CACGGACAG------
Nematostella_vectensis|15754  ACCAATCAGATC------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ACGACGCAAATCGGAGTTATGGAGGTAACTAGAAGC------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Myotis_lucifugus|16909        ACATCGCAGATCGCT---GCCGGT------GCCCCGGGGCCCGGAGGTAGC---------
Ornithorhynchus_anatinus|5033 ACGTCGCAGATCGGGTcggcgggagggccgggccccggggccggcggcgccgcc------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ACTAACCAGGTGGGTCATTTA---------------------------------------
Gasterosteus_aculeatus|27444  ACGTCACAGATCGGGATCCTGCTG------TCCAGCCCCAAAGCGGGC------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ACATCTCAAATTGGAATCTTG---------ATGTCCAGTCCCAAAGGCGAG---------
Oryzias_latipes|7372          ACATCACAGATCGGGATACTTTTG------TCCAGTCCTAAAGGAGGT------------
Tetraodon_nigroviridis|15797  ACGTCTCAAATCGGAATCCTGCTG------TCCAGCCCAAAAGGCGGC------------
Xenopus_tropicalis|9257       ACCTCTCAGATTGGGATTATGGAA------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------

Nasonia_vitripennis|11239     ------------------------------GGACACGCCTATGAGCCTCAATCT------
Apis_mellifera|32002          ------------------------------GATCACAGTTATGAACCCAATATT------
Linepithema_humile|1725       ------------------------------GATCATAGTTATGAGCCTGGTCCT------
Pogonomyrmex_barbatus|16523   ------------------------------GATCACAGTTACGAGCCTGGTCCT------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Loxodonta_africana|17334      ---------TCCGGGGCGAAG---TTCCCGCAGCACGTCTATGGGAACGTGACT------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------

Nasonia_vitripennis|11239     ---CGAACTGCTATGACACTC---------------------------------TTTACT
Apis_mellifera|32002          ---AGAACAGCAAGTTCTGCA---------------------------------TTCACT
Linepithema_humile|1725       ---CGAACTGCAGTCACAGCA---------------------------------------
Pogonomyrmex_barbatus|16523   ---CGAACTGCAGTTACCGCA---------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Daphnia_pulex|29407           ---CGTTACAGCAACCCTAAT------------------------------------GGA
Pediculus_humanus|10257       ---CCCGTCGGTATACGA------------------------------GAAGTACCTTTC
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  AGCTTCATCGGGGGAGGGGGG---------------------------CCCAACTTCACC
Myotis_lucifugus|16909        ---NNNNNNNNNNNNNNNNNN---------------------------NNNNNNNNNNNN
Sorex_araneus|9626            ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Ornithorhynchus_anatinus|5033 ---TTCATCAGCGACTCCGTC---------------------------CCCAACTTCACC
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ---TTCCTGGGAGACTCTCAA---------------------------CCCAACTTCACA
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ---TTCCTGGGAGACTCTCAG---------------------------CCCAACTTCACT
Oryzias_latipes|7372          ---TTTCTTGGAGATTCTCAA---------------------------CCTAACTTCACC
Tetraodon_nigroviridis|15797  ---TTCCTCGGAGACTCTCAA---------------------------CCCAACTTCACT
Microcebus_murinus|16331      ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Equus_caballus|2636           ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Xenopus_tropicalis|9257       ---TTTATCAGTGATTCTGTC---------------------------CCCAACGTCACT
Tarsius_syrichta|7605         ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Canis_familiaris|1414         ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Monodelphis_domestica|33177   ---TTCATCAGCGATTCGGTC---------------------------CCCAACTTCACG
Loxodonta_africana|17334      ---TTCATCAGCGATTCGGTG---------------------------CCCAACTTCACG
Otolemur_garnettii|401        ---TTCATCAGCGATTCAGTG---------------------------CCCAACTTCACG
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Procavia_capensis|2396        ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Rattus_norvegicus|1248        ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Mus_musculus|37917            ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Callithrix_jacchus|28531      ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Bos_taurus|9094               ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Cavia_porcellus|22880         ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Homo_sapiens|40066            ---TTTATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Gorilla_gorilla|8768          ---TTTATCAGCGACTCTGTG---------------------------CCCAACTTCACG
Rhesus_macaque|21005          ---TTTATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Pan_troglodytes|19164         ---TTTATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Pongo_abelii|14165            ---TTTATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Dipodomys_ordii|14456         ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Pteropus_vampyrus|1344        ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ---TTCATCAGCGACTCGGTG---------------------------CCCAACTTCACG

Caenorhabditis_elegans|33787  GACGACAGAGGTGTATTGGAACGGCCTCAAATTGCATCATCT------------------
Nasonia_vitripennis|11239     CTCTCACATTCTCCACCAACAGTTAATACTATCTCT------------------------
Apis_mellifera|32002          ATTTCACATTTAACACCATCTATTTTACAATCT---------------------------
Pogonomyrmex_barbatus|16523   ------TTTACTATCACACGGACACCAGCTTACTTCAATCAATCACAA------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              CAGTACGTGGCATCAGCGCCGCCGTTGTCTCTCGAACACGAC------------------
Tribolium_castaneum|9466      GGAATGTACAATCAACCGGTGCACAATATTCGTAGGGAGAGT------------------
Daphnia_pulex|29407           TCTATCTACGCCATCAGTAACGGAGCCGTCCAT---------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  GAACTCTTCACTGTGGCCACCCCTACTAGTGTACGTGTTGAA------------------
Myotis_lucifugus|16909        NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCGGGAAG------------------
Ornithorhynchus_anatinus|5033 GAGCTCTTCTCCATCCCCCCGCCC------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  GAGCTCTTCTCCATCCACCCGCCCCCTCGGGTCGTAGCT---------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           GAACTCTTCTCCATC---------------------------------------------
Oryzias_latipes|7372          GAGCTGTTTTCCATCCAGTCCGTAAGTCGATTT---------------------------
Tetraodon_nigroviridis|15797  GAACTTTTCTCCATC---------------------------------------------
Microcebus_murinus|16331      GAGCTCTTCTCCATACCCCCGCCCGCCTCCTCCGCCGGGAAG------------------
Equus_caballus|2636           GAGCTCTTCTCCATCCCCCCGCCCGCCTCCTCC---------------------------
Xenopus_tropicalis|9257       GAGCTTTTCTCCATTCCAAGCAACAATGGGAGTGCTGGGGGG------------------
Tarsius_syrichta|7605         GAGCTCTTCTCCATCCCCCCGCCCGCCTCCTCCNNNNNNNNN------------------
Canis_familiaris|1414         GAGCTCTTCTCCATCCCCCCGCCCGCCTCCTCCGTAAGCCCC------------------
Monodelphis_domestica|33177   GAGCTCTTCTCCATCCCT------------------------------------------
Loxodonta_africana|17334      GAGCTCTTCTCCATCCCCCCGCCCGCCTCCTCCGCCGGGAAG------------------
Otolemur_garnettii|401        GAGCTCTTCTCCATACCCCCGCCCGCCTCCTCCGCCGGGAAA------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Procavia_capensis|2396        GAGCTCTTCTCCATCCCCCCGCCCGCCTCCTCCGCCGGGAAG------------------
Rattus_norvegicus|1248        GAGCTCTTCTCCATCCCCCCGCCCACCTCCTCTGCCGGGAAG------------------
Mus_musculus|37917            GAGCTCTTCTCCATCCCCCCGCCAACCTCCTCTGCCGGGAAG------------------
Callithrix_jacchus|28531      GAGCTCTTCTCCATTCCCCCGCCCGCCTCCTCCGCCGGGAAG------------------
Bos_taurus|9094               GAGCTCTTCTCCATACCCCCGCCCGCCTCCTGCGCCGGGAAG------------------
Cavia_porcellus|22880         GAGCTCTTCTCCATCCCCCCGCCCACCTCCTCC---------------------------
Homo_sapiens|40066            GAGCTCTTCTCCATCCCCCCGCCCGCCACCTCCGCCGGGAAG------------------
Gorilla_gorilla|8768          GAGCTCTTCTCCATCCCCCCGCCCGCCACCTCC---------------------------
Rhesus_macaque|21005          GAGCTCTTCTCCATCCCCCCGCCCACCACCTCC---------------------------
Pan_troglodytes|19164         GAGCTCTTCTCCATCCCCCCGCCCGCCACCTCC---------------------------
Pongo_abelii|14165            GAGCTCTTCTCCATCCCCCCGCCCGCCACCTCC---------------------------
Dipodomys_ordii|14456         GAGCTCTTCTCCATCCCTCCGCCCGCCTCCTCC---------------------------
Pteropus_vampyrus|1344        GAGCTCTTCTCCATCCCCCCGCCCGCCTCCTCCGCCGGGAAG------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              GAGCTCTTCTCCATCCCCCCGCCCGCCTCCTCTGCCGGGAAG------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Equus_caballus|2636           ---------------------------CCCCTGCCCCGAGCGGCGCCGGATTCTGGGCTC
Monodelphis_domestica|33177   ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Cavia_porcellus|22880         ---------------------------CCCCTGCCCCGAACGGCGCCGGATTCTGGGCTC
Gorilla_gorilla|8768          ---------------------------NNNNCGCCCCGAGCGGCGCCGGATTCTGGGCTC
Rhesus_macaque|21005          ---------------------------CCCCTGCCCCGAACGGCGCCGGATTCTGGGCTC
Pan_troglodytes|19164         ---------------------------CCCCTGCCCCGAGCGGCGCCGGATTCTGGGCTC
Pongo_abelii|14165            ---------------------------CCCCTGCCCCGAGCGGCGCCGGATTCTGGGCTC
Dipodomys_ordii|14456         ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  CCCGGTGAAGACGGT---------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Equus_caballus|2636           CCGCTGTTCCGAGACCTTCGGCCCCCT---------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Cavia_porcellus|22880         CCGCTGTTCTGCGATCTTCGGCCCCCT---------------------------------
Gorilla_gorilla|8768          CCGCTGTTCCGTGACCTCCGGCCCCCT---------------------------------
Rhesus_macaque|21005          CCGCTGTTCCGTGACCTCCGGCCCCCT---------------------------------
Pan_troglodytes|19164         CCGCTGTTCCGTGACCTCCGGCCCCCT---------------------------------
Pongo_abelii|14165            CAGCTGTTCCGTGACCTCCGGCCCCCT---------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       CATCAGAATGGGTTCCCTGAATATTTCAGCATCCGC------------------------
Tarsius_syrichta|7605         CAGCACACCGGCTTCACCGAATACTTCAGCATGCAC------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   CCGCACACCGGGCTT---GAATACTTCAGCATGCAC------------------------
Procavia_capensis|2396        CCGCACACTGGCTTCACCGAATACTTCAGCATGCAC------------------------
Rattus_norvegicus|1248        CCGCACACCGGCTTCACCGAATACTTCAGCATGCAC------------------------
Mus_musculus|37917            CCGCACACCGGCTTCACCGAATACTTCAGCATGCAC------------------------
Callithrix_jacchus|28531      CCGCACACCGGCTTCACCGAATACTTCAGCATGCAC------------------------
Bos_taurus|9094               CCGCACACCGGCTTCACCGAGTACTTCAGCATGCAC------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            CCGCACACCGGCTTCACCGAATACTTCAGCATGCAC------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        CCGCACACCGGCTTCACCGAATACTTCAGCATGCAC------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              CCGCACACTGGCTTCACCGAATACTTCAGCATGCAC------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       TTAACGGATATGTTTACGGCAACAAGTCGAAAAAATAAC---------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Sorex_araneus|9626            GAACGACGACGGAATCTAGTCTCCCGCTCC------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Equus_caballus|2636           ---------------------GGCCCCCTCCGAGACCTC---------------------
Xenopus_tropicalis|9257       ---------------TCTGCTGGACCACAACCTATG------------------------
Tarsius_syrichta|7605         ------------ACGGCCGGGGGCACCGCACCCCCGGTC---------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------ACGGCCGGGGGCACCGCACCCCCCGGT---------------------
Procavia_capensis|2396        ------------ACGGCCGGGGGCACCGCTCCCCCGGTG---------------------
Rattus_norvegicus|1248        ------------ACAGCCGGGGGCCCTGCACCCCCGGTC---------------------
Mus_musculus|37917            ------------ACAGCCGGGGGCCCTGCACCCCCGGTC---------------------
Callithrix_jacchus|28531      ------------ACGGCCGGGGGCACTGCACCCCCGGTC---------------------
Bos_taurus|9094               ------------ACGGCCGGGGGCACCGCACCCCCGGTC---------------------
Cavia_porcellus|22880         ---------------------GGCCCCCTCCGAGACCTC---------------------
Homo_sapiens|40066            ------------ACGGCCGGGGGCACTGCACCCCCGGTC---------------------
Gorilla_gorilla|8768          ---------------------GGCCCCCTTCGAGACCTC---------------------
Rhesus_macaque|21005          ---------------------GGCCCCCTTCGAGACCTC---------------------
Pan_troglodytes|19164         ---------------------GGCCCCCTTCGAGACCTC---------------------
Pongo_abelii|14165            ---------------------GGCCCCCTTCGAGACCTC---------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------ACGGCCGGGGGCACCGCACCCCCAGTC---------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------ACGGCCGGGGGCAATGCACCCCCGGTC---------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------------
Nasonia_vitripennis|11239     ------------------------------------------------------------
Apis_mellifera|32002          ------------------------------------------------------------
Linepithema_humile|1725       ------------------------------------------------------------
Pogonomyrmex_barbatus|16523   ------------------------------------------------------------
Nematostella_vectensis|15754  ------------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------------
Bombyx_mori|9277              ------------------------------------------------------------
Tribolium_castaneum|9466      ------------------------------------------------------------
Daphnia_pulex|29407           ------------------------------------------------------------
Pediculus_humanus|10257       ------------------------------------------------------------
Ixodes_scapularis|14498       ------------------------------------------------------------
Branchiostoma_floridae|16299  ------------------------------------------------------------
Ornithorhynchus_anatinus|5033 ------------------------------------------------------------
Nematostella_vectensis|15736  ------------------------------------------------------------
Nematostella_vectensis|18340  ------------------------------------------------------------
Gasterosteus_aculeatus|27444  ------------------------------------------------------------
Fugu_rubripes|48313           ------------------------------------------------------------
Tetraodon_nigroviridis|15792  ------------------------------------------------------------
Fugu_rubripes|44613           ------------------------------------------------------------
Oryzias_latipes|7372          ------------------------------------------------------------
Tetraodon_nigroviridis|15797  ------------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------------
Xenopus_tropicalis|9257       ------------------------------------------------------------
Tarsius_syrichta|7605         ------------------------------------------------------------
Monodelphis_domestica|33177   ------------------------------------------------------------
Loxodonta_africana|17334      ------------------------------------------------------------
Erinaceus_europaeus|5811      ------------------------------------------------------------
Oryctolagus_cuniculus|22996   ------------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------------
Rattus_norvegicus|1248        ------------------------------------------------------------
Mus_musculus|37917            ------------------------------------------------------------
Callithrix_jacchus|28531      ------------------------------------------------------------
Bos_taurus|9094               ------------------------------------------------------------
Cavia_porcellus|22880         ------------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------------
Gorilla_gorilla|8768          ------------------------------------------------------------
Rhesus_macaque|21005          ------------------------------------------------------------
Pan_troglodytes|19164         ------------------------------------------------------------
Pongo_abelii|14165            ------------------------------------------------------------
Dipodomys_ordii|14456         ------------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------------
Sus_scrofa|15761              ------------------------------------------------------------
Sus_scrofa|15748              ------------------------------------------------------------

Caenorhabditis_elegans|33787  ------------------------------------------------------TAA
Nasonia_vitripennis|11239     ------------------------------------------------------TGA
Apis_mellifera|32002          ------------------------------------------------------TAA
Linepithema_humile|1725       ------------------------------------------------------TAG
Pogonomyrmex_barbatus|16523   ------------------------------------------------------TAG
Nematostella_vectensis|15754  ---------------------------------------------------------
Culex_quinquefasciatus|18189  ------------------------------------------------------TAA
Bombyx_mori|9277              ------------------------------------------------------TGA
Tribolium_castaneum|9466      ------------------------------------------------------TAA
Daphnia_pulex|29407           ------------------------------------------------------TAA
Pediculus_humanus|10257       ------------------------------------------------------TAA
Ixodes_scapularis|14498       ------------------------------------------------------TGA
Branchiostoma_floridae|16299  ------------------------------------------------------TAA
Myotis_lucifugus|16909        GTAGAAAGATTTTCCCCTTCTTGCCAAAATAGA------------------------
Sorex_araneus|9626            CTTTTTTCCCGTTCTGGCCAAAATAAA------------------------------
Ornithorhynchus_anatinus|5033 ---------------------------------------------------------
Nematostella_vectensis|15736  ---------------------------------------------------------
Nematostella_vectensis|18340  ---------------------------------------------------------
Gasterosteus_aculeatus|27444  ---------------------------------------------------------
Fugu_rubripes|48313           ---------------------------------------------------------
Tetraodon_nigroviridis|15792  ---------------------------------------------------------
Fugu_rubripes|44613           ---------------------------------------------------------
Oryzias_latipes|7372          ---------------------------------------------------------
Tetraodon_nigroviridis|15797  ---------------------------------------------------------
Equus_caballus|2636           ------------------------------------------------------TGA
Xenopus_tropicalis|9257       ------------------------------------------------------TAG
Tarsius_syrichta|7605         ------------------------------------------------------TGA
Monodelphis_domestica|33177   ---------------------------------------------------------
Loxodonta_africana|17334      ---------------------------------------------------------
Otolemur_garnettii|401        GGTTCCCCCCCTTCTTGCCAAAATAAA------------------------------
Erinaceus_europaeus|5811      ---------------------------------------------------------
Oryctolagus_cuniculus|22996   ---------------------------------------------------------
Procavia_capensis|2396        ------------------------------------------------------TGA
Rattus_norvegicus|1248        ------------------------------------------------------TGA
Mus_musculus|37917            ------------------------------------------------------TGA
Callithrix_jacchus|28531      ------------------------------------------------------TGA
Bos_taurus|9094               ------------------------------------------------------TGA
Cavia_porcellus|22880         ---------------------------------------------------------
Homo_sapiens|40066            ------------------------------------------------------TGA
Gorilla_gorilla|8768          ------------------------------------------------------TGA
Rhesus_macaque|21005          ------------------------------------------------------TGA
Pan_troglodytes|19164         ------------------------------------------------------TGA
Pongo_abelii|14165            ------------------------------------------------------TGA
Dipodomys_ordii|14456         ---------------------------------------------------------
Pteropus_vampyrus|1344        ------------------------------------------------------TGA
Sus_scrofa|15761              ---------------------------------------------------------
Sus_scrofa|15748              ---------------------------------------------------------

multiple sequence alignment in CLUSTALW format

Caenorhabditis_elegans|25453  -----------------MKFIQEKHRLVFLLTTFCYHIYIAQGKRAQG------------
Apis_mellifera|1266           ---------------------------------------MHSSKWLR-------------
Linepithema_humile|13677      ------------------------------------------------------------
Pogonomyrmex_barbatus|12245   -------MCGGTVARASRNSVKLGFLLLLFSIAHLPLVRHADARILQG------------
Nematostella_vectensis|10227  ---------------------------------------ITGSVYTAR------------
Culex_quinquefasciatus|5029   ------------------------------------------------------------
Bombyx_mori|11187             ----------------------------MFFLLFQ-------------------------
Tribolium_castaneum|5987      -------------------------MHRFSIVFLLFWLNLCQCKYLEG------------
Daphnia_pulex|10805           -----------------------------MFSLFNYVCQQ--------------------
Pediculus_humanus|10066       ----------------MIKKKIKLIFYALTAFVINLYGTQIYGKYVQG------------
Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   ------------------------------------------------------------
Myotis_lucifugus|15204        ------------------------------------------------------------
Sorex_araneus|8555            ------------------------------------------------------------
Ornithorhynchus_anatinus|4641 ---LARGSVPFFHPT------------APVRNLFYCLPLKTASSLRSG------------
Nematostella_vectensis|10325  ------------------------------------------------------------
Nematostella_vectensis|1279   ------------------------------------------------------------
Gasterosteus_aculeatus|4078   ------------------------------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Fugu_rubripes|3261            ------------------------------------------------------------
Oryzias_latipes|16123         -----------------MELRVGERLLCVAALSSLLCVDSVFGKYVRG------------
Tetraodon_nigroviridis|1554   ------------------------------------------------------------
Microcebus_murinus|13869      -----------------------------------------------G------------
Equus_caballus|862            ------------------------------------------AKYVRG------------
Xenopus_tropicalis|3904       ---MGPQA------------------GPGMLLLLLGFLRISAAKYVRG------------
Tarsius_syrichta|6964         ---MEPPRAPALRHL-----------LPPLLLLLLPLPPRARAKYVRG------------
Canis_familiaris|11112        ---SQRPAAPLIVGA-----------RWPARTLSPPSPPRARAKYVRG------------
Monodelphis_domestica|5453    ------------------------------------------------------------
Loxodonta_africana|1711       ---MEPPRAPALRRM------------PPLMLLLLQLLPRARSKYVRG------------
Otolemur_garnettii|344        ------------------------------------------------------------
Erinaceus_europaeus|4780      ---MEPPRAPALRRL-----------LPPLLLLLLPLPPRVRAKYVRG------------
Oryctolagus_cuniculus|6791    ---AQRPAAPLIGDA-----------RCPARALSPPSPAGAGAKYVRG------------
Procavia_capensis|2261        ---MEPLRAPALHRL-----------LPPLLLLLLQLPLRARAKYVRG------------
Rattus_norvegicus|26339       ---MEPSRAPALRRL-----------LPPLLLLLLPLYPRTRAKYVRG------------
Mus_musculus|9434             ---MEPSRAPVLRRL-----------LPPLLLLLLPLYPRTRAKYVRG------------
Callithrix_jacchus|20556      ---METPRAPALRRL-----------LPPLLLLLLSLPPRARAKYVRG------------
Bos_taurus|21458              ---MEPPRAPALRRL-----------LPPLLLLMLPLPPRARAKYVRG------------
Cavia_porcellus|18075         ---MEPRCTPALRRL-----------LPPLLLLLLPLSPRARAKYVRG------------
Homo_sapiens|27443            ---MEPLRAPALRRL-----------LPPLLLLLLSLPPRARAKYVRG------------
Gorilla_gorilla|7553          ---MEPLRAPALRRL-----------LPPLLLLLLSLPPRARAKYVRG------------
Rhesus_macaque|35581          ------------------------------------------------------------
Pan_troglodytes|18966         ------------------------------------------------------------
Pongo_abelii|18000            ---MEPPRAPALRRL-----------LPPLLLLLLSLPPRARAKYVRG------------
Dipodomys_ordii|13583         ------------------------------------------------------------
Pteropus_vampyrus|1266        ---MKPPRAPSLRRL-----------LPPLLLLLLPLPPRARAKYVRG------------
Sus_scrofa|3283               ---MEPPRAPALRRL-----------LPSLLLLLLPLPPRARAKYVRG------------
Sus_scrofa|3270               ---MEPPRAPALRRL-----------LPSLLLLLLPLPPRARAKYVRG------------

Caenorhabditis_elegans|25453  ------------------------------------------------------------
Apis_mellifera|1266           ------------------------------------------------------------
Linepithema_humile|13677      ------------------------------------------------------------
Pogonomyrmex_barbatus|12245   ------------------------------------------------------------
Nematostella_vectensis|10227  ------------------------------------------------------------
Culex_quinquefasciatus|5029   ------------------------------------------------------------
Bombyx_mori|11187             ------------------------------------------------------------
Tribolium_castaneum|5987      ------------------------------------------------------------
Daphnia_pulex|10805           ------------------------------------------------------------
Pediculus_humanus|10066       ------------------------------------------------------------
Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   ------------------------------------------------------------
Myotis_lucifugus|15204        ------------------------------------------------------------
Sorex_araneus|8555            ------------------------------------------------------------
Ornithorhynchus_anatinus|4641 ------------------------------------------------------------
Nematostella_vectensis|10325  ------------------------------------------------------------
Nematostella_vectensis|1279   ------------------------------------------------------------
Gasterosteus_aculeatus|4078   ------------------------------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Fugu_rubripes|3261            ------------------------------------------------------------
Oryzias_latipes|16123         ------------------------------------------------------------
Tetraodon_nigroviridis|1554   ------------------------------------------------------------
Microcebus_murinus|13869      ------------------------------------------------------------
Equus_caballus|862            ------------------------------------------------------------
Xenopus_tropicalis|3904       ------------------------------------------------------------
Tarsius_syrichta|6964         ------------------------------------------------------------
Canis_familiaris|11112        ------------------------------------------------------------
Monodelphis_domestica|5453    ------------------------------------------------------------
Loxodonta_africana|1711       ------------------------------------------------------------
Otolemur_garnettii|344        ------------------------------------------------------------
Erinaceus_europaeus|4780      ------------------------------------------------------------
Oryctolagus_cuniculus|6791    ------------------------------------------------------------
Procavia_capensis|2261        ------------------------------------------------------------
Rattus_norvegicus|26339       ------------------------------------------------------------
Mus_musculus|9434             ------------------------------------------------------------
Callithrix_jacchus|20556      ------------------------------------------------------------
Bos_taurus|21458              ------------------------------------------------------------
Cavia_porcellus|18075         ------------------------------------------------------------
Homo_sapiens|27443            ------------------------------------------------------------
Gorilla_gorilla|7553          ------------------------------------------------------------
Rhesus_macaque|35581          ------------------------------------------------------------
Pan_troglodytes|18966         ------------------------------------------------------------
Pongo_abelii|18000            ------------------------------------------------------------
Dipodomys_ordii|13583         ------------------------------------------------------------
Pteropus_vampyrus|1266        ------------------------------------------------------------
Sus_scrofa|3283               ------------------------------------------------------------
Sus_scrofa|3270               ------------------------------------------------------------

Caenorhabditis_elegans|25453  ------------------------------------------------------------
Apis_mellifera|1266           ------------------------------------------------------------
Linepithema_humile|13677      ------------------------------------------------------------
Pogonomyrmex_barbatus|12245   ------------------------------------------------------------
Nematostella_vectensis|10227  ------------------------------------------------------------
Culex_quinquefasciatus|5029   ------------------------------------------------------------
Bombyx_mori|11187             ------------------------------------------------------------
Tribolium_castaneum|5987      ------------------------------------------------------------
Daphnia_pulex|10805           ------------------------------------------------------------
Pediculus_humanus|10066       ------------------------------------------------------------
Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   ------------------------------------------------------------
Myotis_lucifugus|15204        ------------------------------------------------------------
Sorex_araneus|8555            ------------------------------------------------------------
Ornithorhynchus_anatinus|4641 ------------------------------------------------------------
Nematostella_vectensis|10325  ------------------------------------------------------------
Nematostella_vectensis|1279   ------------------------------------------------------------
Gasterosteus_aculeatus|4078   ------------------------------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Fugu_rubripes|3261            ------------------------------------------------------------
Oryzias_latipes|16123         ------------------------------------------------------------
Tetraodon_nigroviridis|1554   ------------------------------------------------------------
Microcebus_murinus|13869      ------------------------------------------------------------
Equus_caballus|862            ------------------------------------------------------------
Xenopus_tropicalis|3904       ------------------------------------------------------------
Tarsius_syrichta|6964         ------------------------------------------------------------
Canis_familiaris|11112        ------------------------------------------------------------
Monodelphis_domestica|5453    ------------------------------------------------------------
Loxodonta_africana|1711       ------------------------------------------------------------
Otolemur_garnettii|344        ------------------------------------------------------------
Erinaceus_europaeus|4780      ------------------------------------------------------------
Oryctolagus_cuniculus|6791    ------------------------------------------------------------
Procavia_capensis|2261        ------------------------------------------------------------
Rattus_norvegicus|26339       ------------------------------------------------------------
Mus_musculus|9434             ------------------------------------------------------------
Callithrix_jacchus|20556      ------------------------------------------------------------
Bos_taurus|21458              ------------------------------------------------------------
Cavia_porcellus|18075         ------------------------------------------------------------
Homo_sapiens|27443            ------------------------------------------------------------
Gorilla_gorilla|7553          ------------------------------------------------------------
Rhesus_macaque|35581          ------------------------------------------------------------
Pan_troglodytes|18966         ------------------------------------------------------------
Pongo_abelii|18000            ------------------------------------------------------------
Dipodomys_ordii|13583         ------------------------------------------------------------
Pteropus_vampyrus|1266        ------------------------------------------------------------
Sus_scrofa|3283               ------------------------------------------------------------
Sus_scrofa|3270               ------------------------------------------------------------

Caenorhabditis_elegans|25453  ------------------------------------------------------------
Apis_mellifera|1266           ------------------------------------------------------------
Linepithema_humile|13677      ------------------------------------------------------------
Pogonomyrmex_barbatus|12245   ------------------------------------------------------------
Nematostella_vectensis|10227  ------------------------------------------------------------
Culex_quinquefasciatus|5029   ------------------------------------------------------------
Bombyx_mori|11187             ------------------------------------------------------------
Tribolium_castaneum|5987      ------------------------------------------------------------
Daphnia_pulex|10805           ------------------------------------------------------------
Pediculus_humanus|10066       ------------------------------------------------------------
Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   ------------------------------------------------------------
Myotis_lucifugus|15204        ------------------------------------------------------------
Sorex_araneus|8555            ------------------------------------------------------------
Ornithorhynchus_anatinus|4641 ------------------------------------------------------------
Nematostella_vectensis|10325  ------------------------------------------------------------
Nematostella_vectensis|1279   ------------------------------------------------------------
Gasterosteus_aculeatus|4078   ------------------------------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Fugu_rubripes|3261            ------------------------------------------------------------
Oryzias_latipes|16123         ------------------------------------------------------------
Tetraodon_nigroviridis|1554   ------------------------------------------------------------
Microcebus_murinus|13869      ------------------------------------------------------------
Equus_caballus|862            ------------------------------------------------------------
Xenopus_tropicalis|3904       ------------------------------------------------------------
Tarsius_syrichta|6964         ------------------------------------------------------------
Canis_familiaris|11112        ------------------------------------------------------------
Monodelphis_domestica|5453    ------------------------------------------------------------
Loxodonta_africana|1711       ------------------------------------------------------------
Otolemur_garnettii|344        ------------------------------------------------------------
Erinaceus_europaeus|4780      ------------------------------------------------------------
Oryctolagus_cuniculus|6791    ------------------------------------------------------------
Procavia_capensis|2261        ------------------------------------------------------------
Rattus_norvegicus|26339       ------------------------------------------------------------
Mus_musculus|9434             ------------------------------------------------------------
Callithrix_jacchus|20556      ------------------------------------------------------------
Bos_taurus|21458              ------------------------------------------------------------
Cavia_porcellus|18075         ------------------------------------------------------------
Homo_sapiens|27443            ------------------------------------------------------------
Gorilla_gorilla|7553          ------------------------------------------------------------
Rhesus_macaque|35581          ------------------------------------------------------------
Pan_troglodytes|18966         ------------------------------------------------------------
Pongo_abelii|18000            ------------------------------------------------------------
Dipodomys_ordii|13583         ------------------------------------------------------------
Pteropus_vampyrus|1266        ------------------------------------------------------------
Sus_scrofa|3283               ------------------------------------------------------------
Sus_scrofa|3270               ------------------------------------------------------------

Caenorhabditis_elegans|25453  ---------------------------------------------------------ILS
Apis_mellifera|1266           ---------------------------------------------------------NID
Linepithema_humile|13677      ------------------------------------------------------------
Pogonomyrmex_barbatus|12245   ---------------------------------------------------------NLT
Nematostella_vectensis|10227  ------------------------------------------------------------
Culex_quinquefasciatus|5029   ------------------------------------------------------------
Bombyx_mori|11187             ------------------------------------------------------------
Tribolium_castaneum|5987      ---------------------------------------------------------EIH
Daphnia_pulex|10805           ------------------------------------------------------------
Pediculus_humanus|10066       ---------------------------------------------------------HLV
Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   ------------------------------------------------------------
Myotis_lucifugus|15204        ------------------------------------------------------------
Sorex_araneus|8555            ------------------------------------------------------------
Ornithorhynchus_anatinus|4641 ---------------------------------------------------------NLS
Nematostella_vectensis|10325  ------------------------------------------------------------
Nematostella_vectensis|1279   ------------------------------------------------------------
Gasterosteus_aculeatus|4078   ------------------------------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Fugu_rubripes|3261            ------------------------------------------------------------
Oryzias_latipes|16123         ---------------------------------------------------------VVN
Tetraodon_nigroviridis|1554   ------------------------------------------------------------
Microcebus_murinus|13869      ---------------------------------------------------------NLS
Equus_caballus|862            ---------------------------------------------------------TLS
Xenopus_tropicalis|3904       ---------------------------------------------------------NLT
Tarsius_syrichta|6964         ---------------------------------------------------------NLS
Canis_familiaris|11112        ---------------------------------------------------------NLS
Monodelphis_domestica|5453    ------------------------------------------------------------
Loxodonta_africana|1711       ---------------------------------------------------------NLS
Otolemur_garnettii|344        ------------------------------------------------------------
Erinaceus_europaeus|4780      ---------------------------------------------------------NLS
Oryctolagus_cuniculus|6791    ---------------------------------------------------------NLS
Procavia_capensis|2261        ---------------------------------------------------------NLS
Rattus_norvegicus|26339       ---------------------------------------------------------NLS
Mus_musculus|9434             ---------------------------------------------------------NLS
Callithrix_jacchus|20556      ---------------------------------------------------------NLS
Bos_taurus|21458              ---------------------------------------------------------NLS
Cavia_porcellus|18075         ---------------------------------------------------------NLS
Homo_sapiens|27443            ---------------------------------------------------------NLS
Gorilla_gorilla|7553          ---------------------------------------------------------NLS
Rhesus_macaque|35581          ------------------------------------------------------------
Pan_troglodytes|18966         ------------------------------------------------------------
Pongo_abelii|18000            ---------------------------------------------------------NLS
Dipodomys_ordii|13583         ------------------------------------------------------------
Pteropus_vampyrus|1266        ---------------------------------------------------------NLS
Sus_scrofa|3283               ---------------------------------------------------------NLS
Sus_scrofa|3270               ---------------------------------------------------------NLS

Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   -----------------------------------------------------------M
Nematostella_vectensis|1279   ------------------------------------------------------------
Fugu_rubripes|3261            ------------------------------------------------------------
Tetraodon_nigroviridis|1554   ------------------------------------------------------------
Monodelphis_domestica|5453    ------------------------------------------------------------
Otolemur_garnettii|344        ------------------------------------------------------------

Caenorhabditis_elegans|25453  CEDRVQLLANHSENHQIIYLS--PYALDSSGNGRCQI-----------------------
Nasonia_vitripennis|10836     CFERESVLN--RELGQIVSLS---PYSTYTSVSGCYF-----------------------
Apis_mellifera|1266           CIEKESILW--HGIGQIIPLS-----TVTFEESGCIE-----------------------
Linepithema_humile|13677      CQEKESVLD--ISHGQIIPLN-----TSIDFFSGC-V-----------------------
Pogonomyrmex_barbatus|12245   CWEKQSILN--IKYGQIIPLN------TSEPFSGC-V-----------------------
Nematostella_vectensis|10227  CSNKMDVCT--SSA----------------------------------------------
Tribolium_castaneum|5987      CYEKEAVLH--VEQNQIINLTTTNRPPPTPQIRGNTI-----------------------
Daphnia_pulex|10805           CEERESLLL--IENNQIINLT---------------------------------------
Pediculus_humanus|10066       CWQKEKPLK--KEQNQIVNLT-----TKGLFDNGCNK-----------------------
Ixodes_scapularis|14499       ---MEPLKQ--PQKRIVMALV---------------------------------------
Branchiostoma_floridae|5657   CV----LLQ---------------------------------------------------
Myotis_lucifugus|15204        CLAKESVIR--PENNQVINLT------TQYAWSGCQX-----------------------
Sorex_araneus|8555            CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Ornithorhynchus_anatinus|4641 CVAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Nematostella_vectensis|10325  CTTREDKLY--RGNNQVINLT------TSFMWSGCKR-----------------------
Nematostella_vectensis|1279   ------------------------------------------------------------
Gasterosteus_aculeatus|4078   CYQKEAVLR--PENRQVINLT------TRYTWSGCVV-----------------------
Fugu_rubripes|4210            CYQKEAVLR--PENNQVINLT------TRYTWSGCMV-----------------------
Tetraodon_nigroviridis|1520   CYQKEAVLR--PENNQVINLT------THYTWSGCVV-----------------------
Fugu_rubripes|3261            ------------------------------------------------------------
Oryzias_latipes|16123         CYQKEAVLR--PENNQVINLT------THYTWSGCVV-----------------------
Tetraodon_nigroviridis|1554   ------------------------------------------------------------
Microcebus_murinus|13869      CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Equus_caballus|862            CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Xenopus_tropicalis|3904       CLMKESVIR--PENNQVINLT------TQYVWSGCQV-----------------------
Tarsius_syrichta|6964         CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Canis_familiaris|11112        CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Monodelphis_domestica|5453    ------------------------------------------------------------
Loxodonta_africana|1711       CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Otolemur_garnettii|344        ------------------------------------------------------------
Erinaceus_europaeus|4780      CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Oryctolagus_cuniculus|6791    CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Procavia_capensis|2261        CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Rattus_norvegicus|26339       CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Mus_musculus|9434             CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Callithrix_jacchus|20556      CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Bos_taurus|21458              CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Cavia_porcellus|18075         CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Homo_sapiens|27443            CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Gorilla_gorilla|7553          CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Rhesus_macaque|35581          CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Pan_troglodytes|18966         CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Pongo_abelii|18000            CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Dipodomys_ordii|13583         CIAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Pteropus_vampyrus|1266        CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Sus_scrofa|3283               CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------
Sus_scrofa|3270               CLAKESVIR--PENNQVINLT------TQYAWSGCQV-----------------------

Caenorhabditis_elegans|25453  --------------------------------------HSDGLGQQWI------------
Nasonia_vitripennis|10836     --------------------------------------TSED-KNQV-------------
Apis_mellifera|1266           -------------------------------------------KDAII------------
Linepithema_humile|13677      --------------------------------------EGDD-G--II------------
Pogonomyrmex_barbatus|12245   --------------------------------------EGDD-GTV--------------
Nematostella_vectensis|10227  --------------------------------------ISDNGTTTRL------------
Tribolium_castaneum|5987      ------------------------------------------------------------
Daphnia_pulex|10805           ------------------------------------------------------------
Pediculus_humanus|10066       ----------------------------------ENGRSSSRKNTGMI------------
Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   ------------------------------------------------------------
Myotis_lucifugus|15204        --------------------------------------XXXX-XXXXX------------
Sorex_araneus|8555            --------------------------------------VSKE-GTRYL------------
Ornithorhynchus_anatinus|4641 --------------------------------------VPEG-GTRYL------------
Nematostella_vectensis|10325  --------------------------------------VIVD-NKDML------------
Nematostella_vectensis|1279   ------------------------------------------------------------
Gasterosteus_aculeatus|4078   --------------------------------------EDDG-DEEVL------------
Fugu_rubripes|4210            --------------------------------------EGKG-DQQXL------------
Tetraodon_nigroviridis|1520   --------------------------------------EGEG-DEEVL------------
Fugu_rubripes|3261            ------------------------------------------------------------
Oryzias_latipes|16123         --------------------------------------EGDG-NEEVL------------
Tetraodon_nigroviridis|1554   ------------------------------------------------------------
Microcebus_murinus|13869      --------------------------------------VSEE-GTHYL------------
Equus_caballus|862            --------------------------------------VSEE-GTRYL------------
Xenopus_tropicalis|3904       --------------------------------------IKEA-GQSYL------------
Tarsius_syrichta|6964         --------------------------------------VSEE-GTRYL------------
Canis_familiaris|11112        --------------------------------------VSEE-GTRYL------------
Monodelphis_domestica|5453    ------------------------------------------------------------
Loxodonta_africana|1711       --------------------------------------VSEE-GTRYL------------
Otolemur_garnettii|344        ------------------------------------------------------------
Erinaceus_europaeus|4780      --------------------------------------VSEE-GTHYL------------
Oryctolagus_cuniculus|6791    --------------------------------------VSEA-GTRYL------------
Procavia_capensis|2261        --------------------------------------VSEE-GTRYL------------
Rattus_norvegicus|26339       --------------------------------------VSEE-GTRYL------------
Mus_musculus|9434             --------------------------------------VSEE-GTRYL------------
Callithrix_jacchus|20556      --------------------------------------VSEE-GTRYL------------
Bos_taurus|21458              --------------------------------------VSEE-GTRYL------------
Cavia_porcellus|18075         --------------------------------------VSEE-GTRYL------------
Homo_sapiens|27443            --------------------------------------VSEE-GTRYL------------
Gorilla_gorilla|7553          --------------------------------------VSEE-GTRYL------------
Rhesus_macaque|35581          --------------------------------------VSEE-GTRYL------------
Pan_troglodytes|18966         --------------------------------------VSEE-GTRYL------------
Pongo_abelii|18000            --------------------------------------VSEE-GTRYL------------
Dipodomys_ordii|13583         --------------------------------------VSEE-GTRYL------------
Pteropus_vampyrus|1266        --------------------------------------VSEE-GTRYL------------
Sus_scrofa|3283               --------------------------------------VSEE-GTRYL------------
Sus_scrofa|3270               --------------------------------------VSEE-GTRYL------------

Caenorhabditis_elegans|25453  ------------------------------------------------------------
Nasonia_vitripennis|10836     ------------------------------------------------------------
Apis_mellifera|1266           ------------------------------------------------------------
Linepithema_humile|13677      ------------------------------------------------------------
Pogonomyrmex_barbatus|12245   ------------------------------------------------------------
Nematostella_vectensis|10227  ------------------------------------------------------------
Culex_quinquefasciatus|5029   ------------------------DERVLYSNVEFNSLENTTDYKIFVEELFHGNQESSN
Tribolium_castaneum|5987      ------------------------------------------------------------
Daphnia_pulex|10805           ------------------------------------------------------------
Pediculus_humanus|10066       ------------------------------------------------------------
Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   ------------------------------------------------------------
Myotis_lucifugus|15204        ------------------------------------------------------------
Sorex_araneus|8555            ------------------------------------------------------------
Ornithorhynchus_anatinus|4641 ------------------------------------------------------------
Nematostella_vectensis|10325  ------------------------------------------------------------
Nematostella_vectensis|1279   ------------------------------------------------------------
Gasterosteus_aculeatus|4078   ------------------------------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Fugu_rubripes|3261            ------------------------------------------------------------
Oryzias_latipes|16123         ------------------------------------------------------------
Tetraodon_nigroviridis|1554   ------------------------------------------------------------
Microcebus_murinus|13869      ------------------------------------------------------------
Equus_caballus|862            ------------------------------------------------------------
Xenopus_tropicalis|3904       ------------------------------------------------------------
Tarsius_syrichta|6964         ------------------------------------------------------------
Canis_familiaris|11112        ------------------------------------------------------------
Monodelphis_domestica|5453    ------------------------------------------------------------
Loxodonta_africana|1711       ------------------------------------------------------------
Otolemur_garnettii|344        ------------------------------------------------------------
Erinaceus_europaeus|4780      ------------------------------------------------------------
Oryctolagus_cuniculus|6791    ------------------------------------------------------------
Procavia_capensis|2261        ------------------------------------------------------------
Rattus_norvegicus|26339       ------------------------------------------------------------
Mus_musculus|9434             ------------------------------------------------------------
Callithrix_jacchus|20556      ------------------------------------------------------------
Bos_taurus|21458              ------------------------------------------------------------
Cavia_porcellus|18075         ------------------------------------------------------------
Homo_sapiens|27443            ------------------------------------------------------------
Gorilla_gorilla|7553          ------------------------------------------------------------
Rhesus_macaque|35581          ------------------------------------------------------------
Pan_troglodytes|18966         ------------------------------------------------------------
Pongo_abelii|18000            ------------------------------------------------------------
Dipodomys_ordii|13583         ------------------------------------------------------------
Pteropus_vampyrus|1266        ------------------------------------------------------------
Sus_scrofa|3283               ------------------------------------------------------------
Sus_scrofa|3270               ------------------------------------------------------------

Caenorhabditis_elegans|25453  ----------------ACSGTRVFRSARSRWWFLAIANCDPSESEDRRLYNNESIGIYAE
Nasonia_vitripennis|10836     ----------------RCKSYREFRSSRPRWWFIALSDCHNDK------------GLNIS
Apis_mellifera|1266           ----------------RCSSNRRFRSSRPRWWFIALADCSSKS------------GLNIS
Linepithema_humile|13677      ----------------RCDSQRRFISVRPRWWFMVLADCSSTK-----------------
Pogonomyrmex_barbatus|12245   ----------------RCDSQRRFISARPRWWFIALADCSSKK------------GLNVT
Nematostella_vectensis|10227  ----------------RCTGQMIFRTVRTRWWFLVLSHCDAD-------------VLDMD
Tribolium_castaneum|5987      ----------------MCHNARKFRSARERWWFIALSNCNGTR------------GIHVK
Daphnia_pulex|10805           ------------------SASRTFRSSRERWWFIAVSNCPSSK------------GLSLK
Pediculus_humanus|10066       ----------------YCNNAKRFKSSRERWWFIAFSNCNSTK------------GLNVK
Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   -------------------------------------------------------GLNIQ
Myotis_lucifugus|15204        ----------------XXXXXXXXXXXXXXXXXXXXXXXXXX-------------XXXXX
Sorex_araneus|8555            ----------------SCSSGRSFRSVRERWWYIALSKCGXX-------------XXXXX
Ornithorhynchus_anatinus|4641 ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Nematostella_vectensis|10325  ----------------HCTSDRKFLSMRARWWYIVVSNCKGTK------------GLKLK
Nematostella_vectensis|1279   -------------------------------------------------------GLKLK
Gasterosteus_aculeatus|4078   ----------------SCVGARSSRSRRGE-------------------------GLQLE
Fugu_rubripes|4210            ----------------SFLGGRXFRS----------------------------------
Tetraodon_nigroviridis|1520   ----------------SCVGGRSFRS----------------------------------
Fugu_rubripes|3261            ------------------------------------------------------------
Oryzias_latipes|16123         ----------------SCVGGRSFRS--------------GD-------------GLQLE
Tetraodon_nigroviridis|1554   ----------------------------------------GD-------------GLQLE
Microcebus_murinus|13869      ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Equus_caballus|862            ----------------SCSSGR-IRSMMEEGWLALPASEGGG-------------AWEPR
Xenopus_tropicalis|3904       ----------------SCNSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Tarsius_syrichta|6964         ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Canis_familiaris|11112        ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Monodelphis_domestica|5453    ------------------------------------------------------------
Loxodonta_africana|1711       ----------------TCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Otolemur_garnettii|344        ------------------------------------------------------------
Erinaceus_europaeus|4780      ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Oryctolagus_cuniculus|6791    ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Procavia_capensis|2261        ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Rattus_norvegicus|26339       ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Mus_musculus|9434             ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Callithrix_jacchus|20556      ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Bos_taurus|21458              ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Cavia_porcellus|18075         ----------------SCSSGRSFRS--------------GE-------------GLQLE
Homo_sapiens|27443            ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Gorilla_gorilla|7553          ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Rhesus_macaque|35581          ----------------SCSSGRSFRS--------------GD-------------GLQLE
Pan_troglodytes|18966         ----------------SCSSGRSFRS--------------GD-------------GLQLE
Pongo_abelii|18000            ----------------SCSSGRSFRS--------------GD-------------GLQLE
Dipodomys_ordii|13583         ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Pteropus_vampyrus|1266        ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Sus_scrofa|3283               ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE
Sus_scrofa|3270               ----------------SCSSGRSFRSVRERWWYIALSKCGGD-------------GLQLE

Apis_mellifera|1266           YWISLTNAPHENFWKE-HFSADEFSM-----------------------QLRARRLLHIS
Linepithema_humile|13677      ------------------------DILPLLIATASIYVILVTLSFYVALQLRSRRLLHIS
Pogonomyrmex_barbatus|12245   YWISLTNAPPGSFWKE-HFSADEF------------------CNFHIALQLRSRRLLHIS
Ixodes_scapularis|14499       -----------------AF-----------------------------------------
Nematostella_vectensis|10325  YELNLTNGD--DFWTM-HFSADE-------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Fugu_rubripes|3261            -----------------------------------------------ADHLKGRQLLHTT
Canis_familiaris|11112        YEMVLTNGK--SFWTR-HFSADEFG-----------------------------------
Otolemur_garnettii|344        ------------------------------------------------------------
Dipodomys_ordii|13583         YEMVLTNGK--SFWTR-HFSADEF------------------------------------

Ixodes_scapularis|14499       ------------------------------------------------------------
Nematostella_vectensis|10325  ------------------------------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Canis_familiaris|11112        ---------------------------EHRGTQKPGSLRDVRVEC----------LLRDG
Otolemur_garnettii|344        ------------------------------------------------------------
Dipodomys_ordii|13583         ------------------------------------------------------------

Apis_mellifera|1266           FTVTK-------------------------------------------------------
Ixodes_scapularis|14499       ------------------------------------------YFDPGEVLYLYE-SPAGY
Nematostella_vectensis|10325  ------------------------------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Canis_familiaris|11112        YPDLP-------------------------------------------------------
Otolemur_garnettii|344        ------------------------------------------FFDPGQVLYTYE-SPAGY
Dipodomys_ordii|13583         ------------------------------------------FFDPGQVLYTYE-SPAGY

Culex_quinquefasciatus|5029   GLAGLRCIGWGFFIYSCAA-TIRKFTEKGPFYYPF---------------TLLEQIKVSR
Ixodes_scapularis|14499       GIVALRLVGWGWFVYATVF-TLLHYPEKTAFYTRLFLLYTIW------------------
Nematostella_vectensis|10325  ------------------------------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Canis_familiaris|11112        ----------------VLI-SLRHFPEKQPFYVPFFAAYTLW-FFAVPVMALIANFGIPK
Erinaceus_europaeus|4780      GLIGLQVAAYVWFCYAVLV-SLRHFPEKQPFYVPFFAAYTL-------------------

Nematostella_vectensis|10227  WERTKIFSGVDFAISAIGFLVFLHLLRPSRTNHNFPFHIRTNQI----------------
Culex_quinquefasciatus|5029   TMCEQITS------------VFRLLTMK--------------------------------
Ixodes_scapularis|14499       ------------------------------------------------------------
Nematostella_vectensis|10325  ------------------------------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Erinaceus_europaeus|4780      ------------------------------------------------------------
Sus_scrofa|3283               WAREKIVNGIQLGIHLYAHGVFLV------------------------------------

Nasonia_vitripennis|10836     ----------GHAYEPQS---RTAMTL-----------FTLSHSPPTVNTIS--------
Apis_mellifera|1266           ----------DHSYEPNI---RTASSA-----------FTISHLTPSILQS---------
Linepithema_humile|13677      ----------DHSYEPGP---RTAVTA---------------FTISRTPTYLSQ--PHYT
Pogonomyrmex_barbatus|12245   ----------DHSYEPGP---RTAVTA---------------FTITRTPAYFNQSQ----
Nematostella_vectensis|10227  ------------------------------------------------------------
Culex_quinquefasciatus|5029   ------------------------------------------------------------
Daphnia_pulex|10805           PNHLDLDRFPHHPYEPTL---RYSNPN------------GSIYAISNGAVH---------
Pediculus_humanus|10066       ---SSIYQFGHHTYAPGG---PVGIR----------EVPFELFSVSRQLDLRDKPLDFES
Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   ---NLDHFPHQSMYSTSTDSSFIGGGG---------PNFTELFTVATPTSVRVE------
Myotis_lucifugus|15204        ---EADKAFPQHVXXXXX---XXXXXX---------XXXXXXXXXXXXXXXAGK------
Ornithorhynchus_anatinus|4641 --QAGGKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPP------------
Nematostella_vectensis|10325  ------------------------------------------------------------
Nematostella_vectensis|1279   ------------------------------------------------------------
Gasterosteus_aculeatus|4078   ---EGGESFPHHAYGNGS---FLGDSQ---------PNFTELFSIHPPPRVVA-------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Fugu_rubripes|3261            ---EGAEGFPHHAYGNSS---FLGDSQ---------PNFTELFSI---------------
Oryzias_latipes|16123         ---EGAESFPHHAYGNSS---FLGDSQ---------PNFTELFSIQSVSRF---------
Tetraodon_nigroviridis|1554   ---EGAESFPHHAYGNST---FLGDSQ---------PNFTELFSI---------------
Microcebus_murinus|13869      ---SSDKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPASSAGK------
Equus_caballus|862            ---SADKTFPQHVYGNVT---FISDSV---------PNFTELFSIPPPASS---------
Xenopus_tropicalis|3904       ---QSTEKFPHHVYGNVT---FISDSV---------PNVTELFSIPSNNGSAGG------
Tarsius_syrichta|6964         ---SSDKTFPQHVYGNVT---FISDSV---------PNFTELFSIPPPASSXXX------
Canis_familiaris|11112        ---STDKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPASSVSP------
Monodelphis_domestica|5453    EGAPADKAFPQHVYGNVT---FISDSV---------PNFTELFSIP--------------
Loxodonta_africana|1711       ---SGAK-FPQHVYGNVT---FISDSV---------PNFTELFSIPPPASSAGK------
Otolemur_garnettii|344        ---SGDKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPASSAGK------
Erinaceus_europaeus|4780      ------------------------------------------------------------
Procavia_capensis|2261        ---SGAKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPASSAGK------
Rattus_norvegicus|26339       ---SADKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPTSSAGK------
Mus_musculus|9434             ---SADKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPTSSAGK------
Callithrix_jacchus|20556      ---SADKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPASSAGK------
Bos_taurus|21458              ---SADKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPASCAGK------
Cavia_porcellus|18075         ---SADKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPTSS---------
Homo_sapiens|27443            ---SADKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPATSAGK------
Gorilla_gorilla|7553          ---SADKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPATS---------
Rhesus_macaque|35581          ---SADKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPTTS---------
Pan_troglodytes|18966         ---SADKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPATS---------
Pongo_abelii|18000            ---SADKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPATS---------
Dipodomys_ordii|13583         ---PSDKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPASS---------
Pteropus_vampyrus|1266        ---SADKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPASSAGK------
Sus_scrofa|3283               ------------------------------------------------------------
Sus_scrofa|3270               ---SADKAFPQHVYGNVT---FISDSV---------PNFTELFSIPPPASSAGK------

Caenorhabditis_elegans|25453  ------------------------------------------------------------
Nasonia_vitripennis|10836     ------------------------------------------------------------
Apis_mellifera|1266           ------------------------------------------------------------
Linepithema_humile|13677      ------------------------------------------------------------
Pogonomyrmex_barbatus|12245   ------------------------------------------------------------
Nematostella_vectensis|10227  ------------------------------------------------------------
Culex_quinquefasciatus|5029   ------------------------------------------------------------
Daphnia_pulex|10805           ------------------------------------------------------------
Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   ------------------------------------------------------------
Ornithorhynchus_anatinus|4641 ------------------------------------------------------------
Nematostella_vectensis|10325  ------------------------------------------------------------
Nematostella_vectensis|1279   ------------------------------------------------------------
Gasterosteus_aculeatus|4078   ------------------------GDIDPPPLISPLLPPGPGEDG---------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Fugu_rubripes|3261            ------------------------------------------------------------
Oryzias_latipes|16123         ------------------------------------------------------------
Tetraodon_nigroviridis|1554   ------------------------------------------------------------
Equus_caballus|862            -----------------------------PLPRAAPDSGLPLFRDLRPP-----------
Monodelphis_domestica|5453    ------------------------------------------------------------
Erinaceus_europaeus|4780      ------------------------------------------------------------
Cavia_porcellus|18075         -----------------------------PLPRTAPDSGLPLFCDLRPP-----------
Gorilla_gorilla|7553          -----------------------------XXPRAAPDSGLPLFRDLRPP-----------
Rhesus_macaque|35581          -----------------------------PLPRTAPDSGLPLFRDLRPP-----------
Pan_troglodytes|18966         -----------------------------PLPRAAPDSGLPLFRDLRPP-----------
Pongo_abelii|18000            -----------------------------PLPRAAPDSGLQLFRDLRPP-----------
Dipodomys_ordii|13583         ------------------------------------------------------------
Sus_scrofa|3283               ------------------------------------------------------------

Caenorhabditis_elegans|25453  ------------------------------------------------------------
Nasonia_vitripennis|10836     ------------------------------------------------------------
Apis_mellifera|1266           ------------------------------------------------------------
Linepithema_humile|13677      ------------------------------------------------------------
Pogonomyrmex_barbatus|12245   ------------------------------------------------------------
Nematostella_vectensis|10227  ------------------------------------------------------------
Culex_quinquefasciatus|5029   ------------------------------------------------------------
Tribolium_castaneum|5987      PNGHFDDYVREVPIQLFTVSKMVTGNNDTPNGKTV-------------------------
Daphnia_pulex|10805           ------------------------------------------------------------
Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   ------------------------------------------------------------
Ornithorhynchus_anatinus|4641 ------------------------------------------------------------
Nematostella_vectensis|10325  ------------------------------------------------------------
Nematostella_vectensis|1279   ------------------------------------------------------------
Gasterosteus_aculeatus|4078   ------------------------------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Fugu_rubripes|3261            ------------------------------------------------------------
Oryzias_latipes|16123         ------------------------------------------------------------
Tetraodon_nigroviridis|1554   ------------------------------------------------------------
Equus_caballus|862            ------------------------------------------------------------
Xenopus_tropicalis|3904       HQNGFPEYFSIR------------------------------------------------
Tarsius_syrichta|6964         QHTGFTEYFSMH------------------------------------------------
Monodelphis_domestica|5453    ------------------------------------------------------------
Erinaceus_europaeus|4780      ------------------------------------------------------------
Oryctolagus_cuniculus|6791    PHTGL-EYFSMH------------------------------------------------
Procavia_capensis|2261        PHTGFTEYFSMH------------------------------------------------
Rattus_norvegicus|26339       PHTGFTEYFSMH------------------------------------------------
Mus_musculus|9434             PHTGFTEYFSMH------------------------------------------------
Callithrix_jacchus|20556      PHTGFTEYFSMH------------------------------------------------
Bos_taurus|21458              PHTGFTEYFSMH------------------------------------------------
Cavia_porcellus|18075         ------------------------------------------------------------
Homo_sapiens|27443            PHTGFTEYFSMH------------------------------------------------
Gorilla_gorilla|7553          ------------------------------------------------------------
Rhesus_macaque|35581          ------------------------------------------------------------
Pan_troglodytes|18966         ------------------------------------------------------------
Pongo_abelii|18000            ------------------------------------------------------------
Dipodomys_ordii|13583         ------------------------------------------------------------
Pteropus_vampyrus|1266        PHTGFTEYFSMH------------------------------------------------
Sus_scrofa|3283               ------------------------------------------------------------
Sus_scrofa|3270               PHTGFTEYFSMH------------------------------------------------

Caenorhabditis_elegans|25453  ------------------------------------------------------------
Nasonia_vitripennis|10836     ------------------------------------------------------------
Apis_mellifera|1266           ------------------------------------------------------------
Linepithema_humile|13677      ------------------------------------------------------------
Pogonomyrmex_barbatus|12245   ------------------------------------------------------------
Nematostella_vectensis|10227  ------------------------------------------------------------
Culex_quinquefasciatus|5029   ------------------------------------------------------------
Tribolium_castaneum|5987      ------------------------------------------------------------
Daphnia_pulex|10805           ------------------------------------------------------------
Pediculus_humanus|10066       PSPTKTNEQSDNKSELSIEKLTDMFTATSRKNN---------------------------
Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   ------------------------------------------------------------
Ornithorhynchus_anatinus|4641 ------------------------------------------------------------
Nematostella_vectensis|10325  ------------------------------------------------------------
Nematostella_vectensis|1279   ------------------------------------------------------------
Gasterosteus_aculeatus|4078   ------------------------------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Fugu_rubripes|3261            ------------------------------------------------------------
Oryzias_latipes|16123         ------------------------------------------------------------
Tetraodon_nigroviridis|1554   ------------------------------------------------------------
Equus_caballus|862            -----------------------------------------------GPLRDL-------
Xenopus_tropicalis|3904       ---------------------------------------------SAGPQPM--------
Tarsius_syrichta|6964         --------------------------------------------TAGGTAPPV-------
Monodelphis_domestica|5453    ------------------------------------------------------------
Erinaceus_europaeus|4780      ------------------------------------------------------------
Oryctolagus_cuniculus|6791    --------------------------------------------TAGGTAPPG-------
Procavia_capensis|2261        --------------------------------------------TAGGTAPPV-------
Rattus_norvegicus|26339       --------------------------------------------TAGGPAPPV-------
Mus_musculus|9434             --------------------------------------------TAGGPAPPV-------
Callithrix_jacchus|20556      --------------------------------------------TAGGTAPPV-------
Bos_taurus|21458              --------------------------------------------TAGGTAPPV-------
Cavia_porcellus|18075         -----------------------------------------------GPLRDL-------
Homo_sapiens|27443            --------------------------------------------TAGGTAPPV-------
Gorilla_gorilla|7553          -----------------------------------------------GPLRDL-------
Rhesus_macaque|35581          -----------------------------------------------GPLRDL-------
Pan_troglodytes|18966         -----------------------------------------------GPLRDL-------
Pongo_abelii|18000            -----------------------------------------------GPLRDL-------
Dipodomys_ordii|13583         ------------------------------------------------------------
Pteropus_vampyrus|1266        --------------------------------------------TAGGTAPPV-------
Sus_scrofa|3283               ------------------------------------------------------------
Sus_scrofa|3270               --------------------------------------------TAGGNAPPV-------

Caenorhabditis_elegans|25453  ------------------------------------------------------------
Nasonia_vitripennis|10836     ------------------------------------------------------------
Apis_mellifera|1266           ------------------------------------------------------------
Linepithema_humile|13677      ------------------------------------------------------------
Pogonomyrmex_barbatus|12245   ------------------------------------------------------------
Nematostella_vectensis|10227  ------------------------------------------------------------
Culex_quinquefasciatus|5029   ------------------------------------------------------------
Bombyx_mori|11187             QNIVSKATMDLFNANSNKD-----------------------------------------
Tribolium_castaneum|5987      ------------------------------------------------------------
Daphnia_pulex|10805           ------------------------------------------------------------
Pediculus_humanus|10066       ------------------------------------------------------------
Ixodes_scapularis|14499       ------------------------------------------------------------
Branchiostoma_floridae|5657   ------------------------------------------------------------
Ornithorhynchus_anatinus|4641 ------------------------------------------------------------
Nematostella_vectensis|10325  ------------------------------------------------------------
Nematostella_vectensis|1279   ------------------------------------------------------------
Gasterosteus_aculeatus|4078   ------------------------------------------------------------
Fugu_rubripes|4210            ------------------------------------------------------------
Tetraodon_nigroviridis|1520   ------------------------------------------------------------
Fugu_rubripes|3261            ------------------------------------------------------------
Oryzias_latipes|16123         ------------------------------------------------------------
Tetraodon_nigroviridis|1554   ------------------------------------------------------------
Equus_caballus|862            ------------------------------------------------------------
Xenopus_tropicalis|3904       ------------------------------------------------------------
Tarsius_syrichta|6964         ------------------------------------------------------------
Monodelphis_domestica|5453    ------------------------------------------------------------
Loxodonta_africana|1711       PRDPCDEHQDPAHSRTPRHRATASGTDIVKLVSAL-------------------------
Erinaceus_europaeus|4780      ------------------------------------------------------------
Oryctolagus_cuniculus|6791    ------------------------------------------------------------
Procavia_capensis|2261        ------------------------------------------------------------
Rattus_norvegicus|26339       ------------------------------------------------------------
Mus_musculus|9434             ------------------------------------------------------------
Callithrix_jacchus|20556      ------------------------------------------------------------
Bos_taurus|21458              ------------------------------------------------------------
Cavia_porcellus|18075         ------------------------------------------------------------
Homo_sapiens|27443            ------------------------------------------------------------
Gorilla_gorilla|7553          ------------------------------------------------------------
Rhesus_macaque|35581          ------------------------------------------------------------
Pan_troglodytes|18966         ------------------------------------------------------------
Pongo_abelii|18000            ------------------------------------------------------------
Dipodomys_ordii|13583         ------------------------------------------------------------
Pteropus_vampyrus|1266        ------------------------------------------------------------
Sus_scrofa|3283               ------------------------------------------------------------
Sus_scrofa|3270               ------------------------------------------------------------

Caenorhabditis_elegans|25453  ------------------
Nasonia_vitripennis|10836     ------------------
Apis_mellifera|1266           ------------------
Linepithema_humile|13677      ------------------
Pogonomyrmex_barbatus|12245   ------------------
Nematostella_vectensis|10227  ------------------
Culex_quinquefasciatus|5029   ------------------
Bombyx_mori|11187             ------------------
Tribolium_castaneum|5987      ------------------
Daphnia_pulex|10805           ------------------
Pediculus_humanus|10066       ------------------
Ixodes_scapularis|14499       ------------------
Branchiostoma_floridae|5657   ------------------
Myotis_lucifugus|15204        VERFSPSCQNR-------
Sorex_araneus|8555            LFSRSGQNK---------
Ornithorhynchus_anatinus|4641 ------------------
Nematostella_vectensis|10325  ------------------
Nematostella_vectensis|1279   ------------------
Gasterosteus_aculeatus|4078   ------------------
Fugu_rubripes|4210            ------------------
Tetraodon_nigroviridis|1520   ------------------
Fugu_rubripes|3261            ------------------
Oryzias_latipes|16123         ------------------
Tetraodon_nigroviridis|1554   ------------------
Microcebus_murinus|13869      RSLAERLFPPSCQNR---
Equus_caballus|862            ------------------
Xenopus_tropicalis|3904       ------------------
Tarsius_syrichta|6964         ------------------
Canis_familiaris|11112        RQKDFLPSCQNKADSLSF
Monodelphis_domestica|5453    ------------------
Loxodonta_africana|1711       ------------------
Otolemur_garnettii|344        GSPPSCQNK---------
Erinaceus_europaeus|4780      ------------------
Oryctolagus_cuniculus|6791    ------------------
Procavia_capensis|2261        ------------------
Rattus_norvegicus|26339       ------------------
Mus_musculus|9434             ------------------
Callithrix_jacchus|20556      ------------------
Bos_taurus|21458              ------------------
Cavia_porcellus|18075         ------------------
Homo_sapiens|27443            ------------------
Gorilla_gorilla|7553          ------------------
Rhesus_macaque|35581          ------------------
Pan_troglodytes|18966         ------------------
Pongo_abelii|18000            ------------------
Dipodomys_ordii|13583         ------------------
Pteropus_vampyrus|1266        ------------------
Sus_scrofa|3283               ------------------
Sus_scrofa|3270               ------------------