Orthologs Set ID: EOG4006CN

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Apis mellifera 28034 23, 149, 348, 843
Bombyx mori 4217 23, 149, 462, 843
Bos taurus 19279 23, 142, 276, 435, 565, 877
Branchiostoma floridae 37129 23, 149, 231, 348, 435, 565, 690, 794, 877
Caenorhabditis elegans 23852 149, 435, 794
Callithrix jacchus 47030 23, 142, 276, 435, 565, 877
Canis familiaris 24648 23, 142, 276, 435, 565, 877
Cavia porcellus 8813 276, 435, 565, 877
Choloepus hoffmanni 6178 23, 142, 276, 435, 565, 787, 877
Culex quinquefasciatus 1120 23, 149, 316, 712
Danio rerio 13670 23, 142, 276, 435, 565, 877
Daphnia pulex 18371 20, 149, 348, 536, 712
Daphnia pulex 29404 149, 348, 536, 748
Daphnia pulex 7999 149, 348, 536, 712
Daphnia pulex 880 149, 348, 536, 694
Dasypus novemcinctus 7674 23, 142, 276, 435, 474, 565, 877
Drosophila melanogaster 2118 23, 462, 712
Drosophila willistoni 1842 23, 462, 712
Erinaceus europaeus 7528 23, 142, 276, 435, 565, 877
Felis catus 36235 142, 276, 435, 565, 877
Fugu rubripes 34544 23, 142, 276, 435, 565, 877
Gallus gallus 19545 142, 276, 435, 565, 877
Gasterosteus aculeatus 3428 23, 142, 276, 435, 565, 877
Gorilla gorilla 9633 23, 142, 276, 435, 565, 877
Homo sapiens 4674 23, 142, 276, 435, 565, 877
Ixodes scapularis 19103 348, 435, 565, 690
Linepithema humile 1593 23, 149, 348, 843, 1007, 1167
Loxodonta africana 7525 23, 142, 276, 435, 565, 877
Macropus eugenii 12811 23, 142, 276, 416, 435, 565, 877
Microcebus murinus 15795 23, 142, 276, 290, 435, 565, 877, 976
Monodelphis domestica 7689 142, 276, 435, 565, 877
Mus musculus 27722 23, 142, 276, 435, 565, 877
Nasonia vitripennis 5254 23, 149, 348, 843
Nematostella vectensis 23374 149, 231, 348, 565, 690, 794, 877
Ochotona princeps 17716 23, 142, 145, 276, 435, 565
Oryctolagus cuniculus 5499 23, 142, 276, 435, 565, 877
Oryzias latipes 7913 23, 142, 276, 435, 565, 877
Otolemur garnettii 5970 23, 142, 276, 435, 565, 852, 877
Pan troglodytes 1777 23, 142, 276, 435, 565, 877
Pediculus humanus 10992 23, 149, 564
Pogonomyrmex barbatus 6421 23, 149, 348, 843
Pongo abelii 1688 23, 142, 276, 435, 565, 877
Procavia capensis 3973 23, 142, 276, 435, 565, 597, 618, 651, 678, 710, 877
Pteropus vampyrus 8099 23, 142, 276, 435, 565, 877
Rattus norvegicus 19946 23, 142, 276, 435, 565, 877
Rhesus macaque 1960 23, 142, 276, 435, 565, 877
Sorex araneus 6667 23, 142, 276, 435, 565, 877
Spermophilus tridecemlineatus 15436 23, 142, 276, 435, 565
Sus scrofa 14045 23, 142, 276, 435, 565, 877
Taeniopygia guttata 13944 23, 142, 276, 435, 565, 877
Tarsius syrichta 8840 23, 42, 49, 142, 276, 435, 565, 877
Tetraodon nigroviridis 6196 23, 142, 276, 435, 565, 877
Tribolium castaneum 5593 23, 149, 289, 843
Tupaia belangeri 1387 23, 142, 276, 435, 565, 877, 943, 957
Tursiops truncatus 12390 23, 142, 276, 435, 565, 877
Vicugna pacos 4213 23, 142, 276, 435, 565, 877
Xenopus tropicalis 24068 142, 276, 435, 565, 877

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Apis mellifera 28034 GB18567-PA apiMel3
Bombyx mori 4217 BGIBMGA006014-TA v2.0
Bos taurus 19279 ENSBTAT00000044137 513231 ENSBTAG00000000504 GTF2B bosTau4
Branchiostoma floridae 37129 estExt_fgenesh2_pg.C_30015 braFlo1
Caenorhabditis elegans 23852 W03F9.5.1, NM_070745 178544 WBGene00006648 ttb-1 ce6
Callithrix jacchus 47030 ENSCJAT00000014663 100391836 ENSCJAG00000007469 GTF2B calJac3
Canis familiaris 24648 ENSCAFT00000032192 479960 ENSCAFG00000020209 GTF2B canFam2
Cavia porcellus 8813 ENSCPOT00000014170 100732994 ENSCPOG00000014028 GTF2B cavPor3
Choloepus hoffmanni 6178 ENSCHOT00000006178 ENSCHOG00000006162 GTF2B choHof1
Culex quinquefasciatus 1120 CPIJ006843-RA 6038616 CPIJ006843 CpipJ1
Danio rerio 13670 ENSDART00000023346, NM_199697 324823 ENSDARG00000103578 gtf2b danRer6
Daphnia pulex 18371 NCBI_GNO_7500050 1.1
Daphnia pulex 29404 e_gw1.22.61.1 1.1
Daphnia pulex 880 BDE_e_gw1.22.57.1 1.1
Daphnia pulex 7999 PASA_GEN_0200128 1.1
Dasypus novemcinctus 7674 ENSDNOT00000025042 101433529 ENSDNOG00000024361 GTF2B dasNov2
Drosophila melanogaster 2118 FBtr0080025, NM_057540 34430 FBgn0004915 TfIIB dm3
Drosophila willistoni 1842 FBtr0245525 6641853 FBgn0216879 GK14874 r1.3
Erinaceus europaeus 7528 ENSEEUT00000006756 103125865 ENSEEUG00000006779 GTF2B eriEur1
Felis catus 36235 ENSFCAT00000005963 101081913 ENSFCAG00000005961 GTF2B felCat3
Fugu rubripes 34544 ENSTRUT00000005179 101077295 ENSTRUG00000002246 gtf2b fr2
Gallus gallus 19545 ENSGALT00000010015 424518 ENSGALG00000006205 GTF2B galGal3
Gasterosteus aculeatus 3428 ENSGACT00000020759 ENSGACG00000015696 gtf2b gasAcu1
Gorilla gorilla 9633 ENSGGOT00000026761 101127662 ENSGGOG00000015017 GTF2B gorGor3
Homo sapiens 4674 ENST00000370500, NM_001514 2959 ENSG00000137947 GTF2B hg19,GRCh37
Ixodes scapularis 19103 ISCW023433-RA ISCW023433 IscaW1
Linepithema humile 1593 LH14538-RA 1.2
Loxodonta africana 7525 ENSLAFT00000027172 100676323 ENSLAFG00000006102 GTF2B loxAfr3
Macropus eugenii 12811 ENSMEUT00000012811 ENSMEUG00000012776 GTF2B Meug_1.0
Microcebus murinus 15795 ENSMICT00000014701 ENSMICG00000014701 GTF2B micMur1
Monodelphis domestica 7689 ENSMODT00000015831 100016253 ENSMODG00000012414 GTF2B monDom5
Mus musculus 27722 ENSMUST00000029938 229906 ENSMUSG00000028271 Gtf2b mm9
Nasonia vitripennis 5254 NV12842-RA 1.2
Nematostella vectensis 23374 e_gw.152.51.1 Nemve1
Ochotona princeps 17716 ENSOPRT00000009923 101528042 ENSOPRG00000009935 GTF2B OchPri2.0
Oryctolagus cuniculus 5499 ENSOCUT00000000139 ENSOCUG00000000139 GTF2B oryCun2.0
Oryzias latipes 7913 ENSORLT00000006168 101158724 ENSORLG00000004899 gtf2b oryLat2
Otolemur garnettii 5970 ENSOGAT00000005755 100958137 ENSOGAG00000005753 GTF2B otoGar1
Pan troglodytes 1777 ENSPTRT00000001764, NM_001514 743356 ENSPTRG00000000932 GTF2B panTro2
Pediculus humanus 10992 PHUM626400-RA 8239246 PHUM626400 PhumU1
Pogonomyrmex barbatus 6421 PB22589-RA 1.2
Pongo abelii 1688 ENSPPYT00000001410 100173138 ENSPPYG00000001178 GTF2B ponAbe2
Procavia capensis 3973 ENSPCAT00000003467 ENSPCAG00000003473 GTF2B proCap1
Pteropus vampyrus 8099 ENSPVAT00000007549 ENSPVAG00000007549 GTF2B pteVam1
Rattus norvegicus 19946 ENSRNOT00000015032 81673 ENSRNOG00000011135 Gtf2b rn4
Rhesus macaque 1960 ENSMMUT00000003964 694770 ENSMMUG00000002794 rheMac2
Sorex araneus 6667 ENSSART00000006519 ENSSARG00000006537 GTF2B sorAra1
Spermophilus tridecemlineatus 15436 ENSSTOT00000015437 101958444 ENSSTOG00000015439 Gtf2b speTri1
Sus scrofa 14045 ENSSSCT00000007587 100155974 ENSSSCG00000006926 GTF2B susScr2
Taeniopygia guttata 13944 ENSTGUT00000006497 100220653 ENSTGUG00000006258 GTF2B taeGut1
Tarsius syrichta 8840 ENSTSYT00000010347 ENSTSYG00000010351 GTF2B tarSyr1
Tetraodon nigroviridis 6196 ENSTNIT00000009935 ENSTNIG00000006960 gtf2b tetNig2
Tribolium castaneum 5593 GLEAN_10900 Tcas3.0
Tupaia belangeri 1387 ENSTBET00000001388 ENSTBEG00000001398 GTF2B tupBel1
Tursiops truncatus 12390 ENSTTRT00000011900 101324154 ENSTTRG00000011903 GTF2B turTru1
Vicugna pacos 4213 ENSVPAT00000005311 ENSVPAG00000005312 GTF2B vicPac1
Xenopus tropicalis 24068 ENSXETT00000013433 549031 ENSXETG00000006091 gtf2b xenTro2

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Apis mellifera 8565 GB18567 apiMel3
Bombyx mori 6014 BGIBMGA006014-PA v2.0
Bos taurus 21691 ENSBTAP00000041650 513231 ENSBTAG00000000504 GTF2B bosTau4
Branchiostoma floridae 11781 estExt_fgenesh2_pg.C_30015 braFlo1
Caenorhabditis elegans 18012 W03F9.5.1 178544 WBGene00006648 ttb-1 ce6
Callithrix jacchus 38206 ENSCJAP00000013920 100391836 ENSCJAG00000007469 GTF2B calJac3
Canis familiaris 13271 ENSCAFP00000029978 479960 ENSCAFG00000020209 GTF2B canFam2
Cavia porcellus 6895 ENSCPOP00000012635 100732994 ENSCPOG00000014028 GTF2B cavPor3
Choloepus hoffmanni 5452 ENSCHOP00000005450 ENSCHOG00000006162 GTF2B choHof1
Culex quinquefasciatus 2459 CPIJ006843 CpipJ1
Danio rerio 24778 ENSDARP00000009188 danRer6
Daphnia pulex 10664 JGI_V11_325996 1.1
Daphnia pulex 7610 JGI_V11_50412 1.1
Daphnia pulex 5051 JGI_V11_303055 1.1
Daphnia pulex 148 JGI_V11_299541 1.1
Dasypus novemcinctus 6785 ENSDNOP00000016207 101433529 ENSDNOG00000024361 GTF2B dasNov2
Drosophila melanogaster 1982 FBpp0079615 34430 FBgn0004915 TfIIB dm3
Drosophila willistoni 4785 FBpp0244017 6641853 FBgn0216879 GK14874 r1.3
Erinaceus europaeus 6196 ENSEEUP00000006173 103125865 ENSEEUG00000006779 GTF2B eriEur1
Felis catus 1642 ENSFCAP00000005538 101081913 ENSFCAG00000005961 GTF2B felCat3
Fugu rubripes 5149 ENSTRUP00000005149 101077295 ENSTRUG00000002246 gtf2b fr2
Gallus gallus 9370 ENSGALP00000010001 424518 ENSGALG00000006205 GTF2B galGal3
Gasterosteus aculeatus 20219 ENSGACP00000020720 ENSGACG00000015696 gtf2b gasAcu1
Gorilla gorilla 8193 ENSGGOP00000020269 101127662 ENSGGOG00000015017 GTF2B gorGor3
Homo sapiens 40152 ENSP00000359531 2959 ENSG00000137947 GTF2B hg19,GRCh37
Ixodes scapularis 19096 ISCW023433-PA ISCW023433 IscaW1
Linepithema humile 15212 LH14538-PA 1.2
Loxodonta africana 12557 ENSLAFP00000019453 100676323 ENSLAFG00000006102 GTF2B loxAfr3
Macropus eugenii 11652 ENSMEUP00000011649 ENSMEUG00000012776 GTF2B Meug_1.0
Microcebus murinus 13402 ENSMICP00000013404 ENSMICG00000014701 GTF2B micMur1
Monodelphis domestica 2186 ENSMODP00000015544 100016253 ENSMODG00000012414 GTF2B monDom5
Mus musculus 20628 ENSMUSP00000029938 229906 ENSMUSG00000028271 Gtf2b mm9
Nasonia vitripennis 2801 NV12842-PA 1.2
Nematostella vectensis 9778 e_gw.152.51.1 Nemve1
Ochotona princeps 15437 ENSOPRP00000009067 101528042 ENSOPRG00000009935 GTF2B OchPri2.0
Oryctolagus cuniculus 15583 ENSOCUP00000000122 ENSOCUG00000000139 GTF2B oryCun2.0
Oryzias latipes 5739 ENSORLP00000006167 101158724 ENSORLG00000004899 gtf2b oryLat2
Otolemur garnettii 5144 ENSOGAP00000005144 100958137 ENSOGAG00000005753 GTF2B otoGar1
Pan troglodytes 30506 ENSPTRP00000001610 743356 ENSPTRG00000000932 GTF2B panTro2
Pediculus humanus 10771 PHUM626400-PA 8239246 PHUM626400 PhumU1
Pogonomyrmex barbatus 12589 PB22589-PA 1.2
Pongo abelii 10996 ENSPPYP00000001365 100173138 ENSPPYG00000001178 GTF2B ponAbe2
Procavia capensis 3745 ENSPCAP00000003254 ENSPCAG00000003473 GTF2B proCap1
Pteropus vampyrus 7625 ENSPVAP00000007125 ENSPVAG00000007549 GTF2B pteVam1
Rattus norvegicus 27742 ENSRNOP00000015033 81673 ENSRNOG00000011135 Gtf2b rn4
Rhesus macaque 5574 ENSMMUP00000003745 694770 ENSMMUG00000002794 rheMac2
Sorex araneus 5930 ENSSARP00000005917 ENSSARG00000006537 GTF2B sorAra1
Spermophilus tridecemlineatus 13828 ENSSTOP00000013824 101958444 ENSSTOG00000015439 Gtf2b speTri1
Sus scrofa 7374 ENSSSCP00000007384 100155974 ENSSSCG00000006926 GTF2B susScr2
Taeniopygia guttata 9928 ENSTGUP00000006433 100220653 ENSTGUG00000006258 GTF2B taeGut1
Tarsius syrichta 8087 ENSTSYP00000009480 ENSTSYG00000010351 GTF2B tarSyr1
Tetraodon nigroviridis 6633 ENSTNIP00000009758 ENSTNIG00000006960 gtf2b tetNig2
Tribolium castaneum 10627 GLEAN_10900 Tcas3.0
Tupaia belangeri 1213 ENSTBEP00000001205 ENSTBEG00000001398 GTF2B tupBel1
Tursiops truncatus 11712 ENSTTRP00000011289 101324154 ENSTTRG00000011903 GTF2B turTru1
Vicugna pacos 3925 ENSVPAP00000004931 ENSVPAG00000005312 GTF2B vicPac1
Xenopus tropicalis 21727 ENSXETP00000013433 549031 ENSXETG00000006091 gtf2b xenTro2

multiple sequence alignment in CLUSTALW format

Caenorhabditis_elegans|23852        ------ATGTCG------------------------------GCTCCAGTCCAGTGTCCG
Daphnia_pulex|29404                 ATGCCATTAGGAGGTGGTTTTCGGATTGGG------------------ATTTGTTGCCCT
Daphnia_pulex|880                   ATGCCATTAGAAGGTGGTTTTCGGATTGGG------------------ATTTGTTGTCCT
Nematostella_vectensis|23374        ---------------ATGACAAGAGAGAAA---------------AGCGTGGCGTGTAGA
Ixodes_scapularis|19103             ------------------------------------------------------------
Xenopus_tropicalis|24068            ------------------------ATTGAT------GCACTTCCCAAGGTAACTTGCCCA
Cavia_porcellus|8813                ------------------------------------------------------------
Gallus_gallus|19545                 ------------------------------------------CCGAGAGTGACTTGCCCA
Felis_catus|36235                   ------------------------------------------------------------
Daphnia_pulex|7999                  ------ATGTCATCGGGACGT---------------------GGTAGGATTTGTTGCCCT
Drosophila_melanogaster|2118        ------ATGGCATCGACATCGAGACTGGAC------AAC---AACAAGGTGTGCTGCTAC
Drosophila_willistoni|1842          ------ATGGCTTCAACCTCTAGACTTGAC------AAC---AACAAGGTGTGCTGTTAT
Bombyx_mori|4217                    ------ATGGCGAGTACATCGAGAATTGAG------GCG---AATAAAGTGGTTTGCTAT
Nasonia_vitripennis|5254            ------ATGGCTGCTCACTCAAGGTCGGAC------ACA---AACAAAGTCTGTTGTTAT
Pediculus_humanus|10992             ------------ATGGCGTCAAGGAGCGAT------GGG---AATAAAGTTTGCTGTTAT
Tribolium_castaneum|5593            ------ATGGCGAGTAGTTCAAGGTATGAC------ACG---AATAAGGTTTGTTGTAAT
Apis_mellifera|28034                ------ATGGCAAGTTCGTCAAGACATGAA------ACA---AACAAAGTTTGTTGTTAT
Pogonomyrmex_barbatus|6421          ------ATGGCAAGTTCGTCACGGAATGCT------ACA---AATAAGGTTTGTTGTTAT
Linepithema_humile|1593             ------ATGGCAAGTTCGTCACGAAATTCA------------AACAAGATTTGTTGTTAT

Ixodes_scapularis|19103             ------------------------------------------------------------
Cavia_porcellus|8813                ------------------------------------------------------------
Felis_catus|36235                   ------------------------------------------------------------

Ixodes_scapularis|19103             ------------------------------------------------------------

Ixodes_scapularis|19103             ------------------------------------------------------------

Ixodes_scapularis|19103             ------------------------ATGATCGGAAAGGGGACG------GGAGATGCCAGC
                                                                .                   ..          

                                                                            .        .          

Taeniopygia_guttata|13944           GATCGTGCGATGAtgaatgcttttaaagaaattacgAACATGGCAGACAGAATCAACCTC
                                    .         .       .            .        ..   .      .     . 

Taeniopygia_guttata|13944           CCTAGAAATATAGTTGATCgaacaaataatttattcaagCAAGTGTATGAGCAAAAGAGC
                                              .    .   .           . ..       ..    .           

                                     .    ..                                . .   .    ..  .    

Taeniopygia_guttata|13944           GAGGGTGTTCCAAGAACATTTAAAGaaatatgtgCAGTGTCCCggatttcaaagaaagaa
                                    .  .. ..     .     .    .   . .               .             

Procavia_capensis|3973              ATCGGT---------CGATTTAAACTGATTTTGAAAGCTTTAGAAATCAGTGAC------
                                     . ..             .      .              . .                 

Caenorhabditis_elegans|23852        ---------ATTACATCTGCAGATTTTATGTCTCGGTTCTGTGGAAATCTATCG------
Macropus_eugenii|12811              ---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------
Procavia_capensis|3973              ---------TTAATTACAAGGGACTTCATGTCAAGGTTCTGTTCAAACCTNNNN------
Sorex_araneus|6667                  ---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------
Tarsius_syrichta|8840               ---------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------
Nematostella_vectensis|23374        ---------ATCACATCCGGGGACTTCATGTCGCGGTTCTGTTCCAACCTCACC------
Ixodes_scapularis|19103             ---------ATCACGACGGGCGACTTCATGGCGAAG------CCCCATCTCGGT------
Dasypus_novemcinctus|7674           ---------ATTACAACTGGGGACTTCATGTCCAGGTTCTGTTCAAATCTTTGT------
Spermophilus_tridecemlineatus|15436 ---------ATTACAACTGGGGACTTCATGTCCAGGTTCTGTTCCAACCTTTGT------
Microcebus_murinus|15795            ---------ATTACAACTGGAGACTTCATGTCCAGGTTCTGTTCCAACCTTTGT------
Pteropus_vampyrus|8099              ---------ATTACAACTGGGGACTTCATGTCCAGGTTTTGTTCGAACCTTTGT------
Branchiostoma_floridae|37129        ---------ATCACAACTGGGGACTTCATGTCGCGGTTCTGTTCCAACTTGAAC------
Vicugna_pacos|4213                  ---------ATTACAACTGGGGACTTCATGTCCAGGTTTTGCTCCAACCTTTGT------
Danio_rerio|13670                   ---------ATCACAACTGGTGATTTCATGTCACGTTTCTGCTCCAACTTGGGT------
Oryzias_latipes|7913                ---------ATCACCACGGGGGACTTCATGTCCCGGTTCTGCTCCAACCTGGGC------
Gasterosteus_aculeatus|3428         ---------ATCACCACCGGAGACTTCATGTCTCGGTTCTGCTCAAACCTGGGC------
Tetraodon_nigroviridis|6196         ---------ATCACCACCGGAGACTTCATGTCGCGCTTCTGCTCCAACCTGGGG------
Fugu_rubripes|34544                 ---------ATCACCACCGGCGACTTCATGTCGCGCTTCTGCTCCAACCTGGGG------
Xenopus_tropicalis|24068            ---------ATAACTACTGGAGATTTTATGTCACGGTTCTGCTCAAATCTGGGC------
Choloepus_hoffmanni|6178            ---------ATTACAACTGGGGACTTCATGTCCAGGTTCTGTTCAAATCTTTGT------
Tupaia_belangeri|1387               ---------ATAACAACTGGGGACTTCATGTCCAGGTTCTGTTCCAACCTGTGT------
Cavia_porcellus|8813                ---------ATTACCACTGGGGACTTCATGTCCAGATTCTGCTCCAACCTCTGT------
Gallus_gallus|19545                 ---------ATTACAACTGGAGACTTCATGTCAAGATTCTGTTCAAATCTGGGT------
Taeniopygia_guttata|13944           ---------ATTACAACTGGCGACTTCATGTCACGATTCTGTTCTaatttgggt------
Monodelphis_domestica|7689          ---------ATCACAACAGGGGATTTCATGTCGAGATTTTGCTCCAACCTTGGT------
Felis_catus|36235                   ---------ATTACAACCGGGGACTTCATGTCCAGGTTTTGTTCCAACCTTTGT------
Oryctolagus_cuniculus|5499          ---------ATTACAACTGGGGACTTCATGTCCAGATTCTGTTCGAACCTTTGT------
Ochotona_princeps|17716             ---------ATAACAACTGGGGACTTCATGTCCAGATTCTGTTCCAACCTCTGC------
Mus_musculus|27722                  ---------ATCACAACTGGGGACTTCATGTCCAGGTTCTGCTCCAACCTTTGC------
Rattus_norvegicus|19946             ---------ATCACAACTGGGGACTTCATGTCCAGGTTCTGCTCCAACCTTTGC------
Erinaceus_europaeus|7528            ---------ATTACAACTGGAGACTTCATGTCCAGATTTTGCTCCAACCTTTGT------
Bos_taurus|19279                    ---------ATTACAACTGGGGACTTCATGTCCAGGTTTTGTTCCAACCTTTGT------
Canis_familiaris|24648              ---------ATTACAACTGGGGACTTCATGTCCAGATTTTGTTCCAACCTCTGT------
Callithrix_jacchus|47030            ---------ATTACAACTGGGGACTTTATGTCCAGGTTCTGTTCCAATCTTTGT------
Gorilla_gorilla|9633                ---------ATAACAACTGGGGACTTCATGTCCAGGTTCTGTTCCAACCTTTGT------
Homo_sapiens|4674                   ---------ATTACAACTGGGGACTTCATGTCCAGGTTCTGTTCCAACCTTTGT------
Loxodonta_africana|7525             ---------ATTACAACTGGGGACTTCATGTCCAGGTTCTGTTCAAACCTTTGT------
Rhesus_macaque|1960                 ---------ATTACAACTGGGGACTTCATGTCCAGATTCTGTTCCAATCTTTGT------
Pongo_abelii|1688                   ---------ATTACAACTGGGGACTTCATGTCCAGGTTCTGTTCCAACCTTTGT------
Pan_troglodytes|1777                ---------ATTACAACTGGGGACTTCATGTCCAGGTTCTGTTCCAACCTTTGT------
Sus_scrofa|14045                    ---------ATCACAACTGGGGACTTCATGTCCAGGTTTTGTTCCAACCTCTGT------
Tursiops_truncatus|12390            ---------ATTACAACTGGGGACTTCATGTCCAGGTTTTGTTCCAACCTTTGT------
Otolemur_garnettii|5970             ---------ATTACCACTGGAGACTTCATGTCTAGGTTCTGCTCCAACCTTTGT------
Daphnia_pulex|7999                  ---------ATTAAAACCTCGGATTTTATGCCACGTTTCTGCTCAAATCTTGGA------
Daphnia_pulex|18371                 ---------ATCACTACCGCAGATTTCATGTCCCGTTTCTGTTCGAATCTTGGA------
Culex_quinquefasciatus|1120         ---------ATCACGACCGCCGATTTTATGTCCCGGTTCTGCGCCAACTTGGAC------
Drosophila_melanogaster|2118        ---------ATAACCACTGCGGACTTCATGTGCCGCTTCTGCGCCAACTTGGAC------
Drosophila_willistoni|1842          ---------ATCACAACTGCCGATTTTATGTGCCGCTTTTGTGCTAATTTAGAT------
Bombyx_mori|4217                    ---------ATTACAACAGCAGATTTTATGTCTCGGTTTTGCTCGAATTTGGGT------
Nasonia_vitripennis|5254            ---------ATTACTACTGGTGACTTTATGTCCAGATTTTGTTCAAACTTGGGT------
Pediculus_humanus|10992             ---------ATTACTACTGGAGATTTCATGTCAAGATTTTGTTCCAATTTGGGT------
Tribolium_castaneum|5593            ---------ATTACCACTGGTGATTTTATGTCGAGGTTTTGCTCGAACCTTGGT------
Apis_mellifera|28034                ---------ATTACTACAGGAGACTTTATGTCAAGATTTTGTTCTAATCTTGGT------
Pogonomyrmex_barbatus|6421          ---------ATTACCACGGGTGACTTCATGTCCAGATTTTGTTCTAATCTTGGC------
Linepithema_humile|1593             ---------ATCACCACAGGCGACTTTATGTCCAGATTTTGCTCCACTCTTGGT------
                                              .          .  ..  .                    .          

Ixodes_scapularis|19103             ------------------------------------------------------------
Taeniopygia_guttata|13944           cttcccaaacaAGTACAAATGGCAGCAACA---CATATTGCCCGTAAAGCTGTGGAATTA

Ixodes_scapularis|19103             ------------------------------------GGCAGCCGCTGCTATCTACATGGC
                                                                        .           .   .       

Ixodes_scapularis|19103             ATCGCAAGC------------------------------------------ATCGGAGGA
Spermophilus_tridecemlineatus|15436 CAGGCATCAGCTGAG------AAGAGGACCCAAAAA------------------------
Taeniopygia_guttata|13944           CAGGcttcttcagag------aaaaggacacaaaaagAAATTGGTGATATTGCTGGTGTG
Ochotona_princeps|17716             CAGGCGTCAGCTGAG------AAGAGGACCCAAAAA------------------------
Sus_scrofa|14045                    CAGGCCTCAGCGGAG------AAGAGGACGCAGAAAGaaattggagatattgCTGGTGTT

Ixodes_scapularis|19103             CAAGAAGTCTCAGAAAGG------------------------------------------
Spermophilus_tridecemlineatus|15436 ------------------------------------------------------------
Ochotona_princeps|17716             ------------------------------------------------------------

Daphnia_pulex|29404                 CCTCCGGAATTCAATCTAATT------ATTAGCAAACTATCCCAAGGT------------
Daphnia_pulex|880                   CCTCCGGAATTCAATCTAATT------ATTAGCAAACTATCCCAAGGT------------
Ixodes_scapularis|19103             ------------------------------------------------------------
Spermophilus_tridecemlineatus|15436 ------------------------------------------------------------
Tupaia_belangeri|1387               CCTACAGACTTCAAATTTGACACC------------------------------------
Ochotona_princeps|17716             ------------------------------------------------------------
Daphnia_pulex|7999                  CCGTCGGATTTCAAACTGATT------ATCAGCCAACTACCCCAACGT------------

Caenorhabditis_elegans|23852        ------------------------------------------------------------
Macropus_eugenii|12811              ------------------------------------------------------------
Procavia_capensis|3973              ------------------------------------------------------------
Sorex_araneus|6667                  ------------------------------------------------------------
Tarsius_syrichta|8840               ------------------------------------------------------------
Daphnia_pulex|29404                 ------------------------------------------------------------
Daphnia_pulex|880                   ------------------------------------------------------------
Nematostella_vectensis|23374        ------------------------------------------------------------
Ixodes_scapularis|19103             ------------------------------------------------------------
Dasypus_novemcinctus|7674           ------------------------------------------------------------
Spermophilus_tridecemlineatus|15436 ------------------------------------------------------------
Microcebus_murinus|15795            ------------------------------------------------------------
Pteropus_vampyrus|8099              ------------------------------------------------------------
Branchiostoma_floridae|37129        ------------------------------------------------------------
Vicugna_pacos|4213                  ------------------------------------------------------------
Danio_rerio|13670                   ------------------------------------------------------------
Oryzias_latipes|7913                ------------------------------------------------------------
Gasterosteus_aculeatus|3428         ------------------------------------------------------------
Tetraodon_nigroviridis|6196         ------------------------------------------------------------
Fugu_rubripes|34544                 ------------------------------------------------------------
Xenopus_tropicalis|24068            ------------------------------------------------------------
Choloepus_hoffmanni|6178            ------------------------------------------------------------
Tupaia_belangeri|1387               ------------------------------------------------------------
Cavia_porcellus|8813                ------------------------------------------------------------
Gallus_gallus|19545                 ------------------------------------------------------------
Taeniopygia_guttata|13944           ------------------------------------------------------------
Monodelphis_domestica|7689          ------------------------------------------------------------
Felis_catus|36235                   ------------------------------------------------------------
Oryctolagus_cuniculus|5499          ------------------------------------------------------------
Ochotona_princeps|17716             ------------------------------------------------------------
Mus_musculus|27722                  ------------------------------------------------------------
Rattus_norvegicus|19946             ------------------------------------------------------------
Erinaceus_europaeus|7528            ------------------------------------------------------------
Bos_taurus|19279                    ------------------------------------------------------------
Canis_familiaris|24648              ------------------------------------------------------------
Callithrix_jacchus|47030            ------------------------------------------------------------
Gorilla_gorilla|9633                ------------------------------------------------------------
Homo_sapiens|4674                   ------------------------------------------------------------
Loxodonta_africana|7525             ------------------------------------------------------------
Rhesus_macaque|1960                 ------------------------------------------------------------
Pongo_abelii|1688                   ------------------------------------------------------------
Pan_troglodytes|1777                ------------------------------------------------------------
Sus_scrofa|14045                    ------------------------------------------------------------
Tursiops_truncatus|12390            ------------------------------------------------------------
Otolemur_garnettii|5970             ------------------------------------------------------------
Daphnia_pulex|7999                  ------------------------------------------------------------
Daphnia_pulex|18371                 ------------------------------------------------------------
Culex_quinquefasciatus|1120         ------------------------------------------------------------
Drosophila_melanogaster|2118        ------------------------------------------------------------
Drosophila_willistoni|1842          ------------------------------------------------------------
Bombyx_mori|4217                    ------------------------------------------------------------
Nasonia_vitripennis|5254            ------------------------------------------------------------
Pediculus_humanus|10992             ------------------------------------------------------------
Tribolium_castaneum|5593            ------------------------------------------------------------
Apis_mellifera|28034                ------------------------------------------------------------
Pogonomyrmex_barbatus|6421          ------------------------------------------------------------

Caenorhabditis_elegans|23852        ------------------------------------------------------------
Macropus_eugenii|12811              ------------------------------------------------------------
Procavia_capensis|3973              ------------------------------------------------------------
Sorex_araneus|6667                  ------------------------------------------------------------
Tarsius_syrichta|8840               ------------------------------------------------------------
Daphnia_pulex|29404                 ------------------------------------------------------------
Daphnia_pulex|880                   ------------------------------------------------------------
Nematostella_vectensis|23374        ------------------------------------------------------------
Ixodes_scapularis|19103             ------------------------------------------------------------
Dasypus_novemcinctus|7674           ------------------------------------------------------------
Spermophilus_tridecemlineatus|15436 ------------------------------------------------------------
Microcebus_murinus|15795            ------------------------------------------------------------
Pteropus_vampyrus|8099              ------------------------------------------------------------
Branchiostoma_floridae|37129        ------------------------------------------------------------
Vicugna_pacos|4213                  ------------------------------------------------------------
Danio_rerio|13670                   ------------------------------------------------------------
Oryzias_latipes|7913                ------------------------------------------------------------
Gasterosteus_aculeatus|3428         ------------------------------------------------------------
Tetraodon_nigroviridis|6196         ------------------------------------------------------------
Fugu_rubripes|34544                 ------------------------------------------------------------
Xenopus_tropicalis|24068            ------------------------------------------------------------
Choloepus_hoffmanni|6178            ------------------------------------------------------------
Tupaia_belangeri|1387               ------------------------------------------------------------
Cavia_porcellus|8813                ------------------------------------------------------------
Gallus_gallus|19545                 ------------------------------------------------------------
Taeniopygia_guttata|13944           ------------------------------------------------------------
Monodelphis_domestica|7689          ------------------------------------------------------------
Felis_catus|36235                   ------------------------------------------------------------
Oryctolagus_cuniculus|5499          ------------------------------------------------------------
Ochotona_princeps|17716             ------------------------------------------------------------
Mus_musculus|27722                  ------------------------------------------------------------
Rattus_norvegicus|19946             ------------------------------------------------------------
Erinaceus_europaeus|7528            ------------------------------------------------------------
Bos_taurus|19279                    ------------------------------------------------------------
Canis_familiaris|24648              ------------------------------------------------------------
Callithrix_jacchus|47030            ------------------------------------------------------------
Gorilla_gorilla|9633                ------------------------------------------------------------
Homo_sapiens|4674                   ------------------------------------------------------------
Loxodonta_africana|7525             ------------------------------------------------------------
Rhesus_macaque|1960                 ------------------------------------------------------------
Pongo_abelii|1688                   ------------------------------------------------------------
Pan_troglodytes|1777                ------------------------------------------------------------
Sus_scrofa|14045                    ------------------------------------------------------------
Tursiops_truncatus|12390            ------------------------------------------------------------
Otolemur_garnettii|5970             ------------------------------------------------------------
Daphnia_pulex|7999                  ------------------------------------------------------------
Daphnia_pulex|18371                 ------------------------------------------------------------
Culex_quinquefasciatus|1120         ------------------------------------------------------------
Drosophila_melanogaster|2118        ------------------------------------------------------------
Drosophila_willistoni|1842          ------------------------------------------------------------
Bombyx_mori|4217                    ------------------------------------------------------------
Nasonia_vitripennis|5254            ------------------------------------------------------------
Pediculus_humanus|10992             ------------------------------------------------------------
Tribolium_castaneum|5593            ------------------------------------------------------------
Apis_mellifera|28034                ------------------------------------------------------------
Pogonomyrmex_barbatus|6421          ------------------------------------------------------------

Caenorhabditis_elegans|23852        ------------------------------------------------------------
Macropus_eugenii|12811              ------------------------------------------------------------
Procavia_capensis|3973              ------------------------------------------------------------
Sorex_araneus|6667                  ------------------------------------------------------------
Tarsius_syrichta|8840               ------------------------------------------------------------
Daphnia_pulex|29404                 ------------------------------------------------------------
Daphnia_pulex|880                   ------------------------------------------------------------
Nematostella_vectensis|23374        ------------------------------------------------------------
Ixodes_scapularis|19103             ------------------------------------------------------------
Dasypus_novemcinctus|7674           ------------------------------------------------------------
Spermophilus_tridecemlineatus|15436 ------------------------------------------------------------
Microcebus_murinus|15795            ------------------------------------------------------------
Pteropus_vampyrus|8099              ------------------------------------------------------------
Branchiostoma_floridae|37129        ------------------------------------------------------------
Vicugna_pacos|4213                  ------------------------------------------------------------
Danio_rerio|13670                   ------------------------------------------------------------
Oryzias_latipes|7913                ------------------------------------------------------------
Gasterosteus_aculeatus|3428         ------------------------------------------------------------
Tetraodon_nigroviridis|6196         ------------------------------------------------------------
Fugu_rubripes|34544                 ------------------------------------------------------------
Xenopus_tropicalis|24068            ------------------------------------------------------------
Choloepus_hoffmanni|6178            ------------------------------------------------------------
Tupaia_belangeri|1387               ------------------------------------------------------------
Cavia_porcellus|8813                ------------------------------------------------------------
Gallus_gallus|19545                 ------------------------------------------------------------
Taeniopygia_guttata|13944           ------------------------------------------------------------
Monodelphis_domestica|7689          ------------------------------------------------------------
Felis_catus|36235                   ------------------------------------------------------------
Oryctolagus_cuniculus|5499          ------------------------------------------------------------
Ochotona_princeps|17716             ------------------------------------------------------------
Mus_musculus|27722                  ------------------------------------------------------------
Rattus_norvegicus|19946             ------------------------------------------------------------
Erinaceus_europaeus|7528            ------------------------------------------------------------
Bos_taurus|19279                    ------------------------------------------------------------
Canis_familiaris|24648              ------------------------------------------------------------
Callithrix_jacchus|47030            ------------------------------------------------------------
Gorilla_gorilla|9633                ------------------------------------------------------------
Homo_sapiens|4674                   ------------------------------------------------------------
Loxodonta_africana|7525             ------------------------------------------------------------
Rhesus_macaque|1960                 ------------------------------------------------------------
Pongo_abelii|1688                   ------------------------------------------------------------
Pan_troglodytes|1777                ------------------------------------------------------------
Sus_scrofa|14045                    ------------------------------------------------------------
Tursiops_truncatus|12390            ------------------------------------------------------------
Otolemur_garnettii|5970             ------------------------------------------------------------
Daphnia_pulex|7999                  ------------------------------------------------------------
Daphnia_pulex|18371                 ------------------------------------------------------------
Culex_quinquefasciatus|1120         ------------------------------------------------------------
Drosophila_melanogaster|2118        ------------------------------------------------------------
Drosophila_willistoni|1842          ------------------------------------------------------------
Bombyx_mori|4217                    ------------------------------------------------------------
Nasonia_vitripennis|5254            ------------------------------------------------------------
Pediculus_humanus|10992             ------------------------------------------------------------
Tribolium_castaneum|5593            ------------------------------------------------------------
Apis_mellifera|28034                ------------------------------------------------------------
Pogonomyrmex_barbatus|6421          ------------------------------------------------------------

Caenorhabditis_elegans|23852        ------------------------------------------------------------
Macropus_eugenii|12811              ------------------------------------------------------------
Procavia_capensis|3973              ------------------------------------------------------------
Sorex_araneus|6667                  ------------------------------------------------------------
Tarsius_syrichta|8840               ------------------------------------------------------------
Daphnia_pulex|29404                 ------------------------------------------------------------
Daphnia_pulex|880                   ------------------------------------------------------------
Nematostella_vectensis|23374        ------------------------------------------------------------
Ixodes_scapularis|19103             ------------------------------------------------------------
Dasypus_novemcinctus|7674           ------------------------------------------------------------
Spermophilus_tridecemlineatus|15436 ------------------------------------------------------------
Microcebus_murinus|15795            ------------------------------------------------------------
Pteropus_vampyrus|8099              ------------------------------------------------------------
Branchiostoma_floridae|37129        ------------------------------------------------------------
Vicugna_pacos|4213                  ------------------------------------------------------------
Danio_rerio|13670                   ------------------------------------------------------------
Oryzias_latipes|7913                ------------------------------------------------------------
Gasterosteus_aculeatus|3428         ------------------------------------------------------------
Tetraodon_nigroviridis|6196         ------------------------------------------------------------
Fugu_rubripes|34544                 ------------------------------------------------------------
Xenopus_tropicalis|24068            ------------------------------------------------------------
Choloepus_hoffmanni|6178            ------------------------------------------------------------
Tupaia_belangeri|1387               ------------------------------------------------------------
Cavia_porcellus|8813                ------------------------------------------------------------
Gallus_gallus|19545                 ------------------------------------------------------------
Taeniopygia_guttata|13944           ------------------------------------------------------------
Monodelphis_domestica|7689          ------------------------------------------------------------
Felis_catus|36235                   ------------------------------------------------------------
Oryctolagus_cuniculus|5499          ------------------------------------------------------------
Ochotona_princeps|17716             ------------------------------------------------------------
Mus_musculus|27722                  ------------------------------------------------------------
Rattus_norvegicus|19946             ------------------------------------------------------------
Erinaceus_europaeus|7528            ------------------------------------------------------------
Bos_taurus|19279                    ------------------------------------------------------------
Canis_familiaris|24648              ------------------------------------------------------------
Callithrix_jacchus|47030            ------------------------------------------------------------
Gorilla_gorilla|9633                ------------------------------------------------------------
Homo_sapiens|4674                   ------------------------------------------------------------
Loxodonta_africana|7525             ------------------------------------------------------------
Rhesus_macaque|1960                 ------------------------------------------------------------
Pongo_abelii|1688                   ------------------------------------------------------------
Pan_troglodytes|1777                ------------------------------------------------------------
Sus_scrofa|14045                    ------------------------------------------------------------
Tursiops_truncatus|12390            ------------------------------------------------------------
Otolemur_garnettii|5970             ------------------------------------------------------------
Daphnia_pulex|7999                  ------------------------------------------------------------
Daphnia_pulex|18371                 ------------------------------------------------------------
Culex_quinquefasciatus|1120         ------------------------------------------------------------
Drosophila_melanogaster|2118        ------------------------------------------------------------
Drosophila_willistoni|1842          ------------------------------------------------------------
Bombyx_mori|4217                    ------------------------------------------------------------
Nasonia_vitripennis|5254            ------------------------------------------------------------
Pediculus_humanus|10992             ------------------------------------------------------------
Tribolium_castaneum|5593            ------------------------------------------------------------
Apis_mellifera|28034                ------------------------------------------------------------
Pogonomyrmex_barbatus|6421          ------------------------------------------------------------

Caenorhabditis_elegans|23852        ------------------------------------------------------------
Macropus_eugenii|12811              ------------------------------------------------------------
Procavia_capensis|3973              ------------------------------------------------------------
Sorex_araneus|6667                  ------------------------------------------------------------
Tarsius_syrichta|8840               ------------------------------------------------------------
Daphnia_pulex|29404                 ------------------------------------------------------------
Daphnia_pulex|880                   ------------------------------------------------------------
Nematostella_vectensis|23374        ------------------------------------------------------------
Ixodes_scapularis|19103             ------------------------------------------------------------
Dasypus_novemcinctus|7674           ------------------------------------------------------------
Spermophilus_tridecemlineatus|15436 ------------------------------------------------------------
Microcebus_murinus|15795            ------------------------------------------------------------
Pteropus_vampyrus|8099              ------------------------------------------------------------
Branchiostoma_floridae|37129        ------------------------------------------------------------
Vicugna_pacos|4213                  ------------------------------------------------------------
Danio_rerio|13670                   ------------------------------------------------------------
Oryzias_latipes|7913                ------------------------------------------------------------
Gasterosteus_aculeatus|3428         ------------------------------------------------------------
Tetraodon_nigroviridis|6196         ------------------------------------------------------------
Fugu_rubripes|34544                 ------------------------------------------------------------
Xenopus_tropicalis|24068            ------------------------------------------------------------
Choloepus_hoffmanni|6178            ------------------------------------------------------------
Tupaia_belangeri|1387               ------------------------------------------------------------
Cavia_porcellus|8813                ------------------------------------------------------------
Gallus_gallus|19545                 ------------------------------------------------------------
Taeniopygia_guttata|13944           ------------------------------------------------------------
Monodelphis_domestica|7689          ------------------------------------------------------------
Felis_catus|36235                   ------------------------------------------------------------
Oryctolagus_cuniculus|5499          ------------------------------------------------------------
Ochotona_princeps|17716             ------------------------------------------------------------
Mus_musculus|27722                  ------------------------------------------------------------
Rattus_norvegicus|19946             ------------------------------------------------------------
Erinaceus_europaeus|7528            ------------------------------------------------------------
Bos_taurus|19279                    ------------------------------------------------------------
Canis_familiaris|24648              ------------------------------------------------------------
Callithrix_jacchus|47030            ------------------------------------------------------------
Gorilla_gorilla|9633                ------------------------------------------------------------
Homo_sapiens|4674                   ------------------------------------------------------------
Loxodonta_africana|7525             ------------------------------------------------------------
Rhesus_macaque|1960                 ------------------------------------------------------------
Pongo_abelii|1688                   ------------------------------------------------------------
Pan_troglodytes|1777                ------------------------------------------------------------
Sus_scrofa|14045                    ------------------------------------------------------------
Tursiops_truncatus|12390            ------------------------------------------------------------
Otolemur_garnettii|5970             ------------------------------------------------------------
Daphnia_pulex|7999                  ------------------------------------------------------------
Daphnia_pulex|18371                 ------------------------------------------------------------
Culex_quinquefasciatus|1120         ------------------------------------------------------------
Drosophila_melanogaster|2118        ------------------------------------------------------------
Drosophila_willistoni|1842          ------------------------------------------------------------
Bombyx_mori|4217                    ------------------------------------------------------------
Nasonia_vitripennis|5254            ------------------------------------------------------------
Pediculus_humanus|10992             ------------------------------------------------------------
Tribolium_castaneum|5593            ------------------------------------------------------------
Apis_mellifera|28034                ------------------------------------------------------------
Pogonomyrmex_barbatus|6421          ------------------------------------------------------------

Caenorhabditis_elegans|23852        ------------------TAA
Macropus_eugenii|12811              ------------------TAA
Procavia_capensis|3973              ------------------TGA
Sorex_araneus|6667                  ------------------TAA
Tarsius_syrichta|8840               ------------------TAA
Daphnia_pulex|29404                 ------------------TAA
Daphnia_pulex|880                   ------------------TAA
Nematostella_vectensis|23374        ------------------TGA
Ixodes_scapularis|19103             ------------------TAA
Dasypus_novemcinctus|7674           ------------------TAA
Spermophilus_tridecemlineatus|15436 ---------------------
Microcebus_murinus|15795            ------------------TAA
Pteropus_vampyrus|8099              ------------------TAA
Branchiostoma_floridae|37129        ------------------TAG
Vicugna_pacos|4213                  ------------------TAA
Danio_rerio|13670                   ------------------TGA
Oryzias_latipes|7913                ------------------TGA
Gasterosteus_aculeatus|3428         ------------------TGA
Tetraodon_nigroviridis|6196         ------------------TGA
Fugu_rubripes|34544                 ------------------TGA
Xenopus_tropicalis|24068            ------------------TAA
Choloepus_hoffmanni|6178            ------------------TAA
Tupaia_belangeri|1387               ---------------------
Cavia_porcellus|8813                ------------------TAA
Gallus_gallus|19545                 ------------------TGA
Taeniopygia_guttata|13944           ------------------TGA
Monodelphis_domestica|7689          ------------------TAA
Felis_catus|36235                   ------------------TAA
Oryctolagus_cuniculus|5499          ------------------TAA
Ochotona_princeps|17716             ---------------------
Mus_musculus|27722                  ------------------TAA
Rattus_norvegicus|19946             ------------------TAA
Erinaceus_europaeus|7528            ------------------TAA
Bos_taurus|19279                    ------------------TAA
Canis_familiaris|24648              ------------------TAA
Callithrix_jacchus|47030            ------------------TAA
Gorilla_gorilla|9633                ------------------TAA
Homo_sapiens|4674                   ------------------TAA
Loxodonta_africana|7525             ---------------------
Rhesus_macaque|1960                 ------------------TAA
Pongo_abelii|1688                   ------------------TAA
Pan_troglodytes|1777                ------------------TAA
Sus_scrofa|14045                    ------------------TAA
Tursiops_truncatus|12390            ------------------TAA
Otolemur_garnettii|5970             ------------------TAA
Daphnia_pulex|7999                  ------------------TAA
Daphnia_pulex|18371                 ------------------TAA
Culex_quinquefasciatus|1120         ------------------TAA
Drosophila_melanogaster|2118        ------------------TAA
Drosophila_willistoni|1842          ------------------TAG
Bombyx_mori|4217                    ------------------TAG
Nasonia_vitripennis|5254            ---------------------
Pediculus_humanus|10992             ------------------TAA
Tribolium_castaneum|5593            ------------------TAA
Apis_mellifera|28034                ------------------TAA
Pogonomyrmex_barbatus|6421          ------------------TAA
Linepithema_humile|1593             CATCTCCTAAAGGACACGTAA

multiple sequence alignment in CLUSTALW format

Caenorhabditis_elegans|18012        --MS----------APVQCPIHPDVHLIE--DHRAGDLVCPACGLVVGDRLVDVGTEWRS
Ixodes_scapularis|19096             ------------------------------------------------------------
Cavia_porcellus|6895                ------------------------------------------CLYFIGDRVIDVGSEWRT
Gallus_gallus|9370                  --------------PRVTCPNHPDSILVE--DYRAGDMICSECGLVVGDRVIDVGSEWRT
Felis_catus|1642                    ------------------------------------------CGLVVGDRVIDVGSEWRT

Ixodes_scapularis|19096             ----------------------------MIGKGT--GDASFDESGTA--KYQNRKTMSSS



Ixodes_scapularis|19096             --------------------------------GSRCYLHGIAS--------------IGG

Caenorhabditis_elegans|18012        AEITVRQTYKLLYPKALELFPKDFRFVTPIDALPNS------------------------
Macropus_eugenii|11652              ADVTIRQSYRLIYPRAPDLFPADFKFDTPVDKLPQL------------------------
Procavia_capensis|3745              ADVTIRQSYRLIYPRAPDLFPADFKFDTPVDKLPQL------------------------
Sorex_araneus|5930                  ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Tarsius_syrichta|8087               ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Daphnia_pulex|7610                  ADVTIRQLHELMYPRAAELFPPEFNLI--ISKLSQG------------------------
Daphnia_pulex|148                   ADVTIRQLHELMYPRAAELFPPEFNLI--ISKLSQG------------------------
Nematostella_vectensis|9778         ADVTIRQSYRLLFPKARELFPADFKFAVPIERLPSS------------------------
Ixodes_scapularis|19096             QEVSER------------------------------------------------------
Dasypus_novemcinctus|6785           ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Spermophilus_tridecemlineatus|13828 ------------------------------------------------------------
Microcebus_murinus|13402            ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Pteropus_vampyrus|7625              ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Branchiostoma_floridae|11781        ADVTIRQSYRLIYPRAHELFPADFTFHTPIDQLPQL------------------------
Vicugna_pacos|3925                  XXXXXXXXXXXXXXXAPDLFPTDFKFDTPVDKLPQL------------------------
Danio_rerio|24778                   ADVTIRQSYRLIYPRAADLFPPDFKFDTPVDKLPQL------------------------
Oryzias_latipes|5739                ADVTIRQSYRLIYPRAAELFPPDFKFDTPVDKLPQL------------------------
Gasterosteus_aculeatus|20219        ADVTIRQSYRLIYPRAAELFPPDFKFDTPVDKLPQL------------------------
Tetraodon_nigroviridis|6633         ADVTIRQSYRLIYPRAAELFPPDFKFDTPVDKLPLL------------------------
Fugu_rubripes|5149                  ADVTIRQSYRLIYPRAAELFPPDFKFDTPVDKLPLL------------------------
Xenopus_tropicalis|21727            ADVTIRQSYRLIYPRAPDLFPADFKFDTPVDKLPQL------------------------
Choloepus_hoffmanni|5452            ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Tupaia_belangeri|1213               ADVTIRQSYRLIYPRAPDL-PTDFKFDT--------------------------------
Cavia_porcellus|6895                ADVTIRQSYRLIYPRAPDLFPSDFKFDTPVDKLPQL------------------------
Gallus_gallus|9370                  ADVTIRQSYRLIYPRAPDLFPADFKFDTPVDKLPQL------------------------
Taeniopygia_guttata|9928            ADVTIRQSYRLIYPRAPDLFPADFKFDTPVDKLPQL------------------------
Monodelphis_domestica|2186          ADVTIRQSYRLIYPRAPDLFPADFKFDTPVDKLPQL------------------------
Felis_catus|1642                    ADVTIRQSYRLIYPRALDLFPTDFKFDTPVDKLPQL------------------------
Oryctolagus_cuniculus|15583         ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Ochotona_princeps|15437             ------------------------------------------------------------
Mus_musculus|20628                  ADVTIRQSYRLIYPRAPDLFPSDFKFDTPVDKLPQL------------------------
Rattus_norvegicus|27742             ADVTIRQSYRLIYPRAPDLFPSDFKFDTPVDKLPQL------------------------
Erinaceus_europaeus|6196            ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Bos_taurus|21691                    ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Canis_familiaris|13271              ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Callithrix_jacchus|38206            ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Gorilla_gorilla|8193                ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Homo_sapiens|40152                  ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Loxodonta_africana|12557            ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Rhesus_macaque|5574                 ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Pongo_abelii|10996                  ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Pan_troglodytes|30506               ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Sus_scrofa|7374                     ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Tursiops_truncatus|11712            ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Otolemur_garnettii|5144             ADVTIRQSYRLIYPRAPDLFPTDFKFDTPVDKLPQL------------------------
Daphnia_pulex|5051                  ADVTIRQSYELMYPRAAELFPSDFKLI--ISQLPQR------------------------
Daphnia_pulex|10664                 ADVTIRQSYKLMYPRAAELFPEDFRFTTPIEQLPQL------------------------
Culex_quinquefasciatus|2459         ADVTIRQSYRLMYPHAAELFPEDFKYTTPIEQLPQM------------------------
Drosophila_melanogaster|1982        ADVTIRQSYKLMYPHAAKLFPEDFKFTTPIDQLPQM------------------------
Drosophila_willistoni|4785          ADVTIRQSYKLMYPHAAKLFPEDFKFTTPIDQLPQM------------------------
Bombyx_mori|6014                    ADVTIRQSYKLMYPSAARLFPEDFKFATPIEFLPQM------------------------
Nasonia_vitripennis|2801            ADVTIRQSYKLMFPHAARLFPEDFKFTTPIDQLPQM------------------------
Pediculus_humanus|10771             ADVTIRQSYKLMYPHATKLFPEDFQFSTPIEELPQM------------------------
Tribolium_castaneum|10627           ADVTIRQSYKLMYPHAVKLFPEDFKFATPIDQLPQM------------------------
Apis_mellifera|8565                 ADVTIRQSYKLMYPHAGKLFPEDFRFATPIDQLPQM------------------------
Pogonomyrmex_barbatus|12589         ADVTIRQSYKLMYPHAIKLFPEDFKFATPIDQLPQM------------------------

Caenorhabditis_elegans|18012        ------------------------------------------------------------
Macropus_eugenii|11652              ------------------------------------------------------------
Procavia_capensis|3745              ------------------------------------------------------------
Sorex_araneus|5930                  ------------------------------------------------------------
Tarsius_syrichta|8087               ------------------------------------------------------------
Daphnia_pulex|7610                  ------------------------------------------------------------
Daphnia_pulex|148                   ------------------------------------------------------------
Nematostella_vectensis|9778         ------------------------------------------------------------
Ixodes_scapularis|19096             ------------------------------------------------------------
Dasypus_novemcinctus|6785           ------------------------------------------------------------
Spermophilus_tridecemlineatus|13828 ------------------------------------------------------------
Microcebus_murinus|13402            ------------------------------------------------------------
Pteropus_vampyrus|7625              ------------------------------------------------------------
Branchiostoma_floridae|11781        ------------------------------------------------------------
Vicugna_pacos|3925                  ------------------------------------------------------------
Danio_rerio|24778                   ------------------------------------------------------------
Oryzias_latipes|5739                ------------------------------------------------------------
Gasterosteus_aculeatus|20219        ------------------------------------------------------------
Tetraodon_nigroviridis|6633         ------------------------------------------------------------
Fugu_rubripes|5149                  ------------------------------------------------------------
Xenopus_tropicalis|21727            ------------------------------------------------------------
Choloepus_hoffmanni|5452            ------------------------------------------------------------
Tupaia_belangeri|1213               ------------------------------------------------------------
Cavia_porcellus|6895                ------------------------------------------------------------
Gallus_gallus|9370                  ------------------------------------------------------------
Taeniopygia_guttata|9928            ------------------------------------------------------------
Monodelphis_domestica|2186          ------------------------------------------------------------
Felis_catus|1642                    ------------------------------------------------------------
Oryctolagus_cuniculus|15583         ------------------------------------------------------------
Ochotona_princeps|15437             ------------------------------------------------------------
Mus_musculus|20628                  ------------------------------------------------------------
Rattus_norvegicus|27742             ------------------------------------------------------------
Erinaceus_europaeus|6196            ------------------------------------------------------------
Bos_taurus|21691                    ------------------------------------------------------------
Canis_familiaris|13271              ------------------------------------------------------------
Callithrix_jacchus|38206            ------------------------------------------------------------
Gorilla_gorilla|8193                ------------------------------------------------------------
Homo_sapiens|40152                  ------------------------------------------------------------
Loxodonta_africana|12557            ------------------------------------------------------------
Rhesus_macaque|5574                 ------------------------------------------------------------
Pongo_abelii|10996                  ------------------------------------------------------------
Pan_troglodytes|30506               ------------------------------------------------------------
Sus_scrofa|7374                     ------------------------------------------------------------
Tursiops_truncatus|11712            ------------------------------------------------------------
Otolemur_garnettii|5144             ------------------------------------------------------------
Daphnia_pulex|5051                  ------------------------------------------------------------
Daphnia_pulex|10664                 ------------------------------------------------------------
Culex_quinquefasciatus|2459         ------------------------------------------------------------
Drosophila_melanogaster|1982        ------------------------------------------------------------
Drosophila_willistoni|4785          ------------------------------------------------------------
Bombyx_mori|6014                    ------------------------------------------------------------
Nasonia_vitripennis|2801            ------------------------------------------------------------
Pediculus_humanus|10771             ------------------------------------------------------------
Tribolium_castaneum|10627           ------------------------------------------------------------
Apis_mellifera|8565                 ------------------------------------------------------------
Pogonomyrmex_barbatus|12589         ------------------------------------------------------------

Caenorhabditis_elegans|18012        --------------------------
Macropus_eugenii|11652              --------------------------
Procavia_capensis|3745              --------------------------
Sorex_araneus|5930                  --------------------------
Tarsius_syrichta|8087               --------------------------
Daphnia_pulex|7610                  --------------------------
Daphnia_pulex|148                   --------------------------
Nematostella_vectensis|9778         --------------------------
Ixodes_scapularis|19096             --------------------------
Dasypus_novemcinctus|6785           --------------------------
Spermophilus_tridecemlineatus|13828 --------------------------
Microcebus_murinus|13402            --------------------------
Pteropus_vampyrus|7625              --------------------------
Branchiostoma_floridae|11781        --------------------------
Vicugna_pacos|3925                  --------------------------
Danio_rerio|24778                   --------------------------
Oryzias_latipes|5739                --------------------------
Gasterosteus_aculeatus|20219        --------------------------
Tetraodon_nigroviridis|6633         --------------------------
Fugu_rubripes|5149                  --------------------------
Xenopus_tropicalis|21727            --------------------------
Choloepus_hoffmanni|5452            --------------------------
Tupaia_belangeri|1213               --------------------------
Cavia_porcellus|6895                --------------------------
Gallus_gallus|9370                  --------------------------
Taeniopygia_guttata|9928            --------------------------
Monodelphis_domestica|2186          --------------------------
Felis_catus|1642                    --------------------------
Oryctolagus_cuniculus|15583         --------------------------
Ochotona_princeps|15437             --------------------------
Mus_musculus|20628                  --------------------------
Rattus_norvegicus|27742             --------------------------
Erinaceus_europaeus|6196            --------------------------
Bos_taurus|21691                    --------------------------
Canis_familiaris|13271              --------------------------
Callithrix_jacchus|38206            --------------------------
Gorilla_gorilla|8193                --------------------------
Homo_sapiens|40152                  --------------------------
Loxodonta_africana|12557            --------------------------
Rhesus_macaque|5574                 --------------------------
Pongo_abelii|10996                  --------------------------
Pan_troglodytes|30506               --------------------------
Sus_scrofa|7374                     --------------------------
Tursiops_truncatus|11712            --------------------------
Otolemur_garnettii|5144             --------------------------
Daphnia_pulex|5051                  --------------------------
Daphnia_pulex|10664                 --------------------------
Culex_quinquefasciatus|2459         --------------------------
Drosophila_melanogaster|1982        --------------------------
Drosophila_willistoni|4785          --------------------------
Bombyx_mori|6014                    --------------------------
Nasonia_vitripennis|2801            --------------------------
Pediculus_humanus|10771             --------------------------
Tribolium_castaneum|10627           --------------------------
Apis_mellifera|8565                 --------------------------
Pogonomyrmex_barbatus|12589         --------------------------
Linepithema_humile|15212            CKREELLNLWLEGIEHKQVLHLLKDT