Orthologs Set ID: EOG4006C7

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Anolis carolinensis 1880 190, 295, 413, 523, 634, 850, 931, 1303, 1408, 1552
Apis mellifera 33252 26, 190, 413, 634, 844, 1408, 1552
Bombyx mori 3167 26, 190, 282, 413, 506, 634, 749, 844, 951, 1408, 1552
Bos taurus 25682 26, 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Branchiostoma floridae 18400 26, 190, 413, 523, 634, 850
Branchiostoma floridae 44754 190, 413, 523, 634
Branchiostoma floridae 5695 413, 523, 634, 850
Branchiostoma floridae 887 601, 803, 838
Caenorhabditis elegans 27393 26, 198
Caenorhabditis elegans 6304 26, 198, 601, 827, 1408
Callithrix jacchus 47840 26, 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Canis familiaris 3388 26, 190, 295, 413, 523, 634, 850, 914, 979, 1066, 1153, 1242, 1408, 1552
Canis familiaris 3941 288
Cavia porcellus 24579 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Choloepus hoffmanni 9491 26, 190, 295, 413, 520, 634, 850, 931, 1408, 1552
Culex quinquefasciatus 1738 26, 190
Danio rerio 3367 26, 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Daphnia pulex 15590 26, 190, 413, 634, 850, 1552
Dasypus novemcinctus 5847 190, 211, 218, 270, 295, 413, 523, 634, 850, 931, 939, 1265, 1408, 1552
Dipodomys ordii 7317 26, 190, 295, 413, 523, 634, 850, 931, 946, 1408, 1552
Drosophila grimshawi 1865
Drosophila melanogaster 18121
Drosophila persimilis 11363 26, 190, 413
Drosophila persimilis 788 318
Drosophila yakuba 11269
Echinops telfairi 19011 189, 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Equus caballus 16351 26, 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Erinaceus europaeus 11918 189, 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Felis catus 38736 26, 190, 295, 413, 523, 634, 741, 786, 816, 834, 850, 931, 1408, 1552
Fugu rubripes 35640 26, 190, 523, 634, 850, 931, 1408, 1552
Gallus gallus 23172 26, 190, 289, 413, 523, 634, 850, 922, 1408, 1552
Gasterosteus aculeatus 20997 26, 190, 295, 413, 523, 634, 690, 850, 948, 1408, 1552
Gorilla gorilla 2854 26, 190, 295, 413, 462, 497, 502, 520, 548, 560, 607, 634, 850, 931, 1408, 1552
Homo sapiens 94689 26, 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Ixodes scapularis 15246 190, 413, 523, 629, 633, 850, 1408
Linepithema humile 11144 850, 1408
Linepithema humile 7459 190, 413, 1459
Loxodonta africana 22972 26, 190, 289, 413, 523, 634, 850, 931, 1408, 1552
Macropus eugenii 6041 143, 190, 204, 295, 413, 523, 634, 850, 922, 929, 931, 1408, 1552
Microcebus murinus 10528 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Monodelphis domestica 25651 190, 295, 413, 523, 634, 834, 928, 1408, 1552
Mus musculus 29008 26, 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Myotis lucifugus 17731 189, 190, 295, 413, 523, 634, 696, 705, 850, 931, 1329, 1365, 1386, 1408
Nasonia vitripennis 1384 26, 190, 413, 634, 844, 1408, 1552
Nematostella vectensis 10656
Nematostella vectensis 2681 26, 190, 413, 523, 634, 850, 1462
Ochotona princeps 18056 26, 190, 295, 413, 520, 634, 850, 931, 1408, 1552, 1653
Ornithorhynchus anatinus 25585 523, 634, 850, 931, 1408, 1552
Ornithorhynchus anatinus 6257 26, 190, 295
Oryzias latipes 23688 26, 190, 295, 413, 523, 634, 850, 931, 1408
Otolemur garnettii 2226 190, 295, 297, 413, 493, 523, 634, 850, 931, 1408
Pan troglodytes 37427 26, 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Pediculus humanus 4789 190, 413, 634, 844, 1297, 1408, 1552
Pogonomyrmex barbatus 12993 26, 190, 413, 634, 844, 1408, 1552
Pongo abelii 28018 26, 190, 295, 413, 523, 634, 850, 931, 1408, 1552, 1572
Procavia capensis 12655 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Pteropus vampyrus 18031 26, 189, 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Rattus norvegicus 27251 26, 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Rhesus macaque 14762 26, 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Sorex araneus 2691 190, 295, 413, 520, 637, 850, 931, 1408, 1552
Spermophilus tridecemlineatus 12224 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Sus scrofa 1816 26, 190, 295, 413, 523, 634, 850, 931, 1408, 1552
Taeniopygia guttata 18583 1408, 1552
Taeniopygia guttata 18584 26, 190, 295, 413, 523, 634, 850, 882, 897, 1408, 1552
Tarsius syrichta 14513 26, 190, 295, 413, 523, 634, 789, 850, 931, 1408, 1552
Tetraodon nigroviridis 13017 26, 190, 295, 413, 523, 634, 839, 1336, 1408, 1552
Tupaia belangeri 13414 413, 523, 634, 850, 931, 1383, 1408, 1552
Tursiops truncatus 13365 26, 87, 190, 207, 249, 282, 295, 413, 523, 634, 850, 931, 1366, 1408, 1552
Vicugna pacos 7983 26, 91, 108, 117, 159, 190, 346, 470, 523, 634, 850, 931, 1408, 1552
Xenopus tropicalis 10143 26, 190, 295, 413, 523, 634, 850, 935, 955, 1369, 1552

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Anolis carolinensis 1880 ENSACAT00000017427 100557016 ENSACAG00000017353 hsdl2 anoCar1
Apis mellifera 33252 GB17223-PA apiMel3
Bombyx mori 3167 BGIBMGA007118-TA v2.0
Bos taurus 25682 ENSBTAT00000044340 404131 ENSBTAG00000031295 HSDL2 bosTau4
Branchiostoma floridae 44754 e_gw.26.57.1 braFlo1
Branchiostoma floridae 18400 fgenesh2_pg.scaffold_763000002 braFlo1
Branchiostoma floridae 5695 gw.763.14.1 braFlo1
Branchiostoma floridae 887 fgenesh2_pg.scaffold_349000019 braFlo1
Caenorhabditis elegans 6304 C17G10.8.2 3565470 C17G10.8 dhs-6 ce6
Caenorhabditis elegans 27393 C45B11.3.1, NM_073411 179529 WBGene00000981 dhs-18 ce6
Callithrix jacchus 47840 ENSCJAT00000061393 100387428 ENSCJAG00000017708 HSDL2 calJac3
Canis familiaris 3388 ENSCAFT00000004878 474804 ENSCAFG00000003028 HSDL2 canFam2
Canis familiaris 3941 ENSCAFT00000003325 ENSCAFG00000002101 canFam2
Cavia porcellus 24579 ENSCPOT00000003134 100717243 ENSCPOG00000003091 HSDL2 cavPor3
Choloepus hoffmanni 9491 ENSCHOT00000009494 ENSCHOG00000009469 HSDL2 choHof1
Culex quinquefasciatus 1738 CPIJ009733-RA 6042411 CPIJ009733 CpipJ1
Danio rerio 3367 ENSDART00000038888 322347 ENSDARG00000002523 hsdl2 danRer6
Daphnia pulex 15590 estExt_Genewise1Plus.C_1740027 1.1
Dasypus novemcinctus 5847 ENSDNOT00000008652 101443246 ENSDNOG00000008643 HSDL2 dasNov2
Dipodomys ordii 7317 ENSDORT00000007217 ENSDORG00000007217 Hsdl2 dipOrd1
Drosophila grimshawi 1865 FBtr0151911 6568078 FBgn0123968 GH16497 droGri2
Drosophila melanogaster 18121 FBtr0085215 43325 FBgn0039537 CG5590 dm3
Drosophila persimilis 788 FBtr0179321 6595189 FBgn0151311 GL13706 droPer1
Drosophila persimilis 11363 FBtr0185663 6602131 FBgn0157645 GL20048 droPer1
Drosophila yakuba 11269 FBtr0270270 6538239 FBgn0240909 GE23752 droYak2
Echinops telfairi 19011 ENSETET00000018468 ENSETEG00000018469 HSDL2 TENREC
Equus caballus 16351 ENSECAT00000026861 100057249 ENSECAG00000024878 HSDL2 equCab2
Erinaceus europaeus 11918 ENSEEUT00000010738 ENSEEUG00000010740 HSDL2 eriEur1
Felis catus 38736 ENSFCAT00000014370 101094216 ENSFCAG00000014366 HSDL2 felCat3
Fugu rubripes 35640 ENSTRUT00000016762 101073112 ENSTRUG00000006792 hsdl2 fr2
Gallus gallus 23172 ENSGALT00000025254 100858057 ENSGALG00000015663 HSDL2 galGal3
Gasterosteus aculeatus 20997 ENSGACT00000020408 ENSGACG00000015440 hsdl2 gasAcu1
Gorilla gorilla 2854 ENSGGOT00000030718 ENSGGOG00000006759 HSDL2 gorGor3
Homo sapiens 94689 ENST00000398805, NM_032303 84263 ENSG00000119471 HSDL2 hg19,GRCh37
Ixodes scapularis 15246 ISCW018577-RA ISCW018577 IscaW1
Linepithema humile 11144 LH14414-RA 1.2
Linepithema humile 7459 LH11786-RA 1.2
Loxodonta africana 22972 ENSLAFT00000017195 100665495 ENSLAFG00000017197 HSDL2 loxAfr3
Macropus eugenii 6041 ENSMEUT00000006045 ENSMEUG00000006026 HSDL2 Meug_1.0
Microcebus murinus 10528 ENSMICT00000009802 ENSMICG00000009807 HSDL2 micMur1
Monodelphis domestica 25651 ENSMODT00000006690 100017868 ENSMODG00000005316 HSDL2 monDom5
Mus musculus 29008 ENSMUST00000030078 72479 ENSMUSG00000028383 Hsdl2 mm9
Myotis lucifugus 17731 ENSMLUT00000017499 ENSMLUG00000017494 HSDL2 myoLuc1
Nasonia vitripennis 1384 NV14165-RA 1.2
Nematostella vectensis 2681 estExt_GenewiseH_1.C_570046 Nemve1
Nematostella vectensis 10656 fgenesh1_pg.scaffold_8686000001 Nemve1
Ochotona princeps 18056 ENSOPRT00000005928 ENSOPRG00000005926 HSDL2 OchPri2.0
Ornithorhynchus anatinus 25585 ENSOANT00000018277 ENSOANG00000011531 ornAna1
Ornithorhynchus anatinus 6257 ENSOANT00000023631 ENSOANG00000015009 ornAna1
Oryzias latipes 23688 ENSORLT00000024469 101173429 ENSORLG00000019682 hsdl2 oryLat2
Otolemur garnettii 2226 ENSOGAT00000002147 ENSOGAG00000002144 HSDL2 otoGar1
Pan troglodytes 37427 ENSPTRT00000067066, NM_032303 740849 ENSPTRG00000021264 HSDL2 panTro2
Pediculus humanus 4789 PHUM306060-RA 8239181 PHUM306060 PhumU1
Pogonomyrmex barbatus 12993 PB20478-RA 1.2
Pongo abelii 28018 ENSPPYT00000022752 100172722 ENSPPYG00000019505 HSDL2 ponAbe2
Procavia capensis 12655 ENSPCAT00000006006 ENSPCAG00000006031 HSDL2 proCap1
Pteropus vampyrus 18031 ENSPVAT00000002178 ENSPVAG00000002180 HSDL2 pteVam1
Rattus norvegicus 27251 ENSRNOT00000059458 313200 ENSRNOG00000016692 Hsdl2 rn4
Rhesus macaque 14762 ENSMMUT00000016328 707233 ENSMMUG00000011654 rheMac2
Sorex araneus 2691 ENSSART00000002627 ENSSARG00000002635 HSDL2 sorAra1
Spermophilus tridecemlineatus 12224 ENSSTOT00000012225 ENSSTOG00000012222 HSDL2 speTri1
Sus scrofa 1816 ENSSSCT00000006013 100155587 ENSSSCG00000005467 HSDL2 susScr2
Taeniopygia guttata 18583 ENSTGUT00000001302 ENSTGUG00000001253 taeGut1
Taeniopygia guttata 18584 ENSTGUT00000001310 100228470 ENSTGUG00000001254 HSDL2 taeGut1
Tarsius syrichta 14513 ENSTSYT00000001548 ENSTSYG00000001549 HSDL2 tarSyr1
Tetraodon nigroviridis 13017 ENSTNIT00000005496 ENSTNIG00000002789 hsdl2 tetNig2
Tupaia belangeri 13414 ENSTBET00000013415 ENSTBEG00000013420 HSDL2 tupBel1
Tursiops truncatus 13365 ENSTTRT00000009288 101329100 ENSTTRG00000009288 HSDL2 turTru1
Vicugna pacos 7983 ENSVPAT00000006422 ENSVPAG00000006422 HSDL2 vicPac1
Xenopus tropicalis 10143 ENSXETT00000004744 493329 ENSXETG00000002228 hsdl2 xenTro2

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Anolis carolinensis 16800 ENSACAP00000017090 100557016 ENSACAG00000017353 hsdl2 anoCar1
Apis mellifera 7221 GB17223 apiMel3
Bombyx mori 7118 BGIBMGA007118-PA v2.0
Bos taurus 735 ENSBTAP00000041845 404131 ENSBTAG00000031295 HSDL2 bosTau4
Branchiostoma floridae 2814 fgenesh2_pg.scaffold_349000019 braFlo1
Branchiostoma floridae 13045 fgenesh2_pg.scaffold_763000002 braFlo1
Branchiostoma floridae 13046 gw.763.14.1 braFlo1
Branchiostoma floridae 15752 e_gw.26.57.1 braFlo1
Caenorhabditis elegans 20961 C45B11.3.1 179529 WBGene00000981 dhs-18 ce6
Caenorhabditis elegans 8388 C17G10.8.2 3565470 C17G10.8 dhs-6 ce6
Callithrix jacchus 38976 ENSCJAP00000051420 100387428 ENSCJAG00000017708 HSDL2 calJac3
Canis familiaris 14565 ENSCAFP00000032293 canFam2
Canis familiaris 7225 ENSCAFP00000004523 474804 ENSCAFG00000003028 HSDL2 canFam2
Cavia porcellus 19478 ENSCPOP00000002798 100717243 ENSCPOG00000003091 HSDL2 cavPor3
Choloepus hoffmanni 8379 ENSCHOP00000008380 ENSCHOG00000009469 HSDL2 choHof1
Culex quinquefasciatus 7451 CPIJ009733 CpipJ1
Danio rerio 3257 ENSDARP00000038205 322347 ENSDARG00000002523 hsdl2 danRer6
Daphnia pulex 22008 JGI_V11_203975 1.1
Dasypus novemcinctus 5164 ENSDNOP00000006700 101443246 ENSDNOG00000008643 HSDL2 dasNov2
Dipodomys ordii 6879 ENSDORP00000006767 ENSDORG00000007217 Hsdl2 dipOrd1
Drosophila grimshawi 6367 FBpp0150403 6568078 FBgn0123968 GH16497 droGri2
Drosophila melanogaster 16670 FBpp0084585 43325 FBgn0039537 CG5590 dm3
Drosophila persimilis 9798 FBpp0184155 6602131 FBgn0157645 GL20048 droPer1
Drosophila persimilis 3614 FBpp0177813 6595189 FBgn0151311 GL13706 droPer1
Drosophila yakuba 13550 FBpp0268762 6538239 FBgn0240909 GE23752 droYak2
Echinops telfairi 14995 ENSETEP00000015013 ENSETEG00000018469 HSDL2 TENREC
Equus caballus 22343 ENSECAP00000022450 100057249 ENSECAG00000024878 HSDL2 equCab2
Erinaceus europaeus 9787 ENSEEUP00000009779 ENSEEUG00000010740 HSDL2 eriEur1
Felis catus 4350 ENSFCAP00000013328 101094216 ENSFCAG00000014366 HSDL2 felCat3
Fugu rubripes 16690 ENSTRUP00000016690 101073112 ENSTRUG00000006792 hsdl2 fr2
Gallus gallus 14566 ENSGALP00000025208 100858057 ENSGALG00000015663 HSDL2 galGal3
Gasterosteus aculeatus 19845 ENSGACP00000020369 ENSGACG00000015440 hsdl2 gasAcu1
Gorilla gorilla 2710 ENSGGOP00000023809 ENSGGOG00000006759 HSDL2 gorGor3
Homo sapiens 6552 ENSP00000381785 84263 ENSG00000119471 HSDL2 hg19,GRCh37
Ixodes scapularis 15247 ISCW018577-PA ISCW018577 IscaW1
Linepithema humile 9346 LH14414-PA 1.2
Linepithema humile 12420 LH11786-PA 1.2
Loxodonta africana 21316 ENSLAFP00000014420 100665495 ENSLAFG00000017197 HSDL2 loxAfr3
Macropus eugenii 5507 ENSMEUP00000005507 ENSMEUG00000006026 HSDL2 Meug_1.0
Microcebus murinus 8927 ENSMICP00000008924 ENSMICG00000009807 HSDL2 micMur1
Monodelphis domestica 5290 ENSMODP00000006554 100017868 ENSMODG00000005316 HSDL2 monDom5
Mus musculus 23728 ENSMUSP00000030078 72479 ENSMUSG00000028383 Hsdl2 mm9
Myotis lucifugus 15948 ENSMLUP00000015952 ENSMLUG00000017494 HSDL2 myoLuc1
Nasonia vitripennis 4101 NV14165-PA 1.2
Nematostella vectensis 15702 estExt_GenewiseH_1.C_570046 Nemve1
Nematostella vectensis 22544 fgenesh1_pg.scaffold_8686000001 Nemve1
Ochotona princeps 15730 ENSOPRP00000005444 ENSOPRG00000005926 HSDL2 OchPri2.0
Ornithorhynchus anatinus 25856 ENSOANP00000023627 ENSOANG00000015009 ornAna1
Ornithorhynchus anatinus 491 ENSOANP00000018274 ENSOANG00000011531 ornAna1
Oryzias latipes 23393 ENSORLP00000024468 101173429 ENSORLG00000019682 hsdl2 oryLat2
Otolemur garnettii 1917 ENSOGAP00000001918 ENSOGAG00000002144 HSDL2 otoGar1
Pan troglodytes 20060 ENSPTRP00000058647 740849 ENSPTRG00000021264 HSDL2 panTro2
Pediculus humanus 4694 PHUM306060-PA 8239181 PHUM306060 PhumU1
Pogonomyrmex barbatus 10478 PB20478-PA 1.2
Pongo abelii 793 ENSPPYP00000021855 100172722 ENSPPYG00000019505 HSDL2 ponAbe2
Procavia capensis 11839 ENSPCAP00000005608 ENSPCAG00000006031 HSDL2 proCap1
Pteropus vampyrus 17003 ENSPVAP00000002057 ENSPVAG00000002180 HSDL2 pteVam1
Rattus norvegicus 10635 ENSRNOP00000056213 313200 ENSRNOG00000016692 Hsdl2 rn4
Rhesus macaque 5843 ENSMMUP00000015299 707233 ENSMMUG00000011654 rheMac2
Sorex araneus 2385 ENSSARP00000002379 ENSSARG00000002635 HSDL2 sorAra1
Spermophilus tridecemlineatus 10957 ENSSTOP00000010959 ENSSTOG00000012222 HSDL2 speTri1
Sus scrofa 5855 ENSSSCP00000005864 100155587 ENSSSCG00000005467 HSDL2 susScr2
Taeniopygia guttata 2591 ENSTGUP00000001290 ENSTGUG00000001253 taeGut1
Taeniopygia guttata 2592 ENSTGUP00000001298 100228470 ENSTGUG00000001254 HSDL2 taeGut1
Tarsius syrichta 13305 ENSTSYP00000001442 ENSTSYG00000001549 HSDL2 tarSyr1
Tetraodon nigroviridis 2504 ENSTNIP00000005350 ENSTNIG00000002789 hsdl2 tetNig2
Tupaia belangeri 11627 ENSTBEP00000011618 ENSTBEG00000013420 HSDL2 tupBel1
Tursiops truncatus 12643 ENSTTRP00000008807 101329100 ENSTTRG00000009288 HSDL2 turTru1
Vicugna pacos 7415 ENSVPAP00000005959 ENSVPAG00000006422 HSDL2 vicPac1
Xenopus tropicalis 24094 ENSXETP00000004744 493329 ENSXETG00000002228 hsdl2 xenTro2

multiple sequence alignment in CLUSTALW format

Branchiostoma_floridae|887          ---------------------------------ATGGTAGCCTCCGCCCTTGTTCTTGGC
Nematostella_vectensis|10656        ------------------------ATGTACTACAAGGGCAAAACTATTTTTATTACAGGA
Branchiostoma_floridae|44754        ---------------ATGCGTTACAGAGAGCTAGCGGGCCGTACCATCTTCATCACGGGG
Linepithema_humile|11144            ------------------------------------------------------------
Linepithema_humile|7459             ------------------------------------------------------------
Microcebus_murinus|10528            ---------------------------AAGCTAGCAGGATGCACAGTTTTTATCACAGGT
Sorex_araneus|2691                  ---------------------------AGACTAGCAGGATGTACGATTTTTATCACAGGT
Ixodes_scapularis|15246             ---------------ACCCCTTGCAGGAAACTCGCTGGAAGGACGCTTTTTATCACGGGC
Taeniopygia_guttata|18583           ------------------------------------------------------------
Ornithorhynchus_anatinus|25585      ------------------------------------------------------------
Otolemur_garnettii|2226             ---------------------------AAGCTAGCAGGATGTACGGTGTTTATCACAGGT
Canis_familiaris|3941               ------------------------------------------------------------
Dasypus_novemcinctus|5847           ---------------------------AAGCTAGCAGGATGTACCATTTTTGTCACAGGT
Branchiostoma_floridae|5695         ------------------------------------------------------------
Procavia_capensis|12655             ---------------------------GAGCTTGCCGGATGTACACTTTTTATCACAGGT
Anolis_carolinensis|1880            ---------------------------AAATTGGCAGGATGCACCCTCTTTATCACGGGT
Macropus_eugenii|6041               ---------------------------AAATTAGCAGGATGTACTCTCTTTATCACGGGT
Spermophilus_tridecemlineatus|12224 ---------------------------AAGCTAGCAGGATGTACAGTTTTTATCACAGGT
Echinops_telfairi|19011             ---------------------------AAGCTAGCAGGATGTACGCTTTTTATCACAGGG
Erinaceus_europaeus|11918           ---------------------------AGGCTAGCTGGATGTACAGTTTTTATCACTGGT
Myotis_lucifugus|17731              ---------------------------AAGCTGGCAGGATGTACAGTTTTTATCACAGGT
Tupaia_belangeri|13414              ------------------------------------------------------------
Monodelphis_domestica|25651         ---------------------------AAACTAGCAGGTTGTACTCTCTTCATCACGGGT

Linepithema_humile|11144            ------------------------------------------------------------
Linepithema_humile|7459             ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Ornithorhynchus_anatinus|25585      ------------------------------------------------------------
Canis_familiaris|3941               ------------------------------------------------------------
Branchiostoma_floridae|5695         ------------------------------------------------------------
Tupaia_belangeri|13414              ------------------------------------------------------------

Linepithema_humile|11144            ------------------------------------------------------------
Linepithema_humile|7459             ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Ornithorhynchus_anatinus|25585      ------------------------------------------------------------
Canis_familiaris|3941               ------------------------------------------------------------
Branchiostoma_floridae|5695         ------------------------------------------------------------
Tupaia_belangeri|13414              ------------------------------------------------------------

Linepithema_humile|11144            ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Taeniopygia_guttata|18584           GCAGAAGAAATTGaagcagctggaggaaaggCTTTGCCATGCATTGTTAATGTGAGAGAA
Ornithorhynchus_anatinus|25585      ------------------------------------------------------------
Branchiostoma_floridae|5695         ------------------------------------------------------------
Tupaia_belangeri|13414              ------------------------------------------------------------

Linepithema_humile|11144            ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Ornithorhynchus_anatinus|25585      ------------------------------------------------------------
Branchiostoma_floridae|5695         ---------------TCAGCAGTAGAGCAGGCTGTGCAGAAGTTTGGA------GGGATC
Tupaia_belangeri|13414              ---------------------------------------------------------ATT

Linepithema_humile|11144            ------------------------------------------------------------
Vicugna_pacos|7983                  ---------------------------------------------GNNNNNNNNNNNNNN
Taeniopygia_guttata|18583           ------------------------------------------------------------
Fugu_rubripes|35640                 ------------------------------------------------------------
Ornithorhynchus_anatinus|25585      ------------------------------------------------------------
Canis_familiaris|3941               ------------------------------------------------------------

Linepithema_humile|11144            ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Fugu_rubripes|35640                 ------------------------------------------------------------
Ornithorhynchus_anatinus|25585      ------------------------------------------------------TCTAAA
Canis_familiaris|3941               ------------------------------------------------------------

Linepithema_humile|11144            ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Fugu_rubripes|35640                 ------------------------------------------------------------
Canis_familiaris|3941               ------------------------------------------------------------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Linepithema_humile|11144            ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Oryzias_latipes|23688               CCGCCTCTCAacctcaaccctgtctggttcaaGAACCACACAGCTTACACGATGGCTAAG
Fugu_rubripes|35640                 ------------------------------------------GCATACACAATGGCAAAA
Canis_familiaris|3941               ------------------------------------CACTGTGCTTATACCATTGCTAAG
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Linepithema_humile|11144            ------------------------------------------------------------
Sorex_araneus|2691                  NNNNNN---NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Linepithema_humile|11144            ---------------------------------------------------ATGGACATG
Linepithema_humile|7459             AACATTGCGGTTAATGCTGTTTGGCCAAAGACG---------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          AAG------------GGCGTGCCG------ACCGCGTACTTCAGGAAGGCTGACGTCTTT
Branchiostoma_floridae|18400        AGG---------------GGGCATGGC---CGGGACGGTTGTCGCTCCACTGACATCATG
Branchiostoma_floridae|44754        ATT---------------CTCAGTTTCCCGCGAGAGATGTGTCGTAAGGCGGACATCATG
Apis_mellifera|33252                TTA---------------GTTAATGAATCAAATGATTATGCTCGTAAACCAGAAATAATG
Linepithema_humile|7459             ------------------------------------------------------------
Bombyx_mori|3167                    TTG------------------ACCGGGGACACGTCAACAAGTCGCAAGCCTGAGATCGTT
Taeniopygia_guttata|18583           ------------------------------------------------------------
Taeniopygia_guttata|18584           ctg------------ggaggagctggaatAGAAAAACAGTGCAGGAAAACAGACATCCTG
Myotis_lucifugus|17731              CTG------------GGAGGATCCGGTATTGAAAGC---TGTAGA---GTTGACATCATT
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          GCCGACGCCTGTCTGGCTATTGGTCAGGAA---CCAACA---------------------
Linepithema_humile|7459             ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Taeniopygia_guttata|18584           GCAGATGCTGCATACTGCATtttgacaaaa---ccaaaaacttacACTGGGAACTTCATT
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ------------------GAAAGCAATGGCGTGGTAGCTATCTCACAATGTTCATGTCGG
Linepithema_humile|7459             ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Felis_catus|38736                   ATTGAT---AACATCTTA------GAGAGAAGAGTAAATTTTGACGTCTATGCA------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ---------AGAGGTGCGCTGGTTCCCGACTTT---------------------------
Nematostella_vectensis|10656        ------CCTGGAGGCCCTTTACAGAAAGATTTATTTTTAGAC------------------
Caenorhabditis_elegans|27393        ------CCAGGATCCTCACTTATTCCAGACTTTTTTGTCCCTGAA---------------
Branchiostoma_floridae|18400        ------CCAGAAAACAGGACACTCCTCGACTTT---------------------------
Branchiostoma_floridae|44754        ------CCAGGTAAGAAACTGTTTCCTCAAATCTTT------------------------
Drosophila_grimshawi|1865           CGGGAGAATGCCGACAAGCTGATGGTTGACTTTTTCGTTGAGTCC---------------
Drosophila_persimilis|11363         CCGGAGAATATACATAAGCTGGCTACGGATATATTTTTGGACGAT---------------
Linepithema_humile|11144            ------CCAGATGAGAAAACGAAA---------CATCTTGACAAA---------------
Linepithema_humile|7459             ------------------------------------------------------------
Pogonomyrmex_barbatus|12993         CCAGCAAATAAAGACAACTTAATGATAGACTTCTTTTTGGATGAG---------------
Gallus_gallus|23172                 ------CCAGGTCACCCCCTGATGCCTGACTTCTTCTTGGATGCT------------GAA
Taeniopygia_guttata|18583           ------------------------------------------------------------
Taeniopygia_guttata|18584           ------CCAGGTCACCCTCTGATGCCTGATTTCTTCTTAGAT---------AATTACGAG
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ------------------------------------------------------------
Nematostella_vectensis|10656        ------------------------------------------------------------
Caenorhabditis_elegans|27393        ------------------------------------------------------------
Branchiostoma_floridae|18400        ------------------------------------------------------------
Branchiostoma_floridae|44754        ------------------------------------------------------------
Drosophila_grimshawi|1865           ---------------------AAGGATGCGGAG---------GCTGTCAAGGAGAATACA
Drosophila_yakuba|11269             ---GAAACTGACGATGCGGCA---------------------GGATATACTGCTGCTGCG
Drosophila_persimilis|11363         ------------------------------------------------------------
Linepithema_humile|11144            ------------------ACTAGCAGCAAT------------------------------
Nasonia_vitripennis|1384            AGGATAGTCGGTGGCAATAAAGAA------------------------------------
Linepithema_humile|7459             ------------------------------------------------------------
Pogonomyrmex_barbatus|12993         ---GCAGTTGGCCGAGCT------------------------AAAATCTTTAATGAAACA
Pediculus_humanus|4789              ---AATTACGACCAAGCTCTTGTAGGCTCT------------GCAAAAAAACAAGAAGGT
Bombyx_mori|3167                    ------------------------------TCCGTTGAGCCGACCATAAAGGAATCCGAC
Taeniopygia_guttata|18583           ------------------------------------------------------------
Taeniopygia_guttata|18584           AAGAAAGTAAGCAgatcccagcaggaaggagcagatGCAGCCAAGGTTAAGACAGAATCT
Tetraodon_nigroviridis|13017        ---AGTCTGGTCCAAAAGATGGAGGAGCAC------------------------------
Daphnia_pulex|15590                 ---GACTTCTCCAAGAAA---------------TCGAGCCCCAAAATGTCTGCCGAAGCC
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ------------------------------------------------------------
Nematostella_vectensis|10656        ------------------------------------------------------------
Caenorhabditis_elegans|6304         ------------------------------------------------------------
Caenorhabditis_elegans|27393        ------------------------------------------------------------
Branchiostoma_floridae|18400        ------------------------------------------------------------
Branchiostoma_floridae|44754        ------------------------------------------------------------
Culex_quinquefasciatus|1738         ------------------------------------------------------------
Drosophila_grimshawi|1865           ------------------------------------------------------------
Drosophila_persimilis|788           ------------------------------------------------------------
Drosophila_melanogaster|18121       ------------------------------------------------------------
Drosophila_yakuba|11269             ------------------------------------------------------------
Apis_mellifera|33252                ------------------------------------------------------------
Drosophila_persimilis|11363         ------------------------------------------------------------
Linepithema_humile|11144            ------------------------------------------------------------
Nasonia_vitripennis|1384            ------------------------------------------------------------
Linepithema_humile|7459             ------------------------------------------------------------
Pogonomyrmex_barbatus|12993         ------------------------------------------------------------
Pediculus_humanus|4789              ------------------------------------------------------------
Microcebus_murinus|10528            ------------------------------------------------------------
Tarsius_syrichta|14513              ------------------------------------------------------------
Nematostella_vectensis|2681         ------------------------------------------------------------
Sorex_araneus|2691                  ------------------------------------------------------------
Vicugna_pacos|7983                  ------------------------------------------------------------
Ixodes_scapularis|15246             ------------------------------------------------------------
Bombyx_mori|3167                    ------------------------------------------------------------
Gallus_gallus|23172                 ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Taeniopygia_guttata|18584           ------------------------------------------------------------
Oryzias_latipes|23688               ------------------------------------------------------------
Gasterosteus_aculeatus|20997        ------------------------------------------------------------
Fugu_rubripes|35640                 ------------------------------------------------------------
Tetraodon_nigroviridis|13017        ------------------------------------------------------------
Daphnia_pulex|15590                 ------------------------------------------------------------
Ornithorhynchus_anatinus|25585      ------------------------------------------------------------
Ochotona_princeps|18056             ------------------------------------------------------------
Otolemur_garnettii|2226             ------------------------------------------------------------
Choloepus_hoffmanni|9491            ------------------------------------------------------------
Danio_rerio|3367                    ------------------------------------------------------------
Dipodomys_ordii|7317                ------------------------------------------------------------
Loxodonta_africana|22972            ------------------------------------------------------------
Cavia_porcellus|24579               ------------------------------------------------------------
Gorilla_gorilla|2854                ------------------------------------------------------------
Mus_musculus|29008                  CTGCAGCTGCAGGAGGAGTCACAGCTAcagaagcagccacagctgcaggagcagccacag
Rattus_norvegicus|27251             ctgcagttgcaggagcagccacagctgcaggagcagccacaactgcaggagaagccacag
Felis_catus|38736                   ------------------------------------------------------------
Callithrix_jacchus|47840            ------------------------------------------------------------
Rhesus_macaque|14762                ------------------------------------------------------------
Pongo_abelii|28018                  ------------------------------------------------------------
Homo_sapiens|94689                  ------------------------------------------------------------
Pan_troglodytes|37427               ------------------------------------------------------------
Pteropus_vampyrus|18031             ------------------------------------------------------------
Sus_scrofa|1816                     ------------------------------------------------------------
Bos_taurus|25682                    ------------------------------------------------------------
Tursiops_truncatus|13365            ------------------------------------------------------------
Equus_caballus|16351                ------------------------------------------------------------
Canis_familiaris|3941               ------------------------------------------------------------
Dasypus_novemcinctus|5847           ------------------------------------------------------------
Xenopus_tropicalis|10143            ------------------------------------------------------------
Branchiostoma_floridae|5695         ------------------------------------------------------------
Procavia_capensis|12655             ------------------------------------------------------------
Anolis_carolinensis|1880            ------------------------------------------------------------
Macropus_eugenii|6041               ------------------------------------------------------------
Spermophilus_tridecemlineatus|12224 ------------------------------------------------------------
Echinops_telfairi|19011             ------------------------------------------------------------
Erinaceus_europaeus|11918           ------------------------------------------------------------
Myotis_lucifugus|17731              ------------------------------------------------------------
Tupaia_belangeri|13414              ------------------------------------------------------------
Monodelphis_domestica|25651         ------------------------------------------------------------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ------------------------------------------------------------
Nematostella_vectensis|10656        ------------------------------------------------------------
Caenorhabditis_elegans|6304         ------------------------------------------------------------
Caenorhabditis_elegans|27393        ------------------------------------------------------------
Branchiostoma_floridae|18400        ------------------------------------------------------------
Branchiostoma_floridae|44754        ------------------------------------------------------------
Culex_quinquefasciatus|1738         ------------------------------------------------------------
Drosophila_grimshawi|1865           ------------------------------------------------------------
Drosophila_persimilis|788           ------------------------------------------------------------
Drosophila_melanogaster|18121       ------------------------------------------------------------
Drosophila_yakuba|11269             ------------------------------------------------------------
Apis_mellifera|33252                ------------------------------------------------------------
Drosophila_persimilis|11363         ------------------------------------------------------------
Linepithema_humile|11144            ------------------------------------------------------------
Nasonia_vitripennis|1384            ------------------------------------------------------------
Linepithema_humile|7459             ------------------------------------------------------------
Pogonomyrmex_barbatus|12993         ------------------------------------------------------------
Pediculus_humanus|4789              ------------------------------------------------------------
Microcebus_murinus|10528            ------------------------------------------------------------
Tarsius_syrichta|14513              ------------------------------------------------------------
Nematostella_vectensis|2681         ------------------------------------------------------------
Sorex_araneus|2691                  ------------------------------------------------------------
Vicugna_pacos|7983                  ------------------------------------------------------------
Ixodes_scapularis|15246             ------------------------------------------------------------
Bombyx_mori|3167                    ------------------------------------------------------------
Gallus_gallus|23172                 ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Taeniopygia_guttata|18584           ------------------------------------------------------------
Oryzias_latipes|23688               ------------------------------------------------------------
Gasterosteus_aculeatus|20997        ------------------------------------------------------------
Fugu_rubripes|35640                 ------------------------------------------------------------
Tetraodon_nigroviridis|13017        ------------------------------------------------------------
Daphnia_pulex|15590                 ------------------------------------------------------------
Ornithorhynchus_anatinus|25585      ------------------------------------------------------------
Ochotona_princeps|18056             ------------------------------------------------------------
Otolemur_garnettii|2226             ------------------------------------------------------------
Choloepus_hoffmanni|9491            ------------------------------------------------------------
Danio_rerio|3367                    ------------------------------------------------------------
Dipodomys_ordii|7317                ------------------------------------------------------------
Loxodonta_africana|22972            ------------------------------------------------------------
Cavia_porcellus|24579               ------------------------------------------------------------
Gorilla_gorilla|2854                ------------------------------------------------------------
Mus_musculus|29008                  ctgcaggagaagccacagctgcaggagaagccacagctgcaggagcagccacagctgcag
Rattus_norvegicus|27251             ctgcaggagcagccacagctgcaggagaagccacagctgcaggagcagccacagctgcag
Felis_catus|38736                   ------------------------------------------------------------
Callithrix_jacchus|47840            ------------------------------------------------------------
Rhesus_macaque|14762                ------------------------------------------------------------
Pongo_abelii|28018                  ------------------------------------------------------------
Homo_sapiens|94689                  ------------------------------------------------------------
Pan_troglodytes|37427               ------------------------------------------------------------
Pteropus_vampyrus|18031             ------------------------------------------------------------
Sus_scrofa|1816                     ------------------------------------------------------------
Bos_taurus|25682                    ------------------------------------------------------------
Tursiops_truncatus|13365            ------------------------------------------------------------
Equus_caballus|16351                ------------------------------------------------------------
Canis_familiaris|3941               ------------------------------------------------------------
Dasypus_novemcinctus|5847           ------------------------------------------------------------
Xenopus_tropicalis|10143            ------------------------------------------------------------
Branchiostoma_floridae|5695         ------------------------------------------------------------
Procavia_capensis|12655             ------------------------------------------------------------
Anolis_carolinensis|1880            ------------------------------------------------------------
Macropus_eugenii|6041               ------------------------------------------------------------
Spermophilus_tridecemlineatus|12224 ------------------------------------------------------------
Echinops_telfairi|19011             ------------------------------------------------------------
Erinaceus_europaeus|11918           ------------------------------------------------------------
Myotis_lucifugus|17731              ------------------------------------------------------------
Tupaia_belangeri|13414              ------------------------------------------------------------
Monodelphis_domestica|25651         ------------------------------------------------------------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ------------------------------------------------------------
Nematostella_vectensis|10656        ------------------------------------------------------------
Caenorhabditis_elegans|6304         ------------------------------------------------------------
Caenorhabditis_elegans|27393        ------------------------------------------------------------
Branchiostoma_floridae|18400        ------------------------------------------------------------
Branchiostoma_floridae|44754        ------------------------------------------------------------
Culex_quinquefasciatus|1738         ------------------------------------------------------------
Drosophila_grimshawi|1865           ------------------------------------------------------------
Drosophila_persimilis|788           ------------------------------------------------------------
Drosophila_melanogaster|18121       ------------------------------------------------------------
Drosophila_yakuba|11269             ------------------------------------------------------------
Apis_mellifera|33252                ------------------------------------------------------------
Drosophila_persimilis|11363         ------------------------------------------------------------
Linepithema_humile|11144            ------------------------------------------------------------
Nasonia_vitripennis|1384            ------------------------------------------------------------
Linepithema_humile|7459             ------------------------------------------------------------
Pogonomyrmex_barbatus|12993         ------------------------------------------------------------
Pediculus_humanus|4789              ------------------------------------------------------------
Microcebus_murinus|10528            ------------------------------------------------------------
Tarsius_syrichta|14513              ------------------------------------------------------------
Nematostella_vectensis|2681         ------------------------------------------------------------
Sorex_araneus|2691                  ------------------------------------------------------------
Vicugna_pacos|7983                  ------------------------------------------------------------
Ixodes_scapularis|15246             ------------------------------------------------------------
Bombyx_mori|3167                    ------------------------------------------------------------
Gallus_gallus|23172                 ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Taeniopygia_guttata|18584           ------------------------------------------------------------
Oryzias_latipes|23688               ------------------------------------------------------------
Gasterosteus_aculeatus|20997        ------------------------------------------------------------
Fugu_rubripes|35640                 ------------------------------------------------------------
Tetraodon_nigroviridis|13017        ------------------------------------------------------------
Daphnia_pulex|15590                 ------------------------------------------------------------
Ornithorhynchus_anatinus|25585      ------------------------------------------------------------
Ochotona_princeps|18056             ------------------------------------------------------------
Otolemur_garnettii|2226             ------------------------------------------------------------
Choloepus_hoffmanni|9491            ------------------------------------------------------------
Danio_rerio|3367                    ------------------------------------------------------------
Dipodomys_ordii|7317                ------------------------------------------------------------
Loxodonta_africana|22972            ------------------------------------------------------------
Cavia_porcellus|24579               ------------------------------------------------------------
Gorilla_gorilla|2854                ------------------------------------------------------------
Mus_musculus|29008                  gagaagccacagctgcaggagcagccacagcaa------------cgggaacagccacag
Rattus_norvegicus|27251             gagcagccacagctgcaggagcagccacagcagcagccacagctgcaggagcagccacag
Felis_catus|38736                   ------------------------------------------------------------
Callithrix_jacchus|47840            ------------------------------------------------------------
Rhesus_macaque|14762                ------------------------------------------------------------
Pongo_abelii|28018                  ------------------------------------------------------------
Homo_sapiens|94689                  ------------------------------------------------------------
Pan_troglodytes|37427               ------------------------------------------------------------
Pteropus_vampyrus|18031             ------------------------------------------------------------
Sus_scrofa|1816                     ------------------------------------------------------------
Bos_taurus|25682                    ------------------------------------------------------------
Tursiops_truncatus|13365            ------------------------------------------------------------
Equus_caballus|16351                ------------------------------------------------------------
Canis_familiaris|3941               ------------------------------------------------------------
Dasypus_novemcinctus|5847           ------------------------------------------------------------
Xenopus_tropicalis|10143            ------------------------------------------------------------
Branchiostoma_floridae|5695         ------------------------------------------------------------
Procavia_capensis|12655             ------------------------------------------------------------
Anolis_carolinensis|1880            ------------------------------------------------------------
Macropus_eugenii|6041               ------------------------------------------------------------
Spermophilus_tridecemlineatus|12224 ------------------------------------------------------------
Echinops_telfairi|19011             ------------------------------------------------------------
Erinaceus_europaeus|11918           ------------------------------------------------------------
Myotis_lucifugus|17731              ------------------------------------------------------------
Tupaia_belangeri|13414              ------------------------------------------------------------
Monodelphis_domestica|25651         ------------------------------------------------------------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ------------------------------------------------------------
Nematostella_vectensis|10656        ------------------------------------------------------------
Caenorhabditis_elegans|6304         ------------------------------------------------------------
Caenorhabditis_elegans|27393        ------------------------------------------------------------
Branchiostoma_floridae|18400        ------------------------------------------------------------
Branchiostoma_floridae|44754        ------------------------------------------------------------
Culex_quinquefasciatus|1738         ------------------------------------------------------------
Drosophila_grimshawi|1865           ------------------------------------------------------------
Drosophila_persimilis|788           ------------------------------------------------------------
Drosophila_melanogaster|18121       ------------------------------------------------------------
Drosophila_yakuba|11269             ------------------------------------------------------------
Apis_mellifera|33252                ------------------------------------------------------------
Drosophila_persimilis|11363         ------------------------------------------------------------
Linepithema_humile|11144            ------------------------------------------------------------
Nasonia_vitripennis|1384            ------------------------------------------------------------
Linepithema_humile|7459             ------------------------------------------------------------
Pogonomyrmex_barbatus|12993         ------------------------------------------------------------
Pediculus_humanus|4789              ------------------------------------------------------------
Microcebus_murinus|10528            ------------------------------------------------------------
Tarsius_syrichta|14513              ------------------------------------------------------------
Nematostella_vectensis|2681         ------------------------------------------------------------
Sorex_araneus|2691                  ------------------------------------------------------------
Vicugna_pacos|7983                  ------------------------------------------------------------
Ixodes_scapularis|15246             ------------------------------------------------------------
Bombyx_mori|3167                    ------------------------------------------------------------
Gallus_gallus|23172                 ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Taeniopygia_guttata|18584           ------------------------------------------------------------
Oryzias_latipes|23688               ------------------------------------------------------------
Gasterosteus_aculeatus|20997        ------------------------------------------------------------
Fugu_rubripes|35640                 ------------------------------------------------------------
Tetraodon_nigroviridis|13017        ------------------------------------------------------------
Daphnia_pulex|15590                 ------------------------------------------------------------
Ornithorhynchus_anatinus|25585      ------------------------------------------------------------
Ochotona_princeps|18056             ------------------------------------------------------------
Otolemur_garnettii|2226             ------------------------------------------------------------
Choloepus_hoffmanni|9491            ------------------------------------------------------------
Danio_rerio|3367                    ------------------------------------------------------------
Dipodomys_ordii|7317                ------------------------------------------------------------
Loxodonta_africana|22972            ------------------------------------------------------------
Cavia_porcellus|24579               ------------------------------------------------------------
Gorilla_gorilla|2854                ------------------------------------------------------------
Mus_musculus|29008                  ctg---------------------------------------------------------
Rattus_norvegicus|27251             ctgcaggagaagccacagctgcaggagcagccacagcagcaggagaagccacagccacag
Felis_catus|38736                   ------------------------------------------------------------
Callithrix_jacchus|47840            ------------------------------------------------------------
Rhesus_macaque|14762                ------------------------------------------------------------
Pongo_abelii|28018                  ------------------------------------------------------------
Homo_sapiens|94689                  ------------------------------------------------------------
Pan_troglodytes|37427               ------------------------------------------------------------
Pteropus_vampyrus|18031             ------------------------------------------------------------
Sus_scrofa|1816                     ------------------------------------------------------------
Bos_taurus|25682                    ------------------------------------------------------------
Tursiops_truncatus|13365            ------------------------------------------------------------
Equus_caballus|16351                ------------------------------------------------------------
Canis_familiaris|3941               ------------------------------------------------------------
Dasypus_novemcinctus|5847           ------------------------------------------------------------
Xenopus_tropicalis|10143            ------------------------------------------------------------
Branchiostoma_floridae|5695         ------------------------------------------------------------
Procavia_capensis|12655             ------------------------------------------------------------
Anolis_carolinensis|1880            ------------------------------------------------------------
Macropus_eugenii|6041               ------------------------------------------------------------
Spermophilus_tridecemlineatus|12224 ------------------------------------------------------------
Echinops_telfairi|19011             ------------------------------------------------------------
Erinaceus_europaeus|11918           ------------------------------------------------------------
Myotis_lucifugus|17731              ------------------------------------------------------------
Tupaia_belangeri|13414              ------------------------------------------------------------
Monodelphis_domestica|25651         ------------------------------------------------------------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ------------------------------------------------------------
Nematostella_vectensis|10656        ------------------------------------------------------------
Caenorhabditis_elegans|6304         ------------------------------------------------------------
Caenorhabditis_elegans|27393        ------------------------------------------------------------
Branchiostoma_floridae|18400        ------------------------------------------------------------
Branchiostoma_floridae|44754        ------------------------------------------------------------
Culex_quinquefasciatus|1738         ------------------------------------------------------------
Drosophila_grimshawi|1865           ------------------------------------------------------------
Drosophila_persimilis|788           ------------------------------------------------------------
Drosophila_melanogaster|18121       ------------------------------------------------------------
Drosophila_yakuba|11269             ------------------------------------------------------------
Apis_mellifera|33252                ------------------------------------------------------------
Drosophila_persimilis|11363         ------------------------------------------------------------
Linepithema_humile|11144            ------------------------------------------------------------
Nasonia_vitripennis|1384            ------------------------------------------------------------
Linepithema_humile|7459             ------------------------------------------------------------
Pogonomyrmex_barbatus|12993         ------------------------------------------------------------
Pediculus_humanus|4789              ------------------------------------------------------------
Microcebus_murinus|10528            ------------------------------------------------------------
Tarsius_syrichta|14513              ------------------------------------------------------------
Nematostella_vectensis|2681         ------------------------------------------------------------
Sorex_araneus|2691                  ------------------------------------------------------------
Vicugna_pacos|7983                  ------------------------------------------------------------
Ixodes_scapularis|15246             ------------------------------------------------------------
Bombyx_mori|3167                    ------------------------------------------------------------
Gallus_gallus|23172                 ------------------------------------------------------------
Taeniopygia_guttata|18583           ------------------------------------------------------------
Taeniopygia_guttata|18584           ------------------------------------------------------------
Oryzias_latipes|23688               ------------------------------------------------------------
Gasterosteus_aculeatus|20997        ------------------------------------------------------------
Fugu_rubripes|35640                 ------------------------------------------------------------
Tetraodon_nigroviridis|13017        ------------------------------------------------------------
Daphnia_pulex|15590                 ------------------------------------------------------------
Ornithorhynchus_anatinus|25585      ------------------------------------------------------------
Ochotona_princeps|18056             ------------------------------------------------------------
Otolemur_garnettii|2226             ------------------------------------------------------------
Choloepus_hoffmanni|9491            ------------------------------------------------------------
Danio_rerio|3367                    ------------------------------------------------------------
Dipodomys_ordii|7317                ------------------------------------------------------------
Loxodonta_africana|22972            ------------------------------------------------------------
Cavia_porcellus|24579               ------------------------------------------------------------
Gorilla_gorilla|2854                ------------------------------------------------------------
Mus_musculus|29008                  ---------------------------------cagcagcagcCACGGCCACGGCAACAG
Rattus_norvegicus|27251             cagcagccacagcagcagccacagcagcggccacagcagcggccacagccacagccacag
Felis_catus|38736                   ------------------------------------------------------------
Callithrix_jacchus|47840            ------------------------------------------------------------
Rhesus_macaque|14762                ------------------------------------------------------------
Pongo_abelii|28018                  ------------------------------------------------------------
Homo_sapiens|94689                  ------------------------------------------------------------
Pan_troglodytes|37427               ------------------------------------------------------------
Pteropus_vampyrus|18031             ------------------------------------------------------------
Sus_scrofa|1816                     ------------------------------------------------------------
Bos_taurus|25682                    ------------------------------------------------------------
Tursiops_truncatus|13365            ------------------------------------------------------------
Equus_caballus|16351                ------------------------------------------------------------
Canis_familiaris|3941               ------------------------------------------------------------
Dasypus_novemcinctus|5847           ------------------------------------------------------------
Xenopus_tropicalis|10143            ------------------------------------------------------------
Branchiostoma_floridae|5695         ------------------------------------------------------------
Procavia_capensis|12655             ------------------------------------------------------------
Anolis_carolinensis|1880            ------------------------------------------------------------
Macropus_eugenii|6041               ------------------------------------------------------------
Spermophilus_tridecemlineatus|12224 ------------------------------------------------------------
Echinops_telfairi|19011             ------------------------------------------------------------
Erinaceus_europaeus|11918           ------------------------------------------------------------
Myotis_lucifugus|17731              ------------------------------------------------------------
Tupaia_belangeri|13414              ------------------------------------------------------------
Monodelphis_domestica|25651         ------------------------------------------------------------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ------------------------------------------------------------
Nematostella_vectensis|10656        ------------------------------------------------------------
Caenorhabditis_elegans|6304         ------------------------------------------------GTTGAAGAAGAG
Caenorhabditis_elegans|27393        ------------------------------------------------------------
Branchiostoma_floridae|18400        ------------------------------------------------CAAGGGGGCGCT
Branchiostoma_floridae|44754        ------------------------------------------------------------
Culex_quinquefasciatus|1738         ------------------------------------------------GCCAGCGGCAAA
Drosophila_grimshawi|1865           ---------------------------GCGCCAGCGCCTGCA------GGAGACGACAAA
Drosophila_persimilis|788           ------------------------------------------------GATAGCGGCAAA
Drosophila_melanogaster|18121       ---------------------------------------------------------AAG
Drosophila_yakuba|11269             ---------------------------CCGGCGAGTGGA---------GGAGACGCCAAG
Apis_mellifera|33252                ---------------------------------------------------AATGAAAAA
Drosophila_persimilis|11363         ---------------------------------------------------ACAGGACCT
Linepithema_humile|11144            ------------------------------------------------GAAACTGGACAG
Nasonia_vitripennis|1384            ---------------------------CCAGCAAAAGTT---------GAAAGTGGAAAA
Linepithema_humile|7459             ------------------------------------------------------------
Pogonomyrmex_barbatus|12993         AATAATCCT---------------------------------------ACTGAAACACAA
Pediculus_humanus|4789              ---------------------------TCAGCTTCAGGTAGTGTAAATTACGAAGAAAAA
Microcebus_murinus|10528            ---------------------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Tarsius_syrichta|14513              ---------------------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Nematostella_vectensis|2681         ------------------------------------------------TCTGGTGGTAAT
Sorex_araneus|2691                  GCGAAGCCA------------------GCGTCCAAGCCG---------GGATCTGGAGCT
Vicugna_pacos|7983                  CTGCAGCCA------------------CCACCAAAACCA---------CGTTCTGGAGCT
Ixodes_scapularis|15246             CCGGCACCG------------------GAGGCAACGGGTGGCGGC---AGCGGGAATGCC
Bombyx_mori|3167                    ------------------------------------------------ACCGCAGGCGAA
Gallus_gallus|23172                 ---------------------------GAATCTGCTCCA------------GCTGGGCCT
Taeniopygia_guttata|18583           ------------------------------------------------------GGGCCT
Taeniopygia_guttata|18584           ---------------------------GCTGTAGCCATG---------CCAGCGGGGCCT
Oryzias_latipes|23688               TTGTcgaca------------------gccccgcccccc---------tccgATGGACCA
Gasterosteus_aculeatus|20997        ---------------------------------------------TCCTCCGGCGGACCA
Fugu_rubripes|35640                 TCATCTTCT------------------GCCCCTCCTTCC---------GCCGGTGGACCA
Tetraodon_nigroviridis|13017        ------------------------------------------------------GGTGAA
Daphnia_pulex|15590                 ACACAAGAT------------------GTTCCAGCAGGA---------GGTGCCGGTCAA
Ornithorhynchus_anatinus|25585      CAAGAGCAA------------------GTAACTACCCCT------------TCTGGAGCC
Ochotona_princeps|18056             ACACGGGCC------------CAACTGAAACCACAA------------CGTTCTGGAGCT
Otolemur_garnettii|2226             CCGCAGCCA------------CAGCTGCAACCAAAAGCA---------CATGCTGGAGCT
Choloepus_hoffmanni|9491            CAGCAGCCA------------------CAACGAAAATCA---------AGTTCTGGAGCT
Danio_rerio|3367                    ---------------------------GCAGATCCCGTT---------GCCGCAGGACCA
Dipodomys_ordii|7317                ACGCAGCCA------------------CCACCAAAAATG---------CATACTGGAGCT
Loxodonta_africana|22972            CAGGCACCA------------------CAACCAAAAGCA---------GCTTCTGGATCT
Cavia_porcellus|24579               TCACAGCCA------------------CAAGCAAAGCCA---------CATTCTGGAGCT
Gorilla_gorilla|2854                CTGCAGCTG------------------CAACCAAAACCA---------CGTTCTGGAGCT
Rattus_norvegicus|27251             ccacagccacTGCTGCAGTCAGTGCTACCACCAAAACCA---------CACTTTGGAGCT
Felis_catus|38736                   CCACAGCCA------------------CCACCAAAACCA---------CGTTCTGGAGCT
Callithrix_jacchus|47840            CCACAGCCA------------------CAACCAAAACCA---------CATTTGGGAGCT
Rhesus_macaque|14762                CCGCAGCCG------------------CAACCAAAACCA---------CGTTCTGGAGCT
Pongo_abelii|28018                  CCGCAGCCG------------------CAACCAAAACCA---------CGTTCTGGAGCT
Homo_sapiens|94689                  CTGCAGCTG------------------CAACCAAAACCA---------CGTTCTGGAGCT
Pan_troglodytes|37427               CTGCAGCTG------------------CAACCAAAACCA---------CGTTCTGGAGCT
Pteropus_vampyrus|18031             CCGCAGTCA------------------CCAGCAGAACAA---------CGTTCTGGAGCC
Sus_scrofa|1816                     TTGCCGCCA------------------CCGCCAAAACCA---------TGTTCTGGAGCT
Bos_taurus|25682                    ACGCAGCCA------------------CCACCAAAAGCA---------CGTTCTGGAGCT
Tursiops_truncatus|13365            GCGCAGCCA------------------CCACCAAAACCA---------CGTTCTGGAGCT
Equus_caballus|16351                TCACAGCCG------------------CCACCAAAACCA---------CGATCTGGAGCT
Canis_familiaris|3941               CCACAGCCA------------------CCACCAAAACAA---------CGTTCTGGAGCT
Canis_familiaris|3388               CCACAGCCA------------------CCACCAAAACAA---------CGTTCTGGAGCT
Dasypus_novemcinctus|5847           CAACANNNN------------------NNNNNNNNNNNN---------NNNNNNNNNNNN
Xenopus_tropicalis|10143            TTGACTTTA------------------CCCTTTAAT------------GGCATGTCTTTT
Branchiostoma_floridae|5695         ---------------------------------------------------GCGGGAGGG
Procavia_capensis|12655             CAGGCACCA------------------CGACCCAAA------------GCAGGTTCTCCT
Anolis_carolinensis|1880            AAACAAGAT------------------GTAATGAAGCACGAAGTAAACGCAACCGGGCCT
Macropus_eugenii|6041               NNNNNNNNN------------------NNNNNNNNNNNN---------NNNNNNNNNNNN
Spermophilus_tridecemlineatus|12224 CCACAGCCA------------------CAGTCAAAAGCA---------CATTTTGGAGCT
Echinops_telfairi|19011             CAGGACACC------------------AAATCCAGGCAA---------CGCTCGGGACCC
Erinaceus_europaeus|11918           CCAAAATCA------------------CCACCAAAACCA---------CGCTCTGGAGCT
Myotis_lucifugus|17731              ---CAGCCA------------------CCATCAAAACCA---------CCTTCTGGAGCT
Tupaia_belangeri|13414              CCACAGTCA------------------CAGTCAAAGCCA---------CGTTCCGGCGCT
Monodelphis_domestica|25651         TATCTACAA------------------CAACCACGACTA---------GCTGCTGGAGCA
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ------------------------------------------------------------
Nematostella_vectensis|10656        ------------------------------------------------------------
Caenorhabditis_elegans|27393        ------------------------------------------------------------
Branchiostoma_floridae|18400        ---------------------------------------------------CCTCTTGGA
Branchiostoma_floridae|44754        ------------------------------------------------------------
Drosophila_persimilis|11363         TTT---------------------------------------------------------
Linepithema_humile|7459             ------------------------------------------------------------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ------------------------------------------------------------
Nematostella_vectensis|10656        ------------------------------------------------------------
Caenorhabditis_elegans|27393        ------------------------------------------------------------
Branchiostoma_floridae|44754        ---TGCATGTACATTCTTTTCTTAAAG---------------------------------
Drosophila_persimilis|11363         ------------------------------------------------------------
Linepithema_humile|7459             ------------------------------------------------------------
Ixodes_scapularis|15246             GGCGGACTCTTCCTCTTCCAGGTCAAAGGC---------------GGGGAGAATTTTTTC
Xenopus_tropicalis|10143            ATGAATTTGTATTTA------------GGT---------GAAGAAAGCGGCAACTGGTTC
Branchiostoma_floridae|5695         AAGGGAGTCTTCCAGTTCAACCTCACAGGT------------------------------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ------------------------------------------------------------
Nematostella_vectensis|10656        ------------------------------------------------------------
Caenorhabditis_elegans|27393        ------------------------------------------------------------
Branchiostoma_floridae|18400        ------------------------TCATCGGGCATAGGGGACGTCCCTCCA---------
Branchiostoma_floridae|44754        ------------------------------------------------------------
Drosophila_persimilis|11363         ------------------------------------------------------------
Linepithema_humile|7459             ------------------GATGGCTCA---------------------------------
Branchiostoma_floridae|5695         ------------------------------------------------------------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ------------------------------------------------------------
Nematostella_vectensis|10656        ------------------------------------------------------------
Caenorhabditis_elegans|27393        ---------------------------AAGTCATTTGCACCAAGATTTGGATCA------
Branchiostoma_floridae|18400        ------------------------------------------------------------
Branchiostoma_floridae|44754        ------------------------------------------------------------
Drosophila_persimilis|11363         ------------------------------------------------------------
Linepithema_humile|7459             ------------------------------------------------------------
Oryzias_latipes|23688               GCGGACGTTGTCATGAAGATGGATTCTGGGGActtcaataaaatgtttgcaggTGAGCGC
Branchiostoma_floridae|5695         ------------------------------------------------------------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ------------------------------------------------------------
Nematostella_vectensis|10656        ------------------------------------------------------------
Caenorhabditis_elegans|27393        ------------------------------------------------------------
Branchiostoma_floridae|18400        ACACCCCCGCCGGCCCGTGGAATCGGCCGC------------------------------
Branchiostoma_floridae|44754        ------------------------------------------------------------
Drosophila_persimilis|11363         ------------------------------------------------------------
Linepithema_humile|11144            ------------------------------------------------------------
Linepithema_humile|7459             ------------------------------------------------------------
Oryzias_latipes|23688               AGGTCTGATGCTGCAGCCATGGCA------------------------------------
Otolemur_garnettii|2226             ------------------------------------------------------------
Branchiostoma_floridae|5695         ------------------------------------------------------------
Anolis_carolinensis|1880            AAGCCAACGatggctttcatgtccggaaagCTGACAATCAAGGGTGACATGGCCTTAGCA
Myotis_lucifugus|17731              ------------------------------------------------------------
Ornithorhynchus_anatinus|6257       ------------------------------------------------------------

Branchiostoma_floridae|887          ---------------------------------------------TAA
Nematostella_vectensis|10656        ---------------------------------------------TAA
Caenorhabditis_elegans|27393        ------------------------------------TCAAAATTATAA
Branchiostoma_floridae|18400        ---------------------------------------------TAA
Branchiostoma_floridae|44754        ------------------------------------TATAATTTGTAG
Drosophila_persimilis|11363         ------------------------------------GCTAAATTGTAA
Linepithema_humile|11144            ------------------------------------------------
Linepithema_humile|7459             ---AAAATACGCAAGCTCGATTCG---------------------TAG
Taeniopygia_guttata|18583           TTGAGTCTGGAAAAGATGCTG---------------------------
Oryzias_latipes|23688               ------------------------------------------------
Ochotona_princeps|18056             ATCAAATTGGAGAAACTAATGAACCAGATGAAT---AGA---------
Otolemur_garnettii|2226             ------------------------------------------------
Rattus_norvegicus|27251             ATCAAATTGGAGAAGCTAATGACC------------------------
Branchiostoma_floridae|5695         ------------------------------------------------
Myotis_lucifugus|17731              ------------------------------------------------
Ornithorhynchus_anatinus|6257       ---------------------------------------------TAA

multiple sequence alignment in CLUSTALW format

Linepithema_humile|9346             ------------------------------------------------------------
Linepithema_humile|12420            ------------------------------------------------------------
Taeniopygia_guttata|2591            ------------------------------------------------------------
Ornithorhynchus_anatinus|491        ------------------------------------------------------------
Canis_familiaris|14565              ------------------------------------------------------------
Branchiostoma_floridae|13046        ------------------------------------------------------------
Tupaia_belangeri|11627              ------------------------------------------------------------

Linepithema_humile|9346             ------------------------------------------------------------
Vicugna_pacos|7415                  AEEIKAAGGKALPCVVDVRDEQQINNAVEKAVEKFG-------------------XXXXX
Taeniopygia_guttata|2591            ------------------------------------------------------------
Fugu_rubripes|16690                 AQEVEAAGGKALACVVDIRDEQQIGEAVEKAVSKFG------------------------
Ornithorhynchus_anatinus|491        ------------------------------------------------------------
Canis_familiaris|14565              ---VEAAGGKALPCSVDVRDEQQISNAVEKAVERFG------------------------
Branchiostoma_floridae|13046        -------------------------SAVEQAVQKFG--GIDVLVNNASAISLTGTLETPM
Tupaia_belangeri|11627              ---------------------------------------IDILVNNASAISLTNTLETPT

Linepithema_humile|9346             ------------------------------------------------------------
Taeniopygia_guttata|2591            ------------------------------------------------------------
Fugu_rubripes|16690                 ------------------------------------------------------AYTMAK
Ornithorhynchus_anatinus|491        ------------------SK-ACIPYLKKS-KIAHILNLSPPLNLNPVWFKQHCAYTIAK
Canis_familiaris|14565              ----------------------------------------------------HCAYTIAK
Ornithorhynchus_anatinus|25856      KRVDL-MLSVNTRGTYLT------------------------------------------

Linepithema_humile|9346             -------------------------------------MDML----SGSESSNFCRKPEIM
Linepithema_humile|12420            YG-MSMCVLGMAEELK--LDNIAVNAVWPKT-----------------------------
Taeniopygia_guttata|2591            ------------------------------------------------------------
Ornithorhynchus_anatinus|25856      ------------------------------------------------------------

Branchiostoma_floridae|2814         ADACLAIGQE-PT-------------ESNGVVAISQCSCR---RGALVPDF---------
Linepithema_humile|12420            ------------------------------------------------------------
Taeniopygia_guttata|2591            ------------------------------------------------------------
Ornithorhynchus_anatinus|25856      ------------------------------------------------------------

Branchiostoma_floridae|2814         ------------------------------------------------------------
Nematostella_vectensis|22544        ------------------------------------------------------------
Caenorhabditis_elegans|8388         -KFSSGAQIGKKNKTHEAGV----------------------------------------
Caenorhabditis_elegans|20961        ------------------------------------------------------------
Branchiostoma_floridae|13045        ------------------------------------------------------------
Branchiostoma_floridae|15752        ------------------------------------------------------------
Culex_quinquefasciatus|7451         -QLVEFAAEGSHAASLKKPA----------------------------------------
Drosophila_grimshawi|6367           -------KDAE---AVKENT----------------------------------------
Drosophila_persimilis|3614          GATTETLAATAGASTPTAGS----------------------------------------
Drosophila_melanogaster|16670       PVENEAAAEDAAAPASGGDV----------------------------------------
Drosophila_yakuba|13550             -ETDDAA-------GYTAAA----------------------------------------
Apis_mellifera|7221                 KINVLNKIFQKDINDVNNKS----------------------------------------
Drosophila_persimilis|9798          ------------------------------------------------------------
Linepithema_humile|9346             ------TSSN--------------------------------------------------
Nasonia_vitripennis|4101            RIVGGNKE----------------------------------------------------
Linepithema_humile|12420            ------------------------------------------------------------
Pogonomyrmex_barbatus|10478         -AVGRA--------KIFNET----------------------------------------
Pediculus_humanus|4694              -NYDQALVGS----AKKQEG----------------------------------------
Microcebus_murinus|8927             -PITKKMESQXXXXXXXXXX----------------------------------------
Tarsius_syrichta|13305              -IITKKVEALXXXXXXXXXX----------------------------------------
Nematostella_vectensis|15702        -KLMRDHIKATSGSGSSGAA----------------------------------------
Sorex_araneus|2385                  -TISKKMESRGAAPEPKEEK----------------------------------------
Vicugna_pacos|7415                  --TTKKMESHGAIPELKEET----------------------------------------
Ixodes_scapularis|15247             KEFDQQPGS-GSSPSLSAAA----------------------------------------
Bombyx_mori|7118                    ----------SVEPTIKESD----------------------------------------
Gallus_gallus|14566                 TDMTESHGASQASDGAKANK----------------------------------------
Taeniopygia_guttata|2591            ------------------------------------------------------------
Taeniopygia_guttata|2592            KKVSRSQQEGADAAKVKTES----------------------------------------
Oryzias_latipes|23393               -VLVQQMEQHGATPAFKPPP----------------------------------------
Gasterosteus_aculeatus|19845        -SLVEQMEQHGKYTNASAEP----------------------------------------
Fugu_rubripes|16690                 -DLVEKMEEHGATPAFKPPS----------------------------------------
Tetraodon_nigroviridis|2504         -SLVQKMEEH--------------------------------------------------
Daphnia_pulex|22008                 -DFSKK-----SSPKMSAEA----------------------------------------
Ornithorhynchus_anatinus|491        -ELALKMEAQGATPAFAEVT----------------------------------------
Ochotona_princeps|15730             -XXXXXXXXXXAVPEVKEEK----------------------------------------
Otolemur_garnettii|1917             -XXXXXXXXXXGIPEVKEEK----------------------------------------
Choloepus_hoffmanni|8379            -XXXXXXXXXXDVPAFKEEK----------------------------------------
Danio_rerio|3257                    -DLVKHMEAHGATPAFTTAK----------------------------------------
Dipodomys_ordii|6879                -VVTKTKESHDAVPELKEEK----------------------------------------
Loxodonta_africana|21316            -AVNKEMGTPDAAPAFKEGK----------------------------------------
Cavia_porcellus|19478               -AEMKKRESQGAIPESKEEK----------------------------------------
Gorilla_gorilla|2710                -AVSKKVESTGAVPEFKEEK----------------------------------------
Felis_catus|4350                    -TIIKKVESRGAVPELKEEK----------------------------------------
Callithrix_jacchus|38976            -PITKKMESTGAVPEFKEEK----------------------------------------
Rhesus_macaque|5843                 -AVSKKMESTGAVPEFKEEK----------------------------------------
Pongo_abelii|793                    -AVSKKMESTGAVPEFKEEK----------------------------------------
Homo_sapiens|6552                   -AVSKKVESTGAVPEFKEEK----------------------------------------
Pan_troglodytes|20060               -AVSKKVESTGAVPEFKEEK----------------------------------------
Pteropus_vampyrus|17003             -LVTKKTESHGAVPELKGEK----------------------------------------
Sus_scrofa|5855                     -TVIKKMESHGADPELKKEK----------------------------------------
Bos_taurus|735                      -MVTKKADSYGAVPELKEEK----------------------------------------
Tursiops_truncatus|12643            -TVTKEPATHGALPELKEKE----------------------------------------
Equus_caballus|22343                -TITKKMESRGPPPELREEK----------------------------------------
Canis_familiaris|14565              -IIIKKAESRDVIPELKEEK----------------------------------------
Dasypus_novemcinctus|5164           -TIAKKMESHSAI-AFKEEK----------------------------------------
Xenopus_tropicalis|24094            -ALASAMEEHGRQRVIHRAK----------------------------------------
Branchiostoma_floridae|13046        -ELNKGLPQATAAGGASQGT----------------------------------------
Procavia_capensis|11839             -XXXXXXXXXXPAPAFKDEK----------------------------------------
Anolis_carolinensis|16800           -TLAMKMEAQGASPAFKDGK----------------------------------------
Macropus_eugenii|5507               -IVTKEVETTXXXXXXXXXX----------------------------------------
Spermophilus_tridecemlineatus|10957 VAVIKQMESPGAVPEVKEEK----------------------------------------
Echinops_telfairi|14995             -XXXXXXXXXXAVPAFKEGK----------------------------------------
Erinaceus_europaeus|9787            ---TKKMESHDATLELKEEK----------------------------------------
Myotis_lucifugus|15948              -XXXXXXXXXXAGTKLKEEL----------------------------------------
Tupaia_belangeri|11627              -TVTKKMESPVAVPEVKEEK----------------------------------------
Monodelphis_domestica|5290          -ADRKKPETHAAPPAKDWKQ----------------------------------------
Ornithorhynchus_anatinus|25856      ------------------------------------------------------------

Branchiostoma_floridae|2814         ------------------------------------------------------------
Nematostella_vectensis|22544        ------------------------------------------------------------
Caenorhabditis_elegans|8388         ------------------------------------------------------------
Caenorhabditis_elegans|20961        ------------------------------------------------------------
Branchiostoma_floridae|13045        ------------------------------------------------------------
Branchiostoma_floridae|15752        ------------------------------------------------------------
Culex_quinquefasciatus|7451         ------------------------------------------------------------
Drosophila_grimshawi|6367           ------------------------------------------------------------
Drosophila_persimilis|3614          ------------------------------------------------------------
Drosophila_melanogaster|16670       ------------------------------------------------------------
Drosophila_yakuba|13550             ------------------------------------------------------------
Apis_mellifera|7221                 ------------------------------------------------------------
Drosophila_persimilis|9798          ------------------------------------------------------------
Linepithema_humile|9346             ------------------------------------------------------------
Nasonia_vitripennis|4101            ------------------------------------------------------------
Linepithema_humile|12420            ------------------------------------------------------------
Pogonomyrmex_barbatus|10478         ------------------------------------------------------------
Pediculus_humanus|4694              ------------------------------------------------------------
Microcebus_murinus|8927             ------------------------------------------------------------
Tarsius_syrichta|13305              ------------------------------------------------------------
Nematostella_vectensis|15702        ------------------------------------------------------------
Sorex_araneus|2385                  ------------------------------------------------------------
Vicugna_pacos|7415                  ------------------------------------------------------------
Ixodes_scapularis|15247             ------------------------------------------------------------
Bombyx_mori|7118                    ------------------------------------------------------------
Gallus_gallus|14566                 ------------------------------------------------------------
Taeniopygia_guttata|2591            ------------------------------------------------------------
Taeniopygia_guttata|2592            ------------------------------------------------------------
Oryzias_latipes|23393               ------------------------------------------------------------
Gasterosteus_aculeatus|19845        ------------------------------------------------------------
Fugu_rubripes|16690                 ------------------------------------------------------------
Tetraodon_nigroviridis|2504         ------------------------------------------------------------
Daphnia_pulex|22008                 ------------------------------------------------------------
Ornithorhynchus_anatinus|491        ------------------------------------------------------------
Ochotona_princeps|15730             ------------------------------------------------------------
Otolemur_garnettii|1917             ------------------------------------------------------------
Choloepus_hoffmanni|8379            ------------------------------------------------------------
Danio_rerio|3257                    ------------------------------------------------------------
Dipodomys_ordii|6879                ------------------------------------------------------------
Loxodonta_africana|21316            ------------------------------------------------------------
Cavia_porcellus|19478               ------------------------------------------------------------
Gorilla_gorilla|2710                ------------------------------------------------------------
Mus_musculus|23728                  EKPQLQEQPQQ----REQPQL------------------------------QQQPRPRQQ
Felis_catus|4350                    ------------------------------------------------------------
Callithrix_jacchus|38976            ------------------------------------------------------------
Rhesus_macaque|5843                 ------------------------------------------------------------
Pongo_abelii|793                    ------------------------------------------------------------
Homo_sapiens|6552                   ------------------------------------------------------------
Pan_troglodytes|20060               ------------------------------------------------------------
Pteropus_vampyrus|17003             ------------------------------------------------------------
Sus_scrofa|5855                     ------------------------------------------------------------
Bos_taurus|735                      ------------------------------------------------------------
Tursiops_truncatus|12643            ------------------------------------------------------------
Equus_caballus|22343                ------------------------------------------------------------
Canis_familiaris|14565              ------------------------------------------------------------
Dasypus_novemcinctus|5164           ------------------------------------------------------------
Xenopus_tropicalis|24094            ------------------------------------------------------------
Branchiostoma_floridae|13046        ------------------------------------------------------------
Procavia_capensis|11839             ------------------------------------------------------------
Anolis_carolinensis|16800           ------------------------------------------------------------
Macropus_eugenii|5507               ------------------------------------------------------------
Spermophilus_tridecemlineatus|10957 ------------------------------------------------------------
Echinops_telfairi|14995             ------------------------------------------------------------
Erinaceus_europaeus|9787            ------------------------------------------------------------
Myotis_lucifugus|15948              ------------------------------------------------------------
Tupaia_belangeri|11627              ------------------------------------------------------------
Monodelphis_domestica|5290          ------------------------------------------------------------
Ornithorhynchus_anatinus|25856      ------------------------------------------------------------

Branchiostoma_floridae|2814         ------------------------------------------------------------
Nematostella_vectensis|22544        ------------------------------------------------------------
Caenorhabditis_elegans|8388         ----------------VEEEIKQIFTSAKRLLNADIVKKTGFVYEFLLKDPTTKSERIIT
Caenorhabditis_elegans|20961        ------------------------------------------------------------
Branchiostoma_floridae|13045        ----------------QGGA-----------------PLGKGMFLPQLGD--APPEMVW-
Branchiostoma_floridae|15752        -----------------------------------------CMYILFLK-----------
Culex_quinquefasciatus|7451         ----------------ASGKIEGLFQKIESLLSEEIIKKTGAVYQFNVKG---AEAGVWF
Drosophila_grimshawi|6367           ---------APAPA--GDDKIPQLFKKIEALLSPEIVSKTQAVYQFNISG---AKQDTWY
Drosophila_persimilis|3614          ----------------DSGKIPQLFQKIESLLSTEIVSKTQAVFQFNISG---AEQGTWY
Drosophila_melanogaster|16670       -------------------KIPQLFRKIESLLSPEIVSKTQAVFQFNISG---AEQGTWF
Drosophila_yakuba|13550             ---------PASG---GDAKIPQLFVKIESLLSPEIVSKTQAVFQFNISG---AEQGTWF
Apis_mellifera|7221                 -----------------NEKIAQIFTVIQANLNHELVNKIGAIFQFNVKG---NEAGTWF
Drosophila_persimilis|9798          -----------------TGPF---------------------------------------
Linepithema_humile|9346             ----------------ETGQVARIFSAIDANLNSELVNKTGAIYQFNVKG---KESGTWF
Nasonia_vitripennis|4101            ---------PAKV---ESGKIASLFSVIEKSINPELVSKTGAIFQFNVKG---EEAGTWF
Linepithema_humile|12420            ------------------------------------------------------------
Pogonomyrmex_barbatus|10478         NNP-------------TETQMARIFNAINANLSSELVSKTGAIYKFNVKG---KESGIWF
Nematostella_vectensis|15702        ----------------SGGNVAGLFTKIQSMCDPELVKSVNGSFEFHLTG---AEPGVWY
Bombyx_mori|7118                    ----------------TAGEIPALFSLIGKNLSADLVKKTQAVFQFNVKG---KEEGVWH
Gallus_gallus|14566                 ---------ESAP----AGPVAETFRLIQGELNKEMVKSTQGVFQFELSG---DEGGTWY
Taeniopygia_guttata|2591            ------------------GPVAETFRVIQEAVTEEYMRRTQGIFQFELSG---DGGGTWY
Taeniopygia_guttata|2592            ---------AVAM---PAGPVAETFRVIQEAVTEEYMRRTQGIFQFELSG---DGGGTWY
Gasterosteus_aculeatus|19845        ---------------SSGGPIESTFNAIRGVINEDLVKLTQGIYQFDLSG---ENKGLWF
Tetraodon_nigroviridis|2504         ------------------GEVDTPQRSHQRVINEDVVKSTQGVYQFDLSG---EHAGTWF
Ornithorhynchus_anatinus|491        QEQ------VTTP----SGAVEQTFKIVKAALSEEVVKSTQAIYLFELSG---ENGGTWY
Danio_rerio|3257                    ---------ADPV---AAGPVSEMFNTIRGIISPEMVKTTQGVYKFNLAG---EHAGVWY
Xenopus_tropicalis|24094            LTL------PFN----GMSFFQPNIMLCEKCVAENCSNNNMNLYL----G---EESGNWF
Branchiostoma_floridae|13046        -----------------AGGPAKTFEVINSLVSEEILNSVKGVFQFNLTG----------
Procavia_capensis|11839             QAP------RPK----AGSPVEETFRIVKETLSDDIIKATQAVYQFELSG---EGGGTWF
Myotis_lucifugus|15948              -QP------PSKP---PSGAV-KTFKIVKGSLSDDV--KATQIYQFEXXX---EDGGTWF
Ornithorhynchus_anatinus|25856      ------------------------------------------------------------

Branchiostoma_floridae|2814         ------------------------------------------------------------
Nematostella_vectensis|22544        ------------------------------------------------------------
Caenorhabditis_elegans|20961        -----------------------------KSFAPRFGS----------------------
Branchiostoma_floridae|13045        --------SSGIGDVPP-----------------------TPPPARGIGR----------
Branchiostoma_floridae|15752        ------------------------------------------------------------
Drosophila_persimilis|9798          ------------------------------------------------------------
Linepithema_humile|9346             LDLKNGNGAIGKGEPSQ--PADATLTMDSDNFFAMFSGK---------------------
Linepithema_humile|12420            ------DGS---------------------------------------------------
Oryzias_latipes|23393               LDLKSGSGSAGKGDPSL--KADVVMKMDSGDFNKMFAGERRSDAAAMA------------
Otolemur_garnettii|1917             LDLKSKGGKVGYGEPSD--RADVVMSMSTEDFVKMFS-----------------------
Branchiostoma_floridae|13046        ------------------------------------------------------------
Myotis_lucifugus|15948              LDLKNKGGNAGYGEPSE--QADVVMNMSTDDFVKMFS-----------------------
Ornithorhynchus_anatinus|25856      ------------------------------------------------------------

Branchiostoma_floridae|2814         ---------------
Nematostella_vectensis|22544        ---------------
Caenorhabditis_elegans|8388         MKLESLLRKFTEGKL
Caenorhabditis_elegans|20961        ------------SKL
Branchiostoma_floridae|13045        ---------------
Branchiostoma_floridae|15752        ------------YNL
Culex_quinquefasciatus|7451         MKLEKLMGGLK-SKL
Drosophila_grimshawi|6367           LKLEKLMKALK-SKL
Drosophila_persimilis|3614          LKLEKLMKALK-SKL
Drosophila_melanogaster|16670       LKLEKLMKALK-SKL
Drosophila_yakuba|13550             LKLEKLMKALK-SKL
Apis_mellifera|7221                 MKLEKLMQNLK-SKL
Drosophila_persimilis|9798          ------------AKL
Linepithema_humile|9346             ---------------
Nasonia_vitripennis|4101            MKLEKLMLNLK-SKL
Linepithema_humile|12420            -KIRKLDS-------
Pogonomyrmex_barbatus|10478         MKLEKLMSSLK-SKL
Pediculus_humanus|4694              MKLEKLMNSLK-SKL
Microcebus_murinus|8927             IKLEKLMNQMS-AKL
Tarsius_syrichta|13305              IKLEKLMNQMN-ARL
Nematostella_vectensis|15702        MKLEKLMKQLK-SKL
Sorex_araneus|2385                  IKLEKLMNQMN-AKL
Vicugna_pacos|7415                  IKLEKLMSQLN-AKL
Ixodes_scapularis|15247             MKLEKLMGMLR-AKL
Bombyx_mori|7118                    MKLEKMMQSLK-KKA
Gallus_gallus|14566                 VKLEKMLTQFN-AKL
Taeniopygia_guttata|2591            LSLEKML--------
Taeniopygia_guttata|2592            IKLEKMLSQLN-SKL
Oryzias_latipes|23393               ---------------
Gasterosteus_aculeatus|19845        LKLEKLMGRMSKAKL
Fugu_rubripes|16690                 IKLEKLMGRMNKAKL
Tetraodon_nigroviridis|2504         IKLEKLMGRMNTAKL
Daphnia_pulex|22008                 MKLEKLMGSMQ-SKL
Ornithorhynchus_anatinus|491        IKLERLMNQVN-SRL
Ochotona_princeps|15730             IKLEKLMNQMN-R--
Otolemur_garnettii|1917             ---------------
Choloepus_hoffmanni|8379            IKLEKLMNQMN-AKL
Danio_rerio|3257                    IKLEKMMAMMK-SKL
Dipodomys_ordii|6879                IKLEKLMNQMN-SRL
Loxodonta_africana|21316            IKLEKVMTQMN-AKL
Cavia_porcellus|19478               IKLEKLMSQMH-PRL
Gorilla_gorilla|2710                IKLEKLMNQMN-ARL
Mus_musculus|23728                  IKLEKLMTQMN-SRL
Rattus_norvegicus|10635             IKLEKLMT-------
Felis_catus|4350                    IKLEKLMNQMN-ARL
Callithrix_jacchus|38976            MKLEKLVSQMN-ARL
Rhesus_macaque|5843                 IKLEKLMNQMN-ARL
Pongo_abelii|793                    IKLEKLMNQMN-ARL
Homo_sapiens|6552                   IKLEKLMNQMN-ARL
Pan_troglodytes|20060               IKLEKLMNQMN-ARL
Pteropus_vampyrus|17003             VKLEKLMNQLQ-AKL
Sus_scrofa|5855                     IKLEKLMNQMN-ARL
Bos_taurus|735                      IKLEKLMNQMN-SKL
Tursiops_truncatus|12643            IKLEKLMNQMN-ARL
Equus_caballus|22343                IKLEKLMSQMN-AKL
Canis_familiaris|14565              IKLEKLMNQMN-AKL
Canis_familiaris|7225               IKLEKLMNQMN-AKL
Dasypus_novemcinctus|5164           IKLEKLMNQIN-ARL
Xenopus_tropicalis|24094            LKLEKILGQMN-AKL
Branchiostoma_floridae|13046        ---------------
Procavia_capensis|11839             IKLDKLMTQMT-AKV
Anolis_carolinensis|16800           IKLEKLMGQFN-SKL
Macropus_eugenii|5507               IKLERLMTQMN-SRL
Spermophilus_tridecemlineatus|10957 IKLEKLMNQMN-SRL
Echinops_telfairi|14995             IKLEKLMNQMD-AKL
Erinaceus_europaeus|9787            IKLEKLMNQMN-TRL
Myotis_lucifugus|15948              ---------------
Tupaia_belangeri|11627              IKLEKLMNQMN-ARL
Monodelphis_domestica|5290          IKLERLMTQMN-SRL
Ornithorhynchus_anatinus|25856      ---------------