Orthologs Set ID: EOG4006BZ

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Drosophila grimshawi 1338 435, 807, 2175
Drosophila melanogaster 19470 435, 807, 2160
Drosophila virilis 5685 435, 807, 2175, 2376

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Drosophila grimshawi 1338 FBtr0159584 6565877 FBgn0131626 GH24170 droGri2
Drosophila melanogaster 19470 FBtr0070119, NM_057245 31010 FBgn0001341 l(1)1Bi dm3
Drosophila virilis 5685 FBtr0232619 6633309 FBgn0203877 GJ16694 droVir3

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Drosophila grimshawi 13869 FBpp0158076 6565877 FBgn0131626 GH24170 droGri2
Drosophila melanogaster 17982 FBpp0070114 31010 FBgn0001341 l(1)1Bi dm3
Drosophila virilis 6665 FBpp0231111 6633309 FBgn0203877 GJ16694 droVir3

multiple sequence alignment in CLUSTALW format

Drosophila_melanogaster|19470 ATGAAGAGCAAGGTG---------------------------------------------
                              ***.. *. ***.:*                                             

Drosophila_melanogaster|19470 ------------------------------GATAAACCCGTAACCAATGGTGCACCAAAT
Drosophila_grimshawi|1338     ------------------------------AAACCAAATAAAAGGGAAGGTTCTCCGATC
                                                            .*:..*.. .:*.   * .*  * *...  

                               ...  .. *..*. .. .. .** .... .. .... ..*..     .**:. *...*.

Drosophila_melanogaster|19470 GACTCG---------------------CAAATACCGGCCAAGATTTTGAAGAAGTCCAAG
                              *.  ..                      ... .*****.****::   **..:  *    

                                       *. **  . *.  * .  .*... .**.*...: .  ...  .* .. ** 

                               ** * .  :* .. **.** ****  .* ** *  .* *****.*** ****.*..   

                                    *.:.*..: .*. ..*.*.  .* **  ...* **:.* ***** . ..* ** 

                              . ... ** ** .:*** ** **.***:  * .** *   * *****  **.* **** *

                              ** **.**.*******:..* .* ** . * * .. ***** ** ** .*  ****  * 

                              ..* . *** * * *.* .*  * :* *** * .* .. .  ********.** **. . 

                              *  ..*********.*.******.***** :*. *.** *  ** ** **  * .* **.

                                 *:   ***:.* .*.*  *.. * **  . ... *...* *..** *..* .. * .

                              .* *: *. **: * . .**.**  *.*****..* ** **  ****. * .***  .  

                              ** ** .**** *:.***** **.*** *:  *   *. *  **  *. .  * ** ***

                              **. * *****.** .*.**.*. ... * :* .  .   :.*.  **.* .  ******

                               *  ** *  ****.**  ***.**:* *  .  *. **  .*   . .*  * .:. * 

                              *   * ****     .**.*. *  :.*: ...***** ** **    *** * :.*.. 

                               *.* *** ** .**** *** *.** *. .*: ***  *. ***** *           

                              :.*  *.*..*. *  **** .*************. **** *   . .*  :***  *.

                              **.*  .: . .******   *. .  .* ***. .** :  ** .* ** .* .***: 

Drosophila_melanogaster|19470 AAGCCA---------------AGGGAAGAACAACTCATCCTGGATATCTTT---ACACCG
                              .*  .:               .* .. **   .*:  *  :* * .* ***   . . ..

                              .*    **:.. :*  *. *  . **.    *. * *  **. ..      .. **.   

                              .* . .:.    **. *  *  :..  .** *...  . **:***  ***.** ***.  

                               *  ** *  * :* *:* *..* .** * .*..*  *  . :.***. *  .*.*.***

                              *   . .*.*** ***: ...**.**.******:. .* .   . : ***.** ***:  

                              ***.*.***.*..  **.** ..**:  . .* *   . .:*.**** ** *:*** ..*

                              .* .** * : *:   : .. **  :    .  ...   .. ** *:* * ***** ** 

Drosophila_grimshawi|1338     CAGATGCAC------------------CAGCTGCAGCTGGAGTTTAGCAAGCGTAGCGAT
Drosophila_virilis|5685       CAAATGCAA------------------CAGCTGCAGAAC------TCCAGGCGCAACAAG
                              **.*****.                  .**** .. .:       : .:.*** .. .* 

                              *** * .* *:  *. *  :***     * *****  *..* *.  . .******* ** 

                              .. *  *   *.   ** . .   ** ***** ***   **  * ** ** ******.  

                               *  * .* * * *  **.* **.            : * .. .  ** *.. .** :. 

                               .. :.****.   *. . *  *  * ** .. **. *  *.  ..*.****.    ***

                                 **. **** :  ..   ..   .  .. * *.. : . .*** .. .*.*  . .:.

                               *  **.*           * . ***.** :   . .   * *   ::  .** ** ** 

                              ** .******   *     **** :***  * .   *. :  .    : * .  ... * 

                               * .. **  * :* ** ***.. .*.** **.**       .*....  ****** .*.

                               : .. .*  .     .                ******** ** ** *******  **.

                              ** **.**. *  ******* **:***** *****    ***** .*:   .*   *.  

                              **  **** ** **  * .. ..... ** ** *..*** * ** **. : ** .* ***

                              ......***** ***..*.:.**.   **  * **  * ** ..       .. ** ** 

Drosophila_melanogaster|19470 CTCGACAAG---------------------------------------------------
Drosophila_virilis|5685       GAGGATGAA---------------------------------------------------
                               : ** .*.                                                   

Drosophila_melanogaster|19470 ---------------------------GAAGAATCGTTGAAGGATTCAAGCGATGATTCA
Drosophila_virilis|5685       ---------------------------GAGGATGAAGATGATGACGATGATGAAGACGAT
                                                         **.**: .. : .* **  .:.. .*:**  .:

                              ** ** .* ** **.*. **:** *.*** ** *. *** * ****.:*. :*..* ***

                              *. *..**:** **... **:****: **  ** ***.*.***...**   ** **  : 

                              *.  * ***** .* ** ******** ** ..***.**. *******:**  * **    

                              **  ****..   * ** ** .    *...** ***     .*. . . . .*  . .*.

                              ** *. ***********.***** .. ..*** ... ****.***** ***** ** *  

                               * *** *. * **.*: ** .* .  .. ...** .. *:. .  * .*. **.*** .

                              **...  * .*  : .* ** ** .. .: :**  *.* ** . ***.**..*. *.***

                                  *..**** :: ***: *** ..... .*..**.* .  ** * ..      .  ..

                              ..     .*..**.  ...*.*** * **   *** .**... **.**            

Drosophila_grimshawi|1338     ------------------GTTCTGAAATCGCCG---AAAAACGCCGAACATGCGCCAAAC
                                                    : ..    ..*   ..  .      ..* ** ......

                              ** :  .:  * ***** .***..***:**** **  *  *** ***.  . .:   *. 

                                ..*    *  . ..  ...**  ..** **  *. : ...*:     *  : * *   

Drosophila_grimshawi|1338     ------------------------GTGGCCAGCTTTGGTACGTTGTTCGGCACGCAG---
                                                       ******  ** *.:.*  * **  . :*       

                              *** : **..*** :    : ** .  . * *       *: :*.   . ..*      .

                              .* .   * **.** . .**.::: * .* ***** . *.*.**    ** ** .*  . 

                              .: .*  * .. .* .* .   .* *: **.. .*.**  . .  .:  * ..*..*** 

Drosophila_grimshawi|1338     ------------------CAGCCAACTGGCGCATCTGATCGCAAACTGCATAAGAAGCTG
Drosophila_virilis|5685       ------------------GAGCCGGTCGCCGACAAGGATCGCAGTCTGCAAAAGAAGCTG
                                                 ** * .  .   ..:. **:* **.:****: .: ***.* 

Drosophila_grimshawi|1338     CTCGCTAAG---------------------------------------------------
Drosophila_virilis|5685       CTCGCTCAG---------------------------------------------------
                              ***** .*.                                                   

Drosophila_grimshawi|1338     ------------------------------------------------CTGCAAAAGTAT
Drosophila_virilis|5685       ------------------------------------------------CTGCAAAAGGTC
                                                                                 .**..  : 

Drosophila_melanogaster|19470 GTCGTGGAAGATGAAGAGTCCACATAA
Drosophila_grimshawi|1338     TCT---------------------TAA
Drosophila_virilis|5685       CTCACGGAGGCTGAAGATAGCGCCTAG

multiple sequence alignment in CLUSTALW format

Drosophila_melanogaster|17982 MKSKV-------------------------DKPVTNGAPNATKTKAKEDRKRAKTQKSEA
                              * .*                          .    :.:     .. :: : : :  :. :

                               .         ***  * :     :  : : :..   : :*..:.***.:* :*:*:*  

                                .: : : :*.:*:** ::: *: **** .*.****:*.***** .:*:* ****: *:

                                *..:..:*::..***:* ..***:***::**.**:*:*  .*:::  *  . .:*: .

                              :: ** *:****:***::. **:* ****:    *:.:*******:*. .::  .:: **

                              :**:***.:. :*  .:: : **  ::. : ***: *:..::::.**:* **..**.   

                               ..:::*:****:*  : *.*   **.  :*.*:*:*:::.      * :  : ::*   

                              . *.:** * ::.*   .*.:   *.:  :*: ** *** :*::.::::::::  ** :*

                                :*:  ****.: . *** *:*: **.  .   :*::* ::: *  :   :  * :**:

                              **:      :*.   . *..**::** *.:***: .:*** . : *: **** *:**** 

                              ::..:::*     . *. *   *:  *  * *.:.:*. *.***     .::  *  :. 

                              :::   . *:  .:.  *:**:* :.**:   .   :  :: *::**::***  : .*::

                               .:.       **:****.************* **: :  **:***   ** *.*: *:*

Drosophila_melanogaster|17982 NKNPLSKKSDGEEES--DDELDK--------------------------EESLKDSSDDS
Drosophila_virilis|6665       DRNPLDDK-DWDDDDDKSDEEDE--------------------------EDEDDDDDEDD
                               :***. * * :::.  .:: *:                          *:. .*..:*.

                              ::::: :: *:.* *  ::* :***.** **:.: : :* .:**:*****.**:*:*** 

                              *** :*:  :**. . .: :* ****** .* ***:***.***:* *:  :*  ..:::.

                              *  : :**  ..:* **:.* ::* * *::::: :    .   .. .*::.*: *:    

                                       .    . :*  :  :**::*:***.:* .   : . : * *** .: :   

                                      :*:* ::* :  * *:.  *  :   :  :    .** * *.** :: **: 

Drosophila_grimshawi|13869    NALANDSKAAKELTTKLNEY------QPTGASDRKLHKKLLAK-----------------
Drosophila_virilis|6665       NTLTNKLQTAREFHGILNKY------EPVADKDRSLQKKLLAQ-----------------
                               :: :. .:::::   : .*      :. . .: .*  *:**:                 

Drosophila_melanogaster|17982 DLQPNKKVAKQKKQAAAKPMVVEDEEST
Drosophila_grimshawi|13869    ----------------LQKYS-------
Drosophila_virilis|6665       ----------------LQKVLTEAEDSA