Orthologs Set ID: EOG4006CK

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Anolis carolinensis 10760 1520
Bos taurus 15488 1520
Callithrix jacchus 14927 1520, 1641
Canis familiaris 25817 1173, 1520
Cavia porcellus 5117 1520
Dipodomys ordii 1506 1520
Echinops telfairi 14051
Equus caballus 26043 1520
Erinaceus europaeus 8924 9, 954, 1104, 1115, 1123, 1176, 1212, 1278, 1309, 1374, 1520
Fugu rubripes 13698 14, 800, 1275, 1520
Gallus gallus 22307 1520
Gasterosteus aculeatus 21344 548, 702, 1161, 1520
Gorilla gorilla 23782 1520
Homo sapiens 37308 1520
Loxodonta africana 18101 1520
Macropus eugenii 13471 669, 1520, 1524
Microcebus murinus 19253 554, 1169, 1520, 1920, 1936, 1953, 1956, 1962, 1992, 1995, 2001, 2022, 2031, 2040, 2067, 2075, 2091, 2100, 2110, 2115, 2148, 2151
Monodelphis domestica 13964 1520
Mus musculus 19138 1520
Ochotona princeps 17083 405, 1520
Ornithorhynchus anatinus 4548 565
Oryctolagus cuniculus 19719 547, 1161, 1520, 1755, 1882
Oryzias latipes 3155 409, 708, 1520
Otolemur garnettii 459 1520, 1889, 2006, 2018
Pan troglodytes 17615 1520
Pongo abelii 13036 1520
Procavia capensis 8271 147, 273, 294, 299, 315, 353, 363, 378, 462, 505
Pteropus vampyrus 16901
Rhesus macaque 19208 1520
Sorex araneus 9711 1520
Spermophilus tridecemlineatus 11682 276, 282, 285, 297, 315, 318, 1520, 2079, 2100
Sus scrofa 615
Taeniopygia guttata 18349 1520, 1899, 1992, 2076, 2119
Tetraodon nigroviridis 13654 547, 735, 1520
Tupaia belangeri 16306
Tursiops truncatus 892 676, 746, 1520, 1782
Xenopus tropicalis 9570 851, 1520

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Anolis carolinensis 10760 ENSACAT00000018078 100555841 ENSACAG00000018007 zbtb7c anoCar1
Bos taurus 15488 ENSBTAT00000017690 614110 ENSBTAG00000013306 IPI00907509.1 bosTau4
Callithrix jacchus 14927 ENSCJAT00000061450 100398165 ENSCJAG00000004704 ZBTB7C calJac3
Canis familiaris 25817 ENSCAFT00000030295 490573 ENSCAFG00000019080 canFam2
Cavia porcellus 5117 ENSCPOT00000008962 100726674 ENSCPOG00000008882 ZBTB7C cavPor3
Dipodomys ordii 1506 ENSDORT00000002186 ENSDORG00000002188 Zbtb7c dipOrd1
Echinops telfairi 14051 ENSETET00000013675 ENSETEG00000013676 ZBTB7C TENREC
Equus caballus 26043 ENSECAT00000021695 100053521 ENSECAG00000020456 ZBTB7C equCab2
Erinaceus europaeus 8924 ENSEEUT00000008052 ENSEEUG00000008049 ZBTB7C eriEur1
Fugu rubripes 13698 ENSTRUT00000025999 101073963 ENSTRUG00000010287 ZBTB7C fr2
Gallus gallus 22307 ENSGALT00000023689 431576 ENSGALG00000014696 ZBTB7C galGal3
Gasterosteus aculeatus 21344 ENSGACT00000021848 ENSGACG00000016516 ZBTB7C gasAcu1
Gorilla gorilla 23782 ENSGGOT00000027967 101140756 ENSGGOG00000008438 ZBTB7C gorGor3
Homo sapiens 37308 ENST00000332053, NM_001039360 201501 ENSG00000184828 ZBTB7C hg19,GRCh37
Loxodonta africana 18101 ENSLAFT00000003433 100663211 ENSLAFG00000003436 ZBTB7C loxAfr3
Macropus eugenii 13471 ENSMEUT00000013473 ENSMEUG00000013432 ZBTB7C Meug_1.0
Microcebus murinus 19253 ENSMICT00000017920 ENSMICG00000017920 ZBTB7C micMur1
Monodelphis domestica 13964 ENSMODT00000004263 100019180 ENSMODG00000003412 ZBTB7C monDom5
Mus musculus 19138 ENSMUST00000058997 207259 ENSMUSG00000044646 Zbtb7c mm9
Ochotona princeps 17083 ENSOPRT00000006178 101530341 ENSOPRG00000006181 ZBTB7C OchPri2.0
Ornithorhynchus anatinus 4548 ENSOANT00000009439 100088588 ENSOANG00000005929 ZBTB7C ornAna1
Oryctolagus cuniculus 19719 ENSOCUT00000021151 ENSOCUG00000022348 ZBTB7C oryCun2.0
Oryzias latipes 3155 ENSORLT00000007262 ENSORLG00000005778 ZBTB7C oryLat2
Otolemur garnettii 459 ENSOGAT00000000445 100960028 ENSOGAG00000000444 ZBTB7C otoGar1
Pan troglodytes 17615 ENSPTRT00000018365, NM_001039360 455408 ENSPTRG00000010006 ZBTB7C panTro2
Pongo abelii 13036 ENSPPYT00000010681 100459229 ENSPPYG00000009145 ZBTB7C ponAbe2
Procavia capensis 8271 ENSPCAT00000008117 ENSPCAG00000008113 ZBTB7C proCap1
Pteropus vampyrus 16901 ENSPVAT00000007761 ENSPVAG00000007762 ZBTB7C pteVam1
Rhesus macaque 19208 ENSMMUT00000022041 705033 ENSMMUG00000015704 ZBTB7C rheMac2
Sorex araneus 9711 ENSSART00000009527 101548338 ENSSARG00000009541 ZBTB7C sorAra1
Spermophilus tridecemlineatus 11682 ENSSTOT00000011683 101967557 ENSSTOG00000011681 ZBTB7C speTri1
Sus scrofa 615 ENSSSCT00000004976 susScr2
Taeniopygia guttata 18349 ENSTGUT00000000028 100222194 ENSTGUG00000000028 ZBTB7C taeGut1
Tetraodon nigroviridis 13654 ENSTNIT00000022178 ENSTNIG00000018762 ZBTB7C tetNig2
Tupaia belangeri 16306 ENSTBET00000016307 ENSTBEG00000016322 ZBTB7C tupBel1
Tursiops truncatus 892 ENSTTRT00000011631 ENSTTRG00000011636 ZBTB7C turTru1
Xenopus tropicalis 9570 ENSXETT00000043805 ENSXETG00000020303 zbtb7c xenTro2

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Anolis carolinensis 17430 ENSACAP00000017730 100555841 ENSACAG00000018007 zbtb7c anoCar1
Bos taurus 5031 ENSBTAP00000017690 614110 ENSBTAG00000013306 IPI00907509.1 bosTau4
Callithrix jacchus 7599 ENSCJAP00000050207 100398165 ENSCJAG00000004704 ZBTB7C calJac3
Canis familiaris 15362 ENSCAFP00000028146 490573 ENSCAFG00000019080 canFam2
Cavia porcellus 3981 ENSCPOP00000007977 100726674 ENSCPOG00000008882 ZBTB7C cavPor3
Dipodomys ordii 1422 ENSDORP00000002051 ENSDORG00000002188 Zbtb7c dipOrd1
Echinops telfairi 11078 ENSETEP00000011092 ENSETEG00000013676 ZBTB7C TENREC
Equus caballus 17967 ENSECAP00000017883 100053521 ENSECAG00000020456 ZBTB7C equCab2
Erinaceus europaeus 7334 ENSEEUP00000007333 ENSEEUG00000008049 ZBTB7C eriEur1
Fugu rubripes 25894 ENSTRUP00000025894 101073963 ENSTRUG00000010287 ZBTB7C fr2
Gallus gallus 6284 ENSGALP00000023643 431576 ENSGALG00000014696 ZBTB7C galGal3
Gasterosteus aculeatus 21363 ENSGACP00000021807 ENSGACG00000016516 ZBTB7C gasAcu1
Gorilla gorilla 18622 ENSGGOP00000017890 101140756 ENSGGOG00000008438 ZBTB7C gorGor3
Homo sapiens 7506 ENSP00000328732 hg19,GRCh37
Loxodonta africana 15750 ENSLAFP00000002858 100663211 ENSLAFG00000003436 ZBTB7C loxAfr3
Macropus eugenii 12252 ENSMEUP00000012251 ENSMEUG00000013432 ZBTB7C Meug_1.0
Microcebus murinus 16315 ENSMICP00000016317 ENSMICG00000017920 ZBTB7C micMur1
Monodelphis domestica 1377 ENSMODP00000004175 100019180 ENSMODG00000003412 ZBTB7C monDom5
Mus musculus 50613 ENSMUSP00000057856 207259 ENSMUSG00000044646 Zbtb7c mm9
Ochotona princeps 14890 ENSOPRP00000005665 101530341 ENSOPRG00000006181 ZBTB7C OchPri2.0
Ornithorhynchus anatinus 23188 ENSOANP00000009437 100088588 ENSOANG00000005929 ZBTB7C ornAna1
Oryctolagus cuniculus 19785 ENSOCUP00000021605 ENSOCUG00000022348 ZBTB7C oryCun2.0
Oryzias latipes 6763 ENSORLP00000007261 ENSORLG00000005778 ZBTB7C oryLat2
Otolemur garnettii 398 ENSOGAP00000000399 100960028 ENSOGAG00000000444 ZBTB7C otoGar1
Pan troglodytes 2700 ENSPTRP00000017011 455408 ENSPTRG00000010006 ZBTB7C panTro2
Pongo abelii 6568 ENSPPYP00000010276 100459229 ENSPPYG00000009145 ZBTB7C ponAbe2
Procavia capensis 7756 ENSPCAP00000007591 ENSPCAG00000008113 ZBTB7C proCap1
Pteropus vampyrus 15924 ENSPVAP00000007327 ENSPVAG00000007762 ZBTB7C pteVam1
Rhesus macaque 575 ENSMMUP00000020619 705033 ENSMMUG00000015704 ZBTB7C rheMac2
Sorex araneus 8633 ENSSARP00000008621 101548338 ENSSARG00000009541 ZBTB7C sorAra1
Spermophilus tridecemlineatus 10483 ENSSTOP00000010484 101967557 ENSSTOG00000011681 ZBTB7C speTri1
Sus scrofa 4852 ENSSSCP00000004859 susScr2
Taeniopygia guttata 399 ENSTGUP00000000028 100222194 ENSTGUG00000000028 ZBTB7C taeGut1
Tetraodon nigroviridis 12865 ENSTNIP00000021942 ENSTNIG00000018762 ZBTB7C tetNig2
Tupaia belangeri 14189 ENSTBEP00000014172 ENSTBEG00000016322 ZBTB7C tupBel1
Tursiops truncatus 848 ENSTTRP00000011030 ENSTTRG00000011636 ZBTB7C turTru1
Xenopus tropicalis 9213 ENSXETP00000043805 ENSXETG00000020303 zbtb7c xenTro2

multiple sequence alignment in CLUSTALW format

Procavia_capensis|8271              ---ATGGCCAATGGCATA------------------------------------------
Xenopus_tropicalis|9570             ------------------------------------------------------------
Spermophilus_tridecemlineatus|11682 ------------------------------------------------------------

Procavia_capensis|8271              ------------------------------------------------------------
Spermophilus_tridecemlineatus|11682 ------------------------------------------------------------

Procavia_capensis|8271              ---------------TATAAATCCAGCATTCACATA------------------------
Anolis_carolinensis|10760           GTCCAGGACCaagagtacaggacccacaaatcTGTCCTGGCGGCTTGCAGCCAATACTTC
Spermophilus_tridecemlineatus|11682 ------------------------------------------------------------

Procavia_capensis|8271              ------------------------------------------------------------
Taeniopygia_guttata|18349           AAAAAACTCTTCACTACT---------------GGCACTTTAACAGACCAGCCCTATGTT
Gallus_gallus|22307                 AAAAAACTCTTCACTACC---------------GGCACTTTAACTGACCAGCCCTATGTT
Anolis_carolinensis|10760           AAGAAACTCTTCACTGCC---------------GGCACTTTAGCGGACCAGCCCTGTGTT
Xenopus_tropicalis|9570             AAGAAGCTCTTTACCGCG---------------GGCTCGTTATTAGATCAGCCCTACATA
Echinops_telfairi|14051             CAGAAGCTCTTCACGGCC---------------GGGACCCTGGCCAGCCAGCCCCACGTC
Ornithorhynchus_anatinus|4548       AAGAAACTCTTCACCACG---------------GGCGCCCTAGCCGACCAACCCTACGTC
Sorex_araneus|9711                  AAGAAGCTCTTCACGGCC---------------GGCACCCTGGGCAGCCAGCCCTACGTC
Spermophilus_tridecemlineatus|11682 ------------------------------------------------------------
Dipodomys_ordii|1506                AAGAAGCTCTTCACAGCT---------------GGCAGCCTAACCAGCCAGCCCTACATC
Oryctolagus_cuniculus|19719         AAGAAGCTCTTCACGGCC---------------GGCACCCTAGCCAGCCAGCCCTACGTC
Ochotona_princeps|17083             AAGAAGCTCTTCACAGCT---------------GGCACCCTGGCCAGTCAACCCTACGTC
Erinaceus_europaeus|8924            AAGAAGCTCTTCACAGCT---------------GGCGCCTTGGCCAGCCAGCCCTACGTC
Loxodonta_africana|18101            AAGAAGCTCTTCACAGCT---------------GGCACCCTAGCCAGCCAGCCCTATGTC
Otolemur_garnettii|459              AAGAAGCTCTTCACGGCC---------------GGCACCCTAGCCAGCCAGCCCTATGTC
Mus_musculus|19138                  AAGAAGCTCTTCACAGCC---------------GGGAGCCTGGCCAGCCAGCCCTACGTG
Callithrix_jacchus|14927            AAGAAGCTCTTCACCGCC---------------GGCACCCTAGCCAGCCAGCCTTACGTC
Rhesus_macaque|19208                AAGAAGCTCTTCACAGCT---------------GGCACCCTAGCCAGCCAGCCCTACGTC
Gorilla_gorilla|23782               AAGAAGCTTTTCACAGCC---------------GGCACCCTAGCCAGCCAGCCCTACGTC
Pan_troglodytes|17615               AAGAAGCTTTTCACAGCC---------------GGCACCCTAGCCAGCCAGCCCTACGTC
Homo_sapiens|37308                  AAGAAGCTTTTCACAGCC---------------GGCACCCTAGCCAGCCAGCCCTACGTC
Pongo_abelii|13036                  AAGAAGCTTTTCACAGCC---------------GGCACCCTAGCCAGCCAGCCCTACGTC
Canis_familiaris|25817              AAGAAGCTCTTCACGGCC---------------GGCGCCCTGGCCAGCCAGCCGTACGTC
Cavia_porcellus|5117                AAGAAGCTCTTCACAGCC---------------GGCAGCCTAGCCAGTCAGCCCTATGTC
Macropus_eugenii|13471              AAGAAGCTCTTCACAGCA---------------GGTACTTTAGCTGACCAGCCTTATGTC
Monodelphis_domestica|13964         AAGAAGCTCTTCACGGCG---------------GGGACTTTAGCTGACCAGCCTTACGTC
Bos_taurus|15488                    AAGAAGCTCTTCACGGCG---------------GGCACCTTAGCCAGCCAGCCCTACGTC
Equus_caballus|26043                AAGAAGCTCTTCACGGCC---------------GGCACCTTAGCCAGCCAGCCGTATGTC
Microcebus_murinus|19253            AAGAAGCTGTTCACGGCC---------------GGCACCCTAGCCAGCCAGCCCTACGTG
Pteropus_vampyrus|16901             AAGAAGCTCTTCACAGCC---------------GGCACCTTAGCCAGCCAGCCCTATGTC
Tupaia_belangeri|16306              AAGAAGCTCTTCACAGCC---------------GGCACCCTAGCCAGCCAGCCCTACGTC
Tursiops_truncatus|892              AAGAAGCTCTTCACAGCC---------------GGCACCTTAGCCAGCCAGCCCTACGTC
Sus_scrofa|615                      AAGAAGCTCTTCACGGCC---------------GGCACCCTAGCCAGCCAGCCCTACGTC

Procavia_capensis|8271              ---------------------CCCAAGAGAAGT------------GAAGTACTGTATACC
Spermophilus_tridecemlineatus|11682 ---------GACTTCGTGCAGCCCGAGGCGCTGGCCATCCTGTTC---------TACTGC
                                                         ** .*                            ** :  

                                             **  * *  .*    **  *        *  * .. ** *.  . .** * 

Tetraodon_nigroviridis|13654        GAGATCCCCTGCATCATCAGCGTCTGCCTGGAGATCATGGAC------------------
Fugu_rubripes|13698                 GAGATCCCCTGCATCATCAACGTCTGCTTGGAGATCATGGACAGCgggggcggaggcggg
Sus_scrofa|615                      GAGATCCAGTGCATCGTGAACGTGTGCCTGGAGATCATGGAG------------------
                                    .* .* *.  .  :  *    .. ..  . .   .  . .                    

Tetraodon_nigroviridis|13654        ------------------------------------------------------------
Gasterosteus_aculeatus|21344        ------------------------------------------------------------
Fugu_rubripes|13698                 ggaggcagggaggaggagggagaggaggacgaggatgaagaggaggaggcagaggaagat
Oryzias_latipes|3155                ------------------GATGAGCAGGAGAAGGAGGAAGATAACGCCAGTGAG------
Procavia_capensis|8271              ------------------NNNNNNNNNNNNNNNNNNNNNNNNGATGACGATGACGAGGAG
Taeniopygia_guttata|18349           ------------------GAGGAAGATGACAAAGAGGACGATGATGATGATGAAGATGAA
Gallus_gallus|22307                 ------------------gaggaagatgacaaagaggatgaagatgatgatgaagacgaa
Anolis_carolinensis|10760           ------------------gaggaagaggagaaggaagaggaggaggaggaagaagaggag
Xenopus_tropicalis|9570             ------------------GAGGACAACGAAAAGGAAGAAGATGAGGATGATGACGATGAC
Echinops_telfairi|14051             GGC---------------GGCGCCGAGGACAAGGAGGACGAGGAGGAGGAGGAGGACGAG
Ornithorhynchus_anatinus|4548       ------------------------------------------------------------
Sorex_araneus|9711                  ------------------GAGGAGGACGACAAGGAGGACGACGACGACGACGACGAGGAG
Spermophilus_tridecemlineatus|11682 ------------------GAGGAGGACGACAAGGAGGATGACGACGACGACGAAGACGAC
Dipodomys_ordii|1506                ------------------GAGGAGGATGACAAGGAAGATGATGATGATGACGAAGATGAT
Oryctolagus_cuniculus|19719         ------------------------------------------------------------
Ochotona_princeps|17083             ------------------GAGGAGGATGACAAGGAGGATGACGACGACGATGAGGACGAT
Erinaceus_europaeus|8924            ------------------GAGGAAGATGACAAGGAGGACGATGATGACGATGAGGAGGAT
Loxodonta_africana|18101            ------------------gaggaggacgacaaggaggatgatgacgatgacgaagatgac
Otolemur_garnettii|459              ------------------GAGGAGGACGACAAGGAGGATGACGATGATGATGATGATGAC
Mus_musculus|19138                  ------------------gaggaggatgacaaggaggaggaggacgaggatgacgatgat
Callithrix_jacchus|14927            ------------------GAGGAGGATGACAAGGAGGACGACGATGACGACGAAGATGAT
Rhesus_macaque|19208                ------------------GAGGAGGACGACAAGGAGGATGACGATGATGACGAAGATGAT
Gorilla_gorilla|23782               ------------------GAGGAGGACGACAAGGAGGACGATGACGACGACGAAGATGAT
Pan_troglodytes|17615               ------------------GAGGAGGACGACAAGGAGGACGATGATGACGACGAAGATGAT
Homo_sapiens|37308                  ------------------GAGGAGGATGACAAGGAGGACGATGACGACGACGAAGATGAT
Pongo_abelii|13036                  ------------------GAGGAGGACGACAAGGAGGACGATGACGACGACGAAGATGAT
Canis_familiaris|25817              ------------------gaggaggacgacaaggaggatgacgacgacgaggacgaggac
Cavia_porcellus|5117                ------------------GAGGAGGATGACAAGGAGGATGATGATGATGACgaagatgac
Macropus_eugenii|13471              ------------------GAGGAAGATGACAAGGAGGATGATGATGATGAGGATGAAGAG
Monodelphis_domestica|13964         ------------------GAGGAGGATGACAAGGAGGATGATGACGACGAAGATGAGGAG
Bos_taurus|15488                    ---------------------------GACAAGGAGGACGACGACGACGACGAGGAGGAC
Equus_caballus|26043                ------------------GAGGAGGACGACAAGGAGGACGATGATGATGACGAAGATGAT
Microcebus_murinus|19253            ------------------GAGGAGGACGACAAGGAGGACGACGACGACGACGAAGACGAC
Pteropus_vampyrus|16901             ------------------GAGGAGGACGACAAGGAGGACGATGACGATGACGAGGACGAC
Tupaia_belangeri|16306              ------------------GAGGAGGACGATAAGGAGGACGACGACGATGACGAAGAGGAC
Tursiops_truncatus|892              ------------------GAGGAGGATGACAAAGAGGAC---------------------
Sus_scrofa|615                      ------------------------------------------------------------

Tetraodon_nigroviridis|13654        ------------------------------------------------------------
Gasterosteus_aculeatus|21344        ------------------------------------------------------------
Fugu_rubripes|13698                 gaggaggaagacgacgaggaagacgaggaggaggagatggggtcgaggaagcaagaggag
Oryzias_latipes|3155                ------------------------------------------------------------
Procavia_capensis|8271              GAGGAAGAGGAGGAGGAGGAGGAGGAAGAGGAGGAAGAT---------------------
Taeniopygia_guttata|18349           GATGAAGATGAGGAGGAAGAGGAGGAGGAGGAA---------------------------
Gallus_gallus|22307                 gatgaagatgaggaggaagaggaggaagaggaagaagaa---------------------
Anolis_carolinensis|10760           gaggaagaggaagaagaggaagaggatgaagaaagggaa---------------------
Xenopus_tropicalis|9570             GACGATGAAGAAGAA---------------------------------------------
Echinops_telfairi|14051             GAGGAGGAGGAAGAGGAGGAGGAGGAGGACGAC---------------------------
Ornithorhynchus_anatinus|4548       ------------------------------------------------------------
Spermophilus_tridecemlineatus|11682 GACGACGAGGAGGACGAAGAGGAGGAGGAGGAGGAAGAG---------------------
Dipodomys_ordii|1506                GACGATGAGGAGGATGAAGAGGAGGAGGAGGAGGAAGAG---------------------
Oryctolagus_cuniculus|19719         ------------------------------------------------------------
Ochotona_princeps|17083             GAGGATGATGAGGAGGAGGACGAAGAGGAAGAAGAGGAG---------------GAGGAG
Erinaceus_europaeus|8924            GAGGACGAGGAGGAC---GAAGAGGAGGAGGAAGAAGAG------------------GAG
Loxodonta_africana|18101            gaggaggaggaggaagaagaggaggaggaggaagaagag---------------------
Otolemur_garnettii|459              GATGAGGAGGAGGACGAGGAAGAGGAGGAGGAAGAGGAG---------------------
Mus_musculus|19138                  gaagatgaagacgacgaagaggaggaggaagaggaagaa---------------------
Callithrix_jacchus|14927            GATGATGAGGAGGACGAAGAGGAGGAGGAAGAGGAAGAG------------------GAA
Rhesus_macaque|19208                GATGATGAGGAGGACGAAGAAGAGGAGGAGGAGGAGGAA------------------GAG
Gorilla_gorilla|23782               GATGATGAGGAGGACGAAGAGGAGGAGGAGGAAGAGGAG---------------------
Pan_troglodytes|17615               GATGATGAGGAGGACGAAGAGGAGGAGGAGGAAGAGGAG---------------------
Homo_sapiens|37308                  GATGATGAGGAGGACGAAGAGGAGGAGGAGGAAGAGGAG---------------------
Pongo_abelii|13036                  GATGATGAGGAGGACGAAGAGGAGGAGGAGGAGGAAGAG------------------GAG
Canis_familiaris|25817              gaggatgaggaggacgaggaggaggaggaagaggaggag------------gaagatgag
Cavia_porcellus|5117                gacgatgaagaagatgaagaagaagaggaagaagaggaa------------------gaa
Macropus_eugenii|13471              GATGAGGAGGAGGATGAGGAGGAAGAAGATGAAGATGAT---------------------
Monodelphis_domestica|13964         GACGAGGAAGAGGATGAGGAGGAAGAAGATGAAGAGGAT---------------------
Bos_taurus|15488                    GATGATGAGGACGAAGAGGAGGAGGAGGAGGAGGAAGAA---------------------
Equus_caballus|26043                GATGATGAGGAGGATGAAGAGGAGGAGGAGGAGGAAGAG---------------------
Microcebus_murinus|19253            GACGACGAGGAGGACGAGGAGGAGGAAGAGGAGGAGGAA---------------------
Pteropus_vampyrus|16901             GATGACGAGGAGGACGAGGAGGAGGAGGAGGAAGAGGAG---------------------
Tupaia_belangeri|16306              GATGACGAGGAGGATGAGGAGGAGGAGGAAGAGGAGGAG---------------------
Tursiops_truncatus|892              ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Fugu_rubripes|13698                 gaggaggacaacgTCAGCGAGAGGTCGCTGCAGTCATCGGAGAGCAggggggggCGGACG
Oryzias_latipes|3155                ------------------------------AGGTCGCTGGAGAGCAAGGGTGAGCCGATG
Taeniopygia_guttata|18349           ------------------GTGGAAGATTTTGTCAATCAGGAGAACCTAGCTGATGTACAA
Gallus_gallus|22307                 ------------------gtggaagaTTTTGTCAATCAGGAGAATCTGACTGATGGCCAA
Anolis_carolinensis|10760           ------------ggggaagttgaggaCTTTGCAGTCCAG---AATCTAACAGATGCCCAA
Xenopus_tropicalis|9570             ------------------ACAAAAGACTTCATGAATGAGGAGAACCAGACTGATATCCAG
Ornithorhynchus_anatinus|4548       ---------------------GCCGacTTTGTCAACGGGGAGGACCTGAATGGGACCCGG
Loxodonta_africana|18101            gaggaggaggaggaTGACACGGAGGATTTCGCTGACCAAGAGAACTTGCCAGACCCCCAG
Mus_musculus|19138                  gaggaggaggaggaTGACCCAGAGGACTTTGCCGACCAGGAAAACTTGCCTGACCCCCAG
Canis_familiaris|25817              gaggacgaggaggaCGACACTGAGGACTTTGCTGATCAAGAAAACCTGACTGACCCCCAG
Tursiops_truncatus|892              ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Tursiops_truncatus|892              ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Tetraodon_nigroviridis|13654        GTTTCGTCCCAGGCCCCGTCTCCGGAGGACCCCATGAGGGACAAG---------------
Fugu_rubripes|13698                 CTGTCCTCCCAGTCC------------------------CAGTCT---------------
Procavia_capensis|8271              GACACACCCAGGGACTTCCCTGATTCCTTCCAAGAC---GACAGC---------------
Taeniopygia_guttata|18349           GAAGCACCTAAAGATTTTCCAAATCACTTCGCAGCCAGTAACTCC---------------
Gallus_gallus|22307                 GAAGCACCTAAAGACTTTCCAAATCACTACCCGGCCAACAACACC---------------
Anolis_carolinensis|10760           GAAATGCAGAGTGGTTTCTCCAGCCACTTCCCAGCTGGGACACCA---------------
Xenopus_tropicalis|9570             GAATCGCAGAAGGACCTCCCAACGCATTTCTCATCCATGACCAAC---------------
Echinops_telfairi|14051             GACGCCCCCCGGGACTTCCCTGGCCCCTTCCCGGCG---GGCAGC---------------
Ornithorhynchus_anatinus|4548       GACCCTCCGCGGGATTTTCCCGATCGCTTCCCGGCCCACAGCTCG---------------
Sorex_araneus|9711                  GACCCTCCCCGGGACTTCCCCGACTCCTTCCCCGCG---GGCAGC---------------
Spermophilus_tridecemlineatus|11682 GACACACCCAGGGACTTCCCAGACTCCTTCCAGGCC---GGCAGC---------------
Dipodomys_ordii|1506                GACACACCCAGAGACTTCTCCGATTCCTTCCCGGCC---GACAGC---------------
Oryctolagus_cuniculus|19719         GATGCCCCCAGCGACTTCCCCGACGCCTTCCCGGCC---GGCAGC---------------
Ochotona_princeps|17083             GACGCCCCGAGCGACTTCCCCGATGCCTTTCCGGCC---AGTGGC---------------
Erinaceus_europaeus|8924            GACACCCCCAGGGACTACCCAGACTCCTTCCAGGCC---AGCAGC---------------
Loxodonta_africana|18101            GACACACCCAGGGACTTTCCTGATTCCTTCCAGGCT---GGCAGC---------------
Otolemur_garnettii|459              GACACACCCAGGGACTTCCCTGACCCCTTCCAGGCT---GGCAGC---------------
Mus_musculus|19138                  GACACACCCAGGGACTTCCCCGACTCCTTCCAGCCC---GGAAGC---------------
Callithrix_jacchus|14927            GACACCCCCAGGGACTTCCCTGACTCCTTCCAGGCT---GGCAGT---------------
Rhesus_macaque|19208                GACACCCCCAGGGACTTCCCTGACTCCTTTCAGGCT---GGCAGT---------------
Gorilla_gorilla|23782               GACACCCCCAGGGACTTCCCTGACTCCTTCCAGGCT---GGCAGT---------------
Pan_troglodytes|17615               GACACCCCCAGGGACTTCCCTGACTCCTTCCAGGCT---GGCAGT---------------
Homo_sapiens|37308                  GACACCCCCAGGGACTTCCCTGACTCCTTCCAGGCT---GGCAGT---------------
Pongo_abelii|13036                  GACACCCCCAGGGACTTCCCTGACTCCTTCCAGGCT---GGCAGT---------------
Canis_familiaris|25817              GACACACCCAGGGACTTCCCCGATTCCTTCCAGGCC---GGCAGC---------------
Cavia_porcellus|5117                GACACACCCAGGGACTTCCCTGATTCTTTCCAGGAT---GGCAGC---------------
Macropus_eugenii|13471              GATACCCCCAGGGACTTTTCCAACCCTTTCCAGGCGAATGGCAGC---------------
Monodelphis_domestica|13964         GACACCCCCAGGGACTTCTCCAACCCTTTCCAGGCCAATGGCAGC---------------
Bos_taurus|15488                    GACACACCCAGGGACTTCCCCGACTCCTTTCAGGCC---GGCAGC---------------
Equus_caballus|26043                GACACACCCAGGGACTTCCCTGATTCCTTCCAGGCT---GGCAGC---------------
Microcebus_murinus|19253            NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---------------
Pteropus_vampyrus|16901             GACACACCCAGGGACTTCCCTGATTCCTTCCAGGCT---GGCAGC---------------
Tupaia_belangeri|16306              GACACACCCAGGGACTTCCCCGACTCCTTCCAGGAT---GGCGGT---------------
Tursiops_truncatus|892              ------------GACTNNNCGGATTCCTTCCGGGCC---GGCAGC---------------
Sus_scrofa|615                      ------------------------------------------------------------

Gasterosteus_aculeatus|21344        GCGTCTTGTGTTGCAGGAGAGTTTGGA---------GAGCCGGGC---------TTTGAA
Fugu_rubripes|13698                 ------------CCAGGGGAC------ACCGCCAGAGACAAACAG---------GTAGCG
Oryzias_latipes|3155                ------------AGTATGGAGAGTCGAGCCCTGAAGGACTTCTCC---------ATCGAC
Procavia_capensis|8271              ------------CCTGGTCACCTGGGCGTGATCCGGGACTTCTCC---------ATTGAA
Taeniopygia_guttata|18349           ------------TCTGGACACTTGGGCATGATAAGAGACTTCTCC---------ATAGAG
Gallus_gallus|22307                 ------------TCTGGACACTTGGGCGTGATACGAGACTTTTCC---------ATCGAG
Anolis_carolinensis|10760           ------------AATGGAAGCCTAGGAACCATAAGAGACTTCTCC---------ATTGAG
Xenopus_tropicalis|9570             ------------TCTACCGGCCAGAGCGCTATAAAGGATTTCTCC---------ATTGAA
Echinops_telfairi|14051             ------------CCCGACCACCTGGGGGTCATCCGGGACTTCTCC---------ATCGAG
Ornithorhynchus_anatinus|4548       ------------ACGGGGCCCCTGGGGGTGATCCGTGACTTCTCC---------ATTGAG
Sorex_araneus|9711                  ------------CCCGGGCCCCTGGGCGTGATCCGGGACTTCTCC---------ATCGAG
Spermophilus_tridecemlineatus|11682 ------------CCTGGCCATCTAGGGGTGATCCGGGACTTCTCC---------ATCGAA
Dipodomys_ordii|1506                ------------CCTGGCCATCTGGGGGTGATCCGGGATTTCTCC---------ATTGAA
Oryctolagus_cuniculus|19719         ------------CCCGGCCACCTGGGCGTGATCCGGGACTTCTCC---------ATTGAG
Ochotona_princeps|17083             ------------CCTGGCCACCTGGGTGTGATCCGGGACTTCTCC---------ATTGAG
Erinaceus_europaeus|8924            ------------CCAGGCCACCTGGGCGTGATTCGGGACTTCTCC---------ATCGAG
Loxodonta_africana|18101            ------------CCTGGCCATCTGGGGGTGATCCGGGACTTCTCC---------ATTGAA
Otolemur_garnettii|459              ------------CCTGGCCATCTGGGTGTGATCCGGGACTTCTCC---------ATTGAA
Mus_musculus|19138                  ------------CCTGGCCATTTGGGAGTGATCCGGGACTTCTCC---------ATTGAA
Callithrix_jacchus|14927            ------------CCTGGCCATCTGGGGGTGATCCGGGACTTCTCC---------ATTGAA
Rhesus_macaque|19208                ------------CCTGGCCATCTGGGGGTGATCCGGGACTTTTCC---------ATCGAA
Gorilla_gorilla|23782               ------------CCTGGCCATCTGGGGGTGATCCGGGACTTCTCC---------ATCGAA
Pan_troglodytes|17615               ------------CCTGGCCATCTGGGGGTGATCCGGGACTTCTCC---------ATCGAA
Homo_sapiens|37308                  ------------CCTGGCCATCTGGGGGTGATCCGGGACTTCTCC---------ATCGAA
Pongo_abelii|13036                  ------------CCTGGCCATCTGGGGATGATCCGGGACTTCTCC---------ATCGAA
Canis_familiaris|25817              ------------CCCAGCCACCTGGGCGTGATCCGGGACTTCTCC---------ATTGAG
Cavia_porcellus|5117                ------------CCTGGTCATCTGGGTGTGATTCGGGACTTCTCC---------ATTGAG
Macropus_eugenii|13471              ------------CCTGGTCATCTGGGGGTCATCCGTGATTTTTCC---------ATTGAG
Monodelphis_domestica|13964         ------------CCTGGTCATCTCGGGGTCATCCGGGACTTCTCC---------ATTGAG
Bos_taurus|15488                    ------------CCGAGCCACCTGGGCGTGATCCGGGACTTCTCC---------ATCGAA
Equus_caballus|26043                ------------CCTGGCCATCTGGGTGTGATCCGGGACTTCTCC---------ATCGAA
Microcebus_murinus|19253            ------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN---------NNNNNN
Pteropus_vampyrus|16901             ------------CCTGGCCACCTGGGTGTGATCCGGGACTTCTCC---------ATTGAG
Tupaia_belangeri|16306              ------------CCTGGCCATCTGGGGGTGATCCGGGACTTCTCC---------ATCGAA
Tursiops_truncatus|892              ------------TCTTGCCACCTGGGGGGGATCCGGGACTTCTCC---------ATTGAA
Sus_scrofa|615                      ------------------------------------------------------------

Dipodomys_ordii|1506                TCTCTGCTGAGGGAAAACTTGTACCCCAAAGCTAACATCCCCGAC---------------
Sus_scrofa|615                      ------------------------------------------------------------

Tetraodon_nigroviridis|13654        ---------GGACAGGCGAGCCAGCCTCTCGCCTATCTT---------------------
Fugu_rubripes|13698                 ---------CGTCCAGCACCCACA------------------------------------
Oryzias_latipes|3155                ---------AAGCCCACATTCTCTCCCCTCATC---------------------------
Procavia_capensis|8271              ---------AGGCCATCCTTATCTCCATTCGCC---------------------------
Taeniopygia_guttata|18349           ---------AGGCCAGCTCTGTCTCCTTTCGCC---------------------------
Gallus_gallus|22307                 ---------AGGCCAGCCCTCTCTCCTTTTGCC---------------------------
Anolis_carolinensis|10760           ---------AGGCCAACTCTGTCTCCGTTTGTT---------------------------
Xenopus_tropicalis|9570             ---------AGG------------------------------------------------
Echinops_telfairi|14051             ---------CGGCCCTCCCTCTCGCCGTTCGCC---------------------------
Ornithorhynchus_anatinus|4548       ---------AGGCCCGCCTTGTCTCCCTTCCCG---------------------------
Sorex_araneus|9711                  ---------AGACCCTCCTTATCTCCGTTTGCC---------------------------
Spermophilus_tridecemlineatus|11682 ---------AGACCCTCCTTATCTCCATTTGCC---------------------------
Dipodomys_ordii|1506                ---------AGACCTAGCTTATCTCCATTCACC---------------------------
Oryctolagus_cuniculus|19719         ---------AGACCCTCCCTGTCTCCCTTCGCC---------------------------
Ochotona_princeps|17083             ---------AGACCCTCCCTTTCTCCCTTTGCC---------------------------
Erinaceus_europaeus|8924            ---------AAAGCCTCCCTCTCTCCCTTCGCC---------------------------
Loxodonta_africana|18101            ---------AGACCCTCCTTATCTCCATTCTCC---------------------------
Otolemur_garnettii|459              ---------AGACCCTCCCTGTCTCCATTCACC---------------------------
Mus_musculus|19138                  ---------AGACCCTCCTTATCTCCGTTTGCC---------------------------
Callithrix_jacchus|14927            ---------AGACCCTCCTTGTCTCCATTTGCC---------------------------
Rhesus_macaque|19208                ---------AGACCCTCCTTGTCTCCATTCGCC---------------------------
Gorilla_gorilla|23782               ---------AGACCCTCCTTGTCTCCATTCGCC---------------------------
Pan_troglodytes|17615               ---------AGACCCTCCTTGTCTCCATTCGCC---------------------------
Homo_sapiens|37308                  ---------AGACCCTCCTTGTCTCCATTCGCC---------------------------
Pongo_abelii|13036                  ---------AGACCCTCCTTGTCTCCATTCGCC---------------------------
Canis_familiaris|25817              ---------AGACCCTCCCTGTCTCCGTTCGCC---------------------------
Cavia_porcellus|5117                ---------AGACCCTCCTTATCTCCATTTGCC---------------------------
Macropus_eugenii|13471              ---------AGGCCTGCCTTATCGCCCTTTTCC---------------------------
Monodelphis_domestica|13964         ---------AGGCCTGCCTTATCTCCCTTTTCC---------------------------
Bos_taurus|15488                    ---------AGACCCTCCTTATCTCCATTCGCC---------------------------
Equus_caballus|26043                ---------AGGCCCTCCTTATCTCCGTTTGCC---------------------------
Microcebus_murinus|19253            ---------NNNNNNNNNNNNNNNNNNNNNNNN---------------------------
Pteropus_vampyrus|16901             ---------AGACCCTCCTTATCTCCATTCACC---------------------------
Tupaia_belangeri|16306              ---------AGACCCTCCTTATCTCCATTCGCC---------------------------
Tursiops_truncatus|892              ---------AGACCCTCCTTATCTCCGTTCGCC---------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Tetraodon_nigroviridis|13654        ---------------------------------------CCCGGGCTTCTACCCCCCCTC
Fugu_rubripes|13698                 ------------------------------------------------------------
Oryzias_latipes|3155                ---------------------------------------CCGGGCTTCTATCCTTCTCTG
Procavia_capensis|8271              ---------------------------------------CCGGACTTCTTCCCACACCTC
Taeniopygia_guttata|18349           ---------------------------------------CCCAGCTTCTTCCCCCACCTG
Gallus_gallus|22307                 ---------------------------------------CCTCCCTTCTTCCCCCATCTG
Anolis_carolinensis|10760           ---------------------------------------CCCGACCTCTTCCCCCACCTG
Xenopus_tropicalis|9570             ------------------------------------------------------------
Echinops_telfairi|14051             ---------------------------------------CCGGACTTCTTCCCACACCTC
Ornithorhynchus_anatinus|4548       ---------------------------------------CCGGGCTTCTTCCCCCACCTC
Sorex_araneus|9711                  ---------------------------------------CCCGACTTCTTCCCGCACCTC
Spermophilus_tridecemlineatus|11682 ---------------------------------------CCAGACTTCTTCCCACACCTC
Dipodomys_ordii|1506                ---------------------------------------CCGGACTTCTTCCCTCACCTC
Oryctolagus_cuniculus|19719         ---------------------------------------CCGGACTTCTTCCCCCACCTC
Ochotona_princeps|17083             ---------------------------------------CCAGACTTCTTCCCCCATCTC
Erinaceus_europaeus|8924            ---------------------------------------CCTGACTTCTTCCCG---CTC
Loxodonta_africana|18101            ---------------------------------------CCGGACTTCTTCCCACACCTC
Otolemur_garnettii|459              ---------------------------------------CCGGACTTCTTCCCACATCTC
Mus_musculus|19138                  ---------------------------------------CCGGAATTCTTCCCACACCTC
Callithrix_jacchus|14927            ---------------------------------------CCAGACTTCTTCCCACACCTC
Rhesus_macaque|19208                ---------------------------------------CCGGACTTCTTCCCACACCTC
Gorilla_gorilla|23782               ---------------------------------------CCGGACTTCTTTCCACACCTC
Pan_troglodytes|17615               ---------------------------------------CCGGACTTCTTTCCACACCTC
Homo_sapiens|37308                  ---------------------------------------CCGGACTTCTTTCCACACCTC
Pongo_abelii|13036                  ---------------------------------------CCAGACTTCTTCCCACACCTC
Canis_familiaris|25817              ---------------------------------------CCCGACTTCTTCCCACATCTC
Cavia_porcellus|5117                ---------------------------------------CCAGACTTCTTCCCACACCTC
Macropus_eugenii|13471              ---------------------------------------CCAGGCTTCTTTCCGCACCTC
Monodelphis_domestica|13964         ---------------------------------------CCAGGCTTCTTTCCACACCTC
Bos_taurus|15488                    ---------------------------------------CCGGACTTCTTTCCGCACCTC
Equus_caballus|26043                ---------------------------------------CCGGACTTCTTCCCACACCTC
Microcebus_murinus|19253            ---------------------------------------NNNNNNNNNNNNNNNNNNNNN
Pteropus_vampyrus|16901             ---------------------------------------CCAGACTTCTTCCCACACCTC
Tupaia_belangeri|16306              ---------------------------------------CCGGACTTCTTTCCACACCTC
Tursiops_truncatus|892              ---------------------------------------CCGGACTTCTTTCCACACCTC
Sus_scrofa|615                      ------------------------------------------------------------

Gasterosteus_aculeatus|21344        GGC---------------CCCGCACCAGGCCGGGTTTCACCACGC------CTT------
Fugu_rubripes|13698                 ------------------AACGGGAGCTTCGCCACAAAGCCGgct------ccc------
Oryzias_latipes|3155                TGG------------------GCGGAGTTTCCAGCATTTCCCCAGCAGCTCCTCAACCCC
Procavia_capensis|8271              TGG---------------CCAGGGGACTTTGGTGCCTTTGCCCCG------CTG------
Taeniopygia_guttata|18349           TGG---------------AACGGCGACTTTAACTCCTTCTCCCAG------CTG------
Gallus_gallus|22307                 TGG---------------AATGGTGATTTTAGCAGCTTTCCCCAA------CTC------
Anolis_carolinensis|10760           TGG---------------AATGGAGATTTTGGCACCTTCTCCCAA------GTT------
Xenopus_tropicalis|9570             ------------------------------------------------------------
Echinops_telfairi|14051             TGG---------------CCCGGGGACTTCGGTGCCTTGGCCCAG------CTG------
Ornithorhynchus_anatinus|4548       TGG---------------CCTGGAGACTTCGGGGCCTTCGCTCAG------TTG------
Sorex_araneus|9711                  TGG---------------CCGGGGGATTTCGGTGCCTTTGCCCAG------CTG------
Spermophilus_tridecemlineatus|11682 TGG---------------CCGGGAGACTTTGGTGCCTTTGCCCAG------CTG------
Dipodomys_ordii|1506                TGG---------------CCAGGGGACTTTGGTGCCTTTGCCCAG------TTG------
Oryctolagus_cuniculus|19719         TGG---------------CCAGGCGACTTCGGGGCCTTTGCCCAG------CTG------
Ochotona_princeps|17083             TGG---------------CCAGGCGACTTTGGGGCCTTCACCCAG------CTG------
Erinaceus_europaeus|8924            TGG---------------CCGGGGGACTTTGGTGCCTTTTACCAG------CTG------
Loxodonta_africana|18101            TGG---------------CCAGGGGACTTTGGTGCCTTCGCCCAG------CTG------
Otolemur_garnettii|459              TGG---------------CCAGGGGACTTCGGTGCCTTCACCCCA------CTG------
Mus_musculus|19138                  TGG---------------CCAGGTGGCTTTGGTGCCTTTGCTCAG------CTG------
Callithrix_jacchus|14927            TGG---------------CCAGGGGACTTTGGTGCCTTTGCCCAG------CTG------
Rhesus_macaque|19208                TGG---------------CCAGGGGACTTTGGTGCCTTTGCCCAG------CTG------
Gorilla_gorilla|23782               TGG---------------CCGGGGGACTTCGGTGCCTTTGCCCAG------CTG------
Pan_troglodytes|17615               TGG---------------CCAGGGGACTTCGGTGCCTTTGCCCAG------CTG------
Homo_sapiens|37308                  TGG---------------CCAGGGGACTTCGGTGCCTTTGCCCAG------CTG------
Pongo_abelii|13036                  TGG---------------CCAGGGGACTTTGGTGCCTTTGCCCAG------CTG------
Canis_familiaris|25817              TGG---------------CCAGGGGACTTCGGTGCCTTCACCCAG------CTG------
Cavia_porcellus|5117                TGG---------------CCAGGGGACTTCAGTGCCTTTGCCCAG------CTG------
Macropus_eugenii|13471              TGG---------------CCTGGAGAGTTTGGTGCCTTTGCCCAG------CTG------
Monodelphis_domestica|13964         TGG---------------CCTGGAGATTTTGGTGCCTTTGCCCAG------CTG------
Bos_taurus|15488                    TGG---------------CCAGGGGACTTCGGTGCCTTTGCCCAG------CTG------
Equus_caballus|26043                TGG---------------CCAGGGGACTTCGGTGCCTTTGCCCAG------CTG------
Microcebus_murinus|19253            NNN---------------NNNNNNNNNNNNNNNNNCTTCGCCCAG------CTG------
Pteropus_vampyrus|16901             TGG---------------CCAGGGGACTTTGGTGCCTTTGCCCAG------CTG------
Tupaia_belangeri|16306              TGG---------------CCAGGGGACTTCGGTGCCTTTGCTCAG------CTG------
Tursiops_truncatus|892              TGG---------------TCGGGGGACTTCGGTGCCTTTGCCCAG------CTG------
Sus_scrofa|615                      ------------------------------------------------------------

Gasterosteus_aculeatus|21344        ------------------------------------------------------CCCCGC
Fugu_rubripes|13698                 ------------------------------------------------------ccacag
Procavia_capensis|8271              ------------------------------------------------------CCTGAG
Taeniopygia_guttata|18349           ------------------------------------------------------GAGGAG
Gallus_gallus|22307                 ------------------------------------------------------GAAGAG
Anolis_carolinensis|10760           ------------------------------------------------------GAGGAG
Xenopus_tropicalis|9570             ------------------------------------------------------------
Echinops_telfairi|14051             ------------------------------------------------------CCCGAG
Ornithorhynchus_anatinus|4548       ------------------------------------------------------CCGGAA
Sorex_araneus|9711                  ------------------------------------------------------CCCGAG
Spermophilus_tridecemlineatus|11682 ------------------------------------------------------CCTGAG
Dipodomys_ordii|1506                ------------------------------------------------------CCTGAG
Oryctolagus_cuniculus|19719         ------------------------------------------------------CCCGAG
Ochotona_princeps|17083             ------------------------------------------------------CCAGAG
Erinaceus_europaeus|8924            ------------------------------------------------------CCCGAG
Loxodonta_africana|18101            ------------------------------------------------------CCTGAG
Otolemur_garnettii|459              ------------------------------------------------------CCCGAG
Mus_musculus|19138                  ------------------------------------------------------CCTGAG
Callithrix_jacchus|14927            ------------------------------------------------------CCTGAG
Rhesus_macaque|19208                ------------------------------------------------------CCTGAG
Gorilla_gorilla|23782               ------------------------------------------------------CCTGAG
Pan_troglodytes|17615               ------------------------------------------------------CCTGAG
Homo_sapiens|37308                  ------------------------------------------------------CCTGAG
Pongo_abelii|13036                  ------------------------------------------------------CCTGAG
Canis_familiaris|25817              ------------------------------------------------------CCCGAG
Cavia_porcellus|5117                ------------------------------------------------------CCTGAG
Macropus_eugenii|13471              ------------------------------------------------------CCTGAA
Monodelphis_domestica|13964         ------------------------------------------------------CCCGAG
Bos_taurus|15488                    ------------------------------------------------------CCTGAG
Equus_caballus|26043                ------------------------------------------------------CCTCAG
Microcebus_murinus|19253            ------------------------------------------------------CCCGAG
Pteropus_vampyrus|16901             ------------------------------------------------------CCCGAG
Tupaia_belangeri|16306              ------------------------------------------------------CCCGAG
Tursiops_truncatus|892              ------------------------------------------------------CCCGAG
Sus_scrofa|615                      ------------------------------------------------------------

Fugu_rubripes|13698                 cctccccgcCGC------CCCGCTGGAGGGCTCCAGACCCCTCGATTTGGCGGTGAAAAG
Anolis_carolinensis|10760           GCCCAGTTG---------GACAATGGGCCCTTGGATCTGGTCatcagaaaaaggaaaatc
Xenopus_tropicalis|9570             ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Gasterosteus_aculeatus|21344        GGGGCTCATAAAGGAGGAGGC---------------------------------------
Fugu_rubripes|13698                 AGAAGTAAtcaaggaggaaatgaaagaggaggacCCCCTCGGCGTGATCCATGGCAACTT
Anolis_carolinensis|10760           aaggaggaagaaaaagaggag------ccATCTCCGCCCACCCCTTTTCCCAACAGCCTC
Xenopus_tropicalis|9570             ------------------------------------------------------------
Oryctolagus_cuniculus|19719         AAGGAGGAGGAGAAGGAGGAG------------------------TTCCCCCACGACTTC
Sus_scrofa|615                      ------------------------------------------------------------

Procavia_capensis|8271              TTCAAGGATATGTTCCCGGACCTTCCTGGGGGG---------------------------
Taeniopygia_guttata|18349           TTCAAGGACATGTTTGCCAACACCCCAGCAGCT---------------------------
Gallus_gallus|22307                 TTCAAGGACATGTTTACCAACACCCCAGCAGCT---------------------------
Anolis_carolinensis|10760           TTCAAGGATATATTTGGCAGCAACCCAGCTGGC---------------------------
Xenopus_tropicalis|9570             ------GAGGTGTTTGCGGCCCATCCGGGCAGC---------------------------
Echinops_telfairi|14051             TTCAAAGACATGTTCCCCGACCTTCCCCCGGGC---------------------------
Ornithorhynchus_anatinus|4548       TTCAAGGACATATTTGCCGACGGTGCCGGGGGT---------------------------
Sorex_araneus|9711                  TTCAAGGACATGTTCCCCGAGCTGCCCGGGGGG---------------------------
Spermophilus_tridecemlineatus|11682 TTCAAGGACATGTTCCCTGACCTGCCTGGGGGA---------------------------
Dipodomys_ordii|1506                TTCAAGGACATGTTCCCTGACCTGCCCGGGGGG---------------------------
Oryctolagus_cuniculus|19719         TTCAAGGACGTGTTCCCCGACCTGCCCGCGGGG---------------------------
Ochotona_princeps|17083             CTGAAGGATGTATTCCCTGAGCTGCCCGGGGGG---------------------------
Erinaceus_europaeus|8924            TATTGGGACATG---CCTGATCTGCCTGGGGGG---------------------------
Loxodonta_africana|18101            TTCAAGGACATGTTCCCAGACCTTCCTGGGGGG---------------------------
Otolemur_garnettii|459              TTCAAGGACATGTTCCCTGACCTGCCTGGGGGG---------------------------
Mus_musculus|19138                  TTCAAGGACATGTTTCCTGACCTGCCCGGTGGG---------------------------
Callithrix_jacchus|14927            TTCAAGGACATGTTCCCTGACCTGCCTGGGGGG---------------------------
Rhesus_macaque|19208                TTCAAGGACATGTTCCCTGACCTGCCGGGGGGC---------------------------
Gorilla_gorilla|23782               TTCAAGGACATGTTCCCTGACCTGCCGGGGGGG---------------------------
Pan_troglodytes|17615               TTCAAGGACATGTTCCCTGACCTACCGGGGGGG---------------------------
Homo_sapiens|37308                  TTCAAGGACATGTTCCCTGACCTGCCGGGGGGG---------------------------
Pongo_abelii|13036                  TTCAAGGACATGTTCCCTGACCTGCCCGGGGGG---------------------------
Canis_familiaris|25817              TTCAAGGACATGTTCCCCGACCTCCCTGGGGGG---------------------------
Cavia_porcellus|5117                TTCAAGGACATGTTCCCTGACCTGCCTGGGGGG---------------------------
Macropus_eugenii|13471              TTCAAGGATGTGTTTGCTGACCTTCCTGGGGGG---------------------------
Monodelphis_domestica|13964         TTCAAGGACGTGTTCGCCGACCTGCCCGGGGGA---------------------------
Bos_taurus|15488                    TTCAAGGACATGTTCCCGGACCTTCCCGGGGGG---------------------------
Equus_caballus|26043                TTCAAGGACATGTTCCCAGACCTTCCTGGGGGG---------------------------
Microcebus_murinus|19253            TTCAAGGACATGTTCCCTGACCTGCCCGGGGGG---------------------------
Pteropus_vampyrus|16901             TTCAAGGACATGTTCCCGGACCTCCCCGGGGGG---------------------------
Tupaia_belangeri|16306              TTCAAGGACATGTTCCCTGACCTGCCCGGGGGG---------------------------
Tursiops_truncatus|892              TTCAAGGCCATGTTCCCGGACCTTCCCGGGGGG---------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Sus_scrofa|615                      ------------------------------------------------------------

Fugu_rubripes|13698                 CTGAGCTCTGCCTCGCAGCTGGGGACGCTGTTCCCGCCgtggcagctggaggaagagagg
Sus_scrofa|615                      ------------------------------------------------------------

Sus_scrofa|615                      ------------------------------------------------------------

Anolis_carolinensis|10760           GGGAAGCTGCCACGGCACAtgaggacccacacaggagagaagccatatatgTGCAGTATC
Sus_scrofa|615                      ------------------------------------------------------------

Procavia_capensis|8271              TGCGAGGTCCGCTTCACC------------------------------------------
Echinops_telfairi|14051             TGCGAGGTCCGCTTCACC------------------------------------------
Ornithorhynchus_anatinus|4548       TGTGAAGTTCGCTTTACCAGG---------------------------------------
Erinaceus_europaeus|8924            TGTGAGGTCCGCTTTACCAGGCAGGACAAACTCAAGATC---------------------
Pteropus_vampyrus|16901             TGCGAGGTCCGCTTCACC------------------------------------------
Tupaia_belangeri|16306              TGCGAGGTCCGCTTCACC------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Procavia_capensis|8271              ------------------------------------------------------------
Echinops_telfairi|14051             ------------------------------------------------------------
Ornithorhynchus_anatinus|4548       ------------------------------------------------------------
Erinaceus_europaeus|8924            ------------------------------------------------------------
Pteropus_vampyrus|16901             ------------------------------------------------------------
Tupaia_belangeri|16306              ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Procavia_capensis|8271              ------------------------------------------------------------
Echinops_telfairi|14051             ------------------------------------------------------------
Ornithorhynchus_anatinus|4548       ------------------------------------------------------------
Erinaceus_europaeus|8924            ------------------------------------------------------------
Pteropus_vampyrus|16901             ------------------------------------------------------------
Tupaia_belangeri|16306              ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Procavia_capensis|8271              ------------------------------------------------------------
Echinops_telfairi|14051             ------------------------------------------------------------
Ornithorhynchus_anatinus|4548       ------------------------------------------------------------
Erinaceus_europaeus|8924            ------------------------------------------------------------
Pteropus_vampyrus|16901             ------------------------------------------------------------
Tupaia_belangeri|16306              ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Tetraodon_nigroviridis|13654        CCCCGGAGGGGCCGGAAGCCC---------------------------------------
Gasterosteus_aculeatus|21344        CCCCGCAGGGGGAGGAAGCCG---------------------------------------
Fugu_rubripes|13698                 CCCCGGAGGGGACGGAAGCCC---------------------------------------
Oryzias_latipes|3155                CCCCGGCGAGGACGCAAGCCGGCAGCTTGGAGGTCTGCGCCC------------------
Procavia_capensis|8271              ------------------------------------------------------------
Gallus_gallus|22307                 ccgcgccggggccgcAAGCCGGCAGCATGGCGGGCGGCTGGCTTGCTCTTCGGGCCGAGC
Xenopus_tropicalis|9570             CCCCGGAGAGGGAGGAAG------------------------------------------
Echinops_telfairi|14051             ------------------------------------------------------------
Ornithorhynchus_anatinus|4548       ------------------------------------------------------------
Erinaceus_europaeus|8924            ------------------------------------------------------------
Loxodonta_africana|18101            ccccggcgcggccgcAAGCCCGCCGCCTGGAGGGCCGCCAGCCTGCTCTTCGGGCCCGGA
Canis_familiaris|25817              ccccgccgcggccgcAAGCCCGCCGCCTGGAGGGCCGCCAGCCTGCTCTTCGGGCCCCCG
Cavia_porcellus|5117                ccccggcgcggccgcAAGCCCGCCGCCTGGAGGGCTGCCAGCCTGCTCTTTGGGCCCAGC
Pteropus_vampyrus|16901             ------------------------------------------------------------
Tupaia_belangeri|16306              ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Tetraodon_nigroviridis|13654        ------------------------------------------------------------
Gasterosteus_aculeatus|21344        ------------------------------------------------------------
Fugu_rubripes|13698                 ------------------------------------------------------------
Oryzias_latipes|3155                ------------------------------------------------------------
Procavia_capensis|8271              ------------------------------------------------------------
Xenopus_tropicalis|9570             ------------------------------------------------------------
Echinops_telfairi|14051             ------------------------------------------------------------
Ornithorhynchus_anatinus|4548       ------------------------------------------------------------
Erinaceus_europaeus|8924            ------------------------------------------------------------
Pteropus_vampyrus|16901             ------------------------------------------------------------
Tupaia_belangeri|16306              ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Tetraodon_nigroviridis|13654        ------------------------------------------------------------
Gasterosteus_aculeatus|21344        ------------------------------------------------------------
Fugu_rubripes|13698                 ------------------------------------------------------------
Oryzias_latipes|3155                ------------------------------------------------------------
Procavia_capensis|8271              ------------------------------------------------------------
Xenopus_tropicalis|9570             ------------------------------------------------------------
Echinops_telfairi|14051             ------------------------------------------------------------
Ornithorhynchus_anatinus|4548       ------------------------------------------------------------
Oryctolagus_cuniculus|19719         ---------------------GTGTGCCTGCCGGGCCCCAGCCCCGCCAAGCACTTCCTG
Erinaceus_europaeus|8924            ------------------------------------------------------------
Pteropus_vampyrus|16901             ------------------------------------------------------------
Tupaia_belangeri|16306              ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Tetraodon_nigroviridis|13654        ------------------------------------------------------------
Gasterosteus_aculeatus|21344        ------------------------------------------------------------
Fugu_rubripes|13698                 ------------------------------------------------------------
Oryzias_latipes|3155                ------------------------------------------------------------
Procavia_capensis|8271              ------------------------------------------------------------
Xenopus_tropicalis|9570             ------------------------------------------------------------
Echinops_telfairi|14051             ------------------------------------------------------------
Ornithorhynchus_anatinus|4548       ------------------------------------------------------------
Erinaceus_europaeus|8924            ------------------------------------------------------------
Pteropus_vampyrus|16901             ------------------------------------------------------------
Tupaia_belangeri|16306              ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Tetraodon_nigroviridis|13654        ------------------------------------------------------------
Gasterosteus_aculeatus|21344        ------------------------------------------------------------
Fugu_rubripes|13698                 ------------------------------------------------------------
Oryzias_latipes|3155                ------------------------------------------------------------
Procavia_capensis|8271              ------------------------------------------------------------
Xenopus_tropicalis|9570             ------------------------------------------------------------
Echinops_telfairi|14051             ------------------------------------------------------------
Ornithorhynchus_anatinus|4548       ------------------------------------------------------------
Erinaceus_europaeus|8924            ------------------------------------------------------------
Pteropus_vampyrus|16901             ------------------------------------------------------------
Tupaia_belangeri|16306              ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Tetraodon_nigroviridis|13654        ------------------------------------------------------------
Gasterosteus_aculeatus|21344        ------------------------------------------------------------
Fugu_rubripes|13698                 ------------------------------------------------------------
Oryzias_latipes|3155                ------------------------------------------------------------
Procavia_capensis|8271              ------------------------------------------------------------
Xenopus_tropicalis|9570             ------------------------------------------------------------
Echinops_telfairi|14051             ------------------------------------------------------------
Ornithorhynchus_anatinus|4548       ------------------------------------------------------------
Sorex_araneus|9711                  TTCGCGCTGGCCGAGAACGTG---GCCGCCGCGCGGCCCTACTTC---------------
Erinaceus_europaeus|8924            ------------------------------------------------------------
Bos_taurus|15488                    ------------------------------------------------------------
Microcebus_murinus|19253            GCC---------------------GAGGCGCCGCGGCCCTACTTCCCGCTG---GACCGT
Pteropus_vampyrus|16901             ------------------------------------------------------------
Tupaia_belangeri|16306              ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Tetraodon_nigroviridis|13654        ------------------------------------------------------------
Gasterosteus_aculeatus|21344        ------------------------------------------------------------
Fugu_rubripes|13698                 ------------------------------------------------------------
Oryzias_latipes|3155                ------------------------------------------------------------
Procavia_capensis|8271              ------------------------------------------------------------
Xenopus_tropicalis|9570             ------------------------------------------------------------
Echinops_telfairi|14051             ------------------------------------------------------------
Ornithorhynchus_anatinus|4548       ------------------------------------------------------------
Sorex_araneus|9711                  ------------------------------------------------------------
Erinaceus_europaeus|8924            ------------------------------------------------------------
Bos_taurus|15488                    ------------------------------------------------------------
Microcebus_murinus|19253            ACCGCGGCTGGCCTC------------------------CTCGCGCTCCACGCCTCCATG
Pteropus_vampyrus|16901             ------------------------------------------------------------
Tupaia_belangeri|16306              ------------------------------------------------------------
Sus_scrofa|615                      ------------------------------------------------------------

Tetraodon_nigroviridis|13654        ------------------
Gasterosteus_aculeatus|21344        ------------------
Fugu_rubripes|13698                 ------------------
Oryzias_latipes|3155                ------------------
Procavia_capensis|8271              ------------------
Taeniopygia_guttata|18349           TCAGAGTCCAGCAACTAA
Gallus_gallus|22307                 TCGGAGGCCACCAACTAG
Anolis_carolinensis|10760           ACAGAAGCTACCAACTAA
Xenopus_tropicalis|9570             ------------------
Echinops_telfairi|14051             ------------------
Ornithorhynchus_anatinus|4548       ------------------
Sorex_araneus|9711                  ------------------
Spermophilus_tridecemlineatus|11682 TCAGAAGCCAACAACTAG
Dipodomys_ordii|1506                TCTGAAGCCAACAACTAG
Oryctolagus_cuniculus|19719         TCTGAAGCCAACAACTAG
Ochotona_princeps|17083             TCCGAAGCCAACAACTAG
Erinaceus_europaeus|8924            ------------------
Loxodonta_africana|18101            TCTGAAGCCAACAAC---
Otolemur_garnettii|459              TCTGAAGCCAACAACTAA
Mus_musculus|19138                  TCTGAAGCCAACAACTAG
Callithrix_jacchus|14927            TCGGAAGCCAACAACTAG
Rhesus_macaque|19208                TCCGAAGCCAACAACTAG
Gorilla_gorilla|23782               TCCGAAGCCAACAACTAG
Pan_troglodytes|17615               TCCGAAGCCAACAACTAG
Homo_sapiens|37308                  TCCGAAGCCAACAACTAG
Pongo_abelii|13036                  TCCGAAGCCAACAACTAG
Canis_familiaris|25817              TCGGAGGCCGACAAC---
Cavia_porcellus|5117                TCTGATGCCAACAAC---
Macropus_eugenii|13471              TCTGAAGCAAACAATTAG
Monodelphis_domestica|13964         TCCGAGGCGAACAAC---
Bos_taurus|15488                    ------------------
Equus_caballus|26043                TCTGAAGCCAACAACTAG
Microcebus_murinus|19253            TCTGAAGCCAACAACTAG
Pteropus_vampyrus|16901             ------------------
Tupaia_belangeri|16306              ------------------
Tursiops_truncatus|892              TCTGAAGCCAACAACTAG
Sus_scrofa|615                      ------------------

multiple sequence alignment in CLUSTALW format

Procavia_capensis|7756              -MANGI---------------------------------------YKSSIHI--------
Xenopus_tropicalis|9213             ------------------------LNAQRQDGLLCDVILIVQEQEYRTHRSVLAACSQYF
Spermophilus_tridecemlineatus|10483 ------------------------------------------------------------

Procavia_capensis|7756              ---------------------------PKRS----EVLYTAMVTIIAEKL--LLDADWMV
Spermophilus_tridecemlineatus|10483 -----------------------DFVQPEALAILF---YC---TLIACNVKHILNAARML
                                                               *.         *    *: : ::  :*.*  ::

Tetraodon_nigroviridis|12865        EIPCIISVCLEIMD----------------------------------------------
Gasterosteus_aculeatus|21363        EIPCIINVCLEIMDSGGGGG----------------------------------------
Oryzias_latipes|6763                EIPCIINVCLEIMDSGGSRK------DEQEKEEDNASE----------------------
Procavia_capensis|7756              NLHEYLXXXXXXXXXXXXXX------XXXXXXXXDDDDEEEEEEEEEEEEEED-------
Taeniopygia_guttata|399             EIQSIINVCLEIMEPDREAE------EEDDKEDDDDDEDEDEDEEEEEEEE---------
Gallus_gallus|6284                  EIQCIINVCLEIMEPGRGEE------EEDDKEDEDDDEDEDEDEEEEEEEEEE-------
Anolis_carolinensis|17430           EIPCVINVCMEIMDPVGDEE------EEEEKEEEEEEEEEEEEEEEEEDEERE-------
Xenopus_tropicalis|9213             EIQCIINVCLEILETPRDGE------EDNEKEEDEDDDDDDDEEE---------------
Echinops_telfairi|11078             EIPCVVNVCLEIMAPGGAGGG-----GAEDKEDEEEEEDEEEEEEEEEEDD---------
Ornithorhynchus_anatinus|23188      EIQCIVNVCLEIMEPGG-------------------------------------------
Spermophilus_tridecemlineatus|10483 EIQCIVNVCLEIMEPGGEGG------EEDDKEDDDDDEDDDDEEDEEEEEEEE-------
Dipodomys_ordii|1422                EIQCIVNVCLEIIEPGGDGG------EEDDKEDDDDDEDDDDEEDEEEEEEEE-------
Oryctolagus_cuniculus|19785         EIQCIVNVCLEIMEPGGEG-----------------------------------------
Erinaceus_europaeus|7334            EIQCIVNVCLEIMEPGGDGG------EEDDKEDDDDDEEDEDEED-EEEEEEE------E
Loxodonta_africana|15750            EIQCVVNVCMEIMEPGGDGG------EEDDKEDDDDDEDDEEEEEEEEEEEEE-------
Otolemur_garnettii|398              EIPCIVNVCLEIMEPGGDGA------EEDDKEDDDDDDDDDEEEDEEEEEEEE-------
Mus_musculus|50613                  EIQCIVNVCLEIMEPGGSVG------EEDDKEEEDEDDDDEDEDDEEEEEEEE-------
Gorilla_gorilla|18622               EIQCIVNVCLEIMEPGGDGG------EEDDKEDDDDDEDDDDEEDEEEEEEEE-------
Pan_troglodytes|2700                EIQCIVNVCLEIMEPGGDGG------EEDDKEDDDDDEDDDDEEDEEEEEEEE-------
Homo_sapiens|7506                   EIQCIVNVCLEIMEPGGDGG------EEDDKEDDDDDEDDDDEEDEEEEEEEE-------
Macropus_eugenii|12252              EIQCIVNVCLEIMEPGGDGE------EEDDKEDDDDEDEEDEEEDEEEEDEDD-------
Monodelphis_domestica|1377          EIQCIVNVCLEIMEPGGDGE------EEDDKEDDDDEDEEDEEEDEEEEDEED-------
Bos_taurus|5031                     EIQCIVNVCLEIMEPGG------------DKEDDDDDEEDDDEDEEEEEEEEE-------
Equus_caballus|17967                EIQCIVNVCLEIMEPGGDGG------EEDDKEDDDDDEDDDDEEDEEEEEEEE-------
Microcebus_murinus|16315            EIQCIVNVCLEIMEPGGDGG------EEDDKEDDDDDEDDDDEEDEEEEEEEE-------
Pteropus_vampyrus|15924             EIQCIVNVCLEIMEPGGDGG------EEDDKEDDDDDEDDDDEEDEEEEEEEE-------
Tupaia_belangeri|14189              EIQCIVNVCLEIMEPGGDGG------EEDDKEDDDDDEEDDDEEDEEEEEEEE-------
Tursiops_truncatus|848              EIQCIVNVCLEIMEPGGDGE------EEDDKED---------------------------
Sus_scrofa|4852                     EIQCIVNVCLEIME----------------------------------------------
                                    ::   :                                                      

Fugu_rubripes|25894                 EEDNVSERSLQSSESRGGRTPPGTEGSPPPSTSAYERQLELSSQS--------QS-----
Oryzias_latipes|6763                ----------RSLESKGEPMHLGAEDSPPPSTSTLHQRREPSQAQSPGGMRGKQVQE---
Xenopus_tropicalis|9213             ------TKDFMNEENQTDIQESSCHQSPPTSEQL--EGHYESQKDLPTHFSSMTN-----
Tursiops_truncatus|848              --------------------------------------------DXXDSFRA-GS-----
Sus_scrofa|4852                     ------------------------------------------------------------

Tetraodon_nigroviridis|12865        ----QTVVSCVAEHGESDLERLLHRIAPPGRPVPPNVHA----GQASQPLAYL-------
Fugu_rubripes|25894                 ----PGD--TARDKQ---VASWECAEIPQAASGPPS-------RPAPT------------
Oryzias_latipes|6763                ----SMESRALKDFS---IDSLLQEGLYPRMATVDR-------KPTFSPLI---------
Procavia_capensis|7756              ----PGHLGVIRDFS---IESLLRENLYPKASIPDR-------RPSLSPFA---------
Taeniopygia_guttata|399             ----SGHLGMIRDFS---IESLLSENLYPKANIPER-------RPALSPFA---------
Gallus_gallus|6284                  ----SGHLGVIRDFS---IESLLRENLYPKANIPER-------RPALSPFA---------
Anolis_carolinensis|17430           ----NGSLGTIRDFS---IESLLRENLYPKTGLPER-------RPTLSPFV---------
Xenopus_tropicalis|9213             ----STGQSAIKDFS---IESLLSENLYPKSNMAER-------R----------------
Echinops_telfairi|11078             ----PDHLGVIRDFS---IESLLRENLYPKASIPDG-------RPSLSPFA---------
Ornithorhynchus_anatinus|23188      ----TGPLGVIRDFS---IESLLRENLYPKATVPDR-------RPALSPFP---------
Sorex_araneus|8633                  ----PGPLGVIRDFS---IESLLRENLYPKANLPDR-------RPSLSPFA---------
Spermophilus_tridecemlineatus|10483 ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------RPSLSPFA---------
Dipodomys_ordii|1422                ----PGHLGVIRDFS---IESLLRENLYPKANIPD--------RPSLSPFT---------
Oryctolagus_cuniculus|19785         ----PGHLGVIRDFS---IESLLRENLYPKASIPDR-------RPSLSPFA---------
Ochotona_princeps|14890             ----PGHLGVIRDFS---IESLLRENLYPKAGIPDR-------RPSLSPFA---------
Erinaceus_europaeus|7334            ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------KASLSPFA---------
Loxodonta_africana|15750            ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------RPSLSPFS---------
Otolemur_garnettii|398              ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------RPSLSPFT---------
Mus_musculus|50613                  ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------RPSLSPFA---------
Callithrix_jacchus|7599             ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------RPSLSPFA---------
Rhesus_macaque|575                  ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------RPSLSPFA---------
Gorilla_gorilla|18622               ----PGHLGVIRDFS---IESLLRENLYPKANIPDS-------RPSLSPFA---------
Pan_troglodytes|2700                ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------RPSLSPFA---------
Homo_sapiens|7506                   ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------RPSLSPFA---------
Pongo_abelii|6568                   ----PGHLGMIRDFS---IESLLRENLYPKANIPDR-------RPSLSPFA---------
Canis_familiaris|15362              ----PSHLGVIRDFS---IESLLRENLYPKANIADR-------RPSLSPFA---------
Cavia_porcellus|3981                ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------RPSLSPFA---------
Macropus_eugenii|12252              ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------RPALSPFS---------
Monodelphis_domestica|1377          ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------RPALSPFS---------
Bos_taurus|5031                     ----PSHLGVIRDFS---IESLLRENLYPKASLPDR-------RPSLSPFA---------
Equus_caballus|17967                ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------RPSLSPFA---------
Microcebus_murinus|16315            ----XXXXXXXXXXX---XXXXXXXXXXXXXXXXXX-------XXXXXXXX---------
Pteropus_vampyrus|15924             ----PGHLGVIRDFS---IESLLRENLYPKANIPDR-------RPSLSPFT---------
Tupaia_belangeri|14189              ----PGHLGVIRDFS---IESLLRENLYPKASIPDR-------RPSLSPFA---------
Tursiops_truncatus|848              ----SCHLGGIRDFS---IESLLRENLYPKANIPDR-------RPSLSPFA---------
Sus_scrofa|4852                     ------------------------------------------------------------

Tetraodon_nigroviridis|12865        -------------PGLLPPLHVALGLPGVPQAPSG--PSSCPASTNGRSPQSRAPHNLPA
Gasterosteus_aculeatus|21363        VPDVPQAVPESRPPPASPHGG-----PAPGRVSPR--L--------------------PR
Fugu_rubripes|25894                 --------------------------NGSFATKPA--P--------------------PQ
Oryzias_latipes|6763                -------------PGFYPSLW------AEFPAFPQQLLNPTHPHAGVSPQVRLPPPFPPS
Procavia_capensis|7756              -------------PDFFPHLW-----PGDFGAFAP--L--------------------PE
Taeniopygia_guttata|399             -------------PSFFPHLW-----NGDFNSFSQ--L--------------------EE
Gallus_gallus|6284                  -------------PPFFPHLW-----NGDFSSFPQ--L--------------------EE
Anolis_carolinensis|17430           -------------PDLFPHLW-----NGDFGTFSQ--V--------------------EE
Xenopus_tropicalis|9213             ------------------------------------------------------------
Echinops_telfairi|11078             -------------PDFFPHLW-----PGDFGALAQ--L--------------------PE
Ornithorhynchus_anatinus|23188      -------------PGFFPHLW-----PGDFGAFAQ--L--------------------PE
Sorex_araneus|8633                  -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Spermophilus_tridecemlineatus|10483 -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Dipodomys_ordii|1422                -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Oryctolagus_cuniculus|19785         -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Ochotona_princeps|14890             -------------PDFFPHLW-----PGDFGAFTQ--L--------------------PE
Erinaceus_europaeus|7334            -------------PDFFP-LW-----PGDFGAFYQ--L--------------------PE
Loxodonta_africana|15750            -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Otolemur_garnettii|398              -------------PDFFPHLW-----PGDFGAFTP--L--------------------PE
Mus_musculus|50613                  -------------PEFFPHLW-----PGGFGAFAQ--L--------------------PE
Callithrix_jacchus|7599             -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Rhesus_macaque|575                  -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Gorilla_gorilla|18622               -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Pan_troglodytes|2700                -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Homo_sapiens|7506                   -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Pongo_abelii|6568                   -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Canis_familiaris|15362              -------------PDFFPHLW-----PGDFGAFTQ--L--------------------PE
Cavia_porcellus|3981                -------------PDFFPHLW-----PGDFSAFAQ--L--------------------PE
Macropus_eugenii|12252              -------------PGFFPHLW-----PGEFGAFAQ--L--------------------PE
Monodelphis_domestica|1377          -------------PGFFPHLW-----PGDFGAFAQ--L--------------------PE
Bos_taurus|5031                     -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Equus_caballus|17967                -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PQ
Microcebus_murinus|16315            -------------XXXXXXXX-----XXXXXXFAQ--L--------------------PE
Pteropus_vampyrus|15924             -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Tupaia_belangeri|14189              -------------PDFFPHLW-----PGDFGAFAQ--L--------------------PE
Tursiops_truncatus|848              -------------PDFFPHLW-----SGDFGAFAQ--L--------------------PE
Sus_scrofa|4852                     ------------------------------------------------------------

Gasterosteus_aculeatus|21363        LG----PAGRLEAPRSGREKGAHKGGG---------------EFVSSGLGGAMNTGSGPS
Taeniopygia_guttata|399             PQV---DNGPLDLVIKKRKIKEEEEKE--DLPPPPFPNDFFKDMFANTPAA---------
Gallus_gallus|6284                  PQI---DNGPLDLVIKKRKIKEEEEKE--ELPPPPFPNDFFKDMFTNTPAA---------
Anolis_carolinensis|17430           AQL---DNGPLDLVIRKRKIKEEEKEE--PSPPTPFPNSLFKDIFGSNPAG---------
Xenopus_tropicalis|9213             ------------------------------------------EVFAAHPGS---------
Ornithorhynchus_anatinus|23188      QPL---DSGPLDLVIRKRKIKEEEKEEI---PPAPFPNDFFKDIFADGAGG---------
Oryctolagus_cuniculus|19785         QPMEPLDNGPLDLVIGSRKIKEEEKEE--------FPHDFFKDVFPDLPAG---------
Erinaceus_europaeus|7334            QPL---DS-PLXXXXQSLEVEWEAKAGLA-RRQPPFILAFYWDM-PDLPGG---------
Sus_scrofa|4852                     ------------------------------------------------------------

Sus_scrofa|4852                     ------------------------------------------------------------

Procavia_capensis|7756              GKLPRHMRTHTGEKPYMCSICEVRFT----------------------------------
Echinops_telfairi|11078             GKLPRHMRTHTGEKPYMCNICEVRFT----------------------------------
Ornithorhynchus_anatinus|23188      GKLPRHMRTHTGEKPYMCNICEVRFTR---------------------------------
Erinaceus_europaeus|7334            GKLPRHMRTHTGEKPYMCTICEVRFTRQDKLKI---------------------------
Pteropus_vampyrus|15924             GKLPRHMRTHTGEKPYMCNICEVRFT----------------------------------
Tupaia_belangeri|14189              GKLPRHMRTHTGEKPYMCNICEVRFT----------------------------------
Sus_scrofa|4852                     ------------------------------------------------------------

Tetraodon_nigroviridis|12865        NHLRIHTGVRPYQCEHCYKSFTRSDHLHRHIKRQSCRVSRPRRGRKP-------------
Gasterosteus_aculeatus|21363        NHLRIHTGVRPYQCEHCYKSFTRSDHLHRHIKRQSCRISRPRRGRKP-------------
Fugu_rubripes|25894                 NHLRIHTGVRPYQCEHCYKSFTRSDHLHRHIKRQSCRVSRPRRGRKP-------------
Procavia_capensis|7756              ------------------------------------------------------------
Xenopus_tropicalis|9213             NHMRIHTGVRPYQCEFCYKSFTRSDHLHRHIKRQSCRMSRPRRGRK--------------
Echinops_telfairi|11078             ------------------------------------------------------------
Ornithorhynchus_anatinus|23188      ------------------------------------------------------------
Erinaceus_europaeus|7334            ------------------------------------------------------------
Pteropus_vampyrus|15924             ------------------------------------------------------------
Tupaia_belangeri|14189              ------------------------------------------------------------
Sus_scrofa|4852                     ------------------------------------------------------------

Tetraodon_nigroviridis|12865        ------------------------------------------------------------
Gasterosteus_aculeatus|21363        ------------------------------------------------------------
Fugu_rubripes|25894                 ------------------------------------------------------------
Oryzias_latipes|6763                ------------------------------------------------------------
Procavia_capensis|7756              ------------------------------------------------------------
Xenopus_tropicalis|9213             ------------------------------------------------------------
Echinops_telfairi|11078             ------------------------------------------------------------
Ornithorhynchus_anatinus|23188      ------------------------------------------------------------
Erinaceus_europaeus|7334            ------------------------------------------------------------
Pteropus_vampyrus|15924             ------------------------------------------------------------
Tupaia_belangeri|14189              ------------------------------------------------------------
Sus_scrofa|4852                     ------------------------------------------------------------

Tetraodon_nigroviridis|12865        ------------------------------------------------------------
Gasterosteus_aculeatus|21363        ------------------------------------------------------------
Fugu_rubripes|25894                 ------------------------------------------------------------
Oryzias_latipes|6763                ------------------------------------------------------------
Procavia_capensis|7756              ------------------------------------------------------------
Xenopus_tropicalis|9213             ------------------------------------------------------------
Echinops_telfairi|11078             ------------------------------------------------------------
Ornithorhynchus_anatinus|23188      ------------------------------------------------------------
Sorex_araneus|8633                  MKLFGHAQLEADAHAGGLLAFALAENV-AAARPYF-------------------------
Erinaceus_europaeus|7334            ------------------------------------------------------------
Bos_taurus|5031                     MKLFGRAQLEAERNAGGLLA----------------------------------------
Microcebus_murinus|16315            MKLFRQL---AEQNGGLAFAA-------EAPRPYFPL-DRTAAGL--------LALHASM
Pteropus_vampyrus|15924             ------------------------------------------------------------
Tupaia_belangeri|14189              ------------------------------------------------------------
Sus_scrofa|4852                     ------------------------------------------------------------

Tetraodon_nigroviridis|12865        -----
Gasterosteus_aculeatus|21363        -----
Fugu_rubripes|25894                 -----
Oryzias_latipes|6763                -----
Procavia_capensis|7756              -----
Taeniopygia_guttata|399             SESSN
Gallus_gallus|6284                  SEATN
Anolis_carolinensis|17430           TEATN
Xenopus_tropicalis|9213             -----
Echinops_telfairi|11078             -----
Ornithorhynchus_anatinus|23188      -----
Sorex_araneus|8633                  -----
Spermophilus_tridecemlineatus|10483 SEANN
Dipodomys_ordii|1422                SEANN
Oryctolagus_cuniculus|19785         SEANN
Ochotona_princeps|14890             SEANN
Erinaceus_europaeus|7334            -----
Loxodonta_africana|15750            SEANN
Otolemur_garnettii|398              SEANN
Mus_musculus|50613                  SEANN
Callithrix_jacchus|7599             SEANN
Rhesus_macaque|575                  SEANN
Gorilla_gorilla|18622               SEANN
Pan_troglodytes|2700                SEANN
Homo_sapiens|7506                   SEANN
Pongo_abelii|6568                   SEANN
Canis_familiaris|15362              SEADN
Cavia_porcellus|3981                SDANN
Macropus_eugenii|12252              SEANN
Monodelphis_domestica|1377          SEANN
Bos_taurus|5031                     -----
Equus_caballus|17967                SEANN
Microcebus_murinus|16315            SEANN
Pteropus_vampyrus|15924             -----
Tupaia_belangeri|14189              -----
Tursiops_truncatus|848              SEANN
Sus_scrofa|4852                     -----