Orthologs Set ID: EOG4006CV

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Anolis carolinensis 5970 143, 438, 570, 666, 750, 929, 1101, 1281
Bos taurus 4002 438, 570, 666, 750, 929, 1101, 1281
Branchiostoma floridae 24811 73, 223, 438, 570, 675, 944, 1101
Callithrix jacchus 41147 438, 606, 637, 703, 750, 929, 1101, 1281
Canis familiaris 12943 166, 438, 570, 666, 750, 929, 1101, 1281
Cavia porcellus 17761 166, 438, 570, 666, 750, 929, 1101, 1281
Dipodomys ordii 14912 166, 438, 570, 666, 750, 929, 1101, 1281
Echinops telfairi 7444 438, 570, 666, 750, 929, 1101
Equus caballus 27079 666, 750, 929, 1101
Felis catus 40858 166, 438, 570, 666, 750, 929, 1101, 1281, 1359, 1416
Fugu rubripes 811 230, 438, 570, 666, 750, 929, 1101, 1281, 1344
Gallus gallus 2358 438, 570, 666, 750, 929, 1101, 1281
Gasterosteus aculeatus 1961 166, 438, 570, 666, 750, 929, 1101, 1281
Gorilla gorilla 16246 166, 438, 570, 666, 750, 929, 1101, 1281
Homo sapiens 25349 166, 438, 570, 666, 750, 929, 1101, 1281
Loxodonta africana 13027 255, 438, 570, 666, 750, 925, 1101, 1281
Macropus eugenii 794 438, 570, 666, 750, 929, 1101, 1281
Monodelphis domestica 28463 166, 438, 570, 666, 750, 929, 1101, 1281
Mus musculus 41300 428, 571, 576, 666, 750, 929, 1101, 1281
Myotis lucifugus 7745 438, 570, 666, 750, 929, 1101, 1281
Ochotona princeps 11698 438, 570, 666, 750, 929, 949, 968, 988, 1006, 1101
Ornithorhynchus anatinus 10495 411, 474, 726, 1185, 1389
Ornithorhynchus anatinus 19931 568, 570, 666, 750, 929, 1101, 1281
Oryzias latipes 15201 438, 570, 666, 750, 929, 1101, 1281
Pan troglodytes 10999 929, 1101, 1281
Procavia capensis 4959 438, 570, 666, 750, 929, 1101, 1281, 1463
Pteropus vampyrus 12149 166, 438, 570, 666, 750, 929, 1101, 1281
Rattus norvegicus 14545 438, 570, 666, 750, 929, 1101, 1281
Rhesus macaque 18815 166, 438, 570, 670, 750, 929, 1101, 1281
Sus scrofa 3182 438, 570, 666, 813, 929, 1101, 1122, 1281
Taeniopygia guttata 232 438, 570, 666, 750, 929, 1101, 1281
Tetraodon nigroviridis 14180 438, 570, 666, 750, 853, 929, 1134, 1285, 1315
Tursiops truncatus 2478 166, 438, 570, 666, 750, 818, 929, 1101, 1281, 1294, 1299, 1311, 1395, 1398
Xenopus tropicalis 13887 166, 438, 570, 666, 750, 929, 1101, 1281

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Anolis carolinensis 5970 ENSACAT00000000371 100560244 ENSACAG00000000417 TMEM255B anoCar1
Bos taurus 4002 ENSBTAT00000026592 618499 ENSBTAG00000019965 TMEM255B bosTau4
Branchiostoma floridae 24811 fgenesh2_pg.scaffold_7000180 braFlo1
Callithrix jacchus 41147 ENSCJAT00000037144 ENSCJAG00000018945 TMEM255B calJac3
Canis familiaris 12943 ENSCAFT00000010336 ENSCAFG00000006398 FAM70B canFam2
Cavia porcellus 17761 ENSCPOT00000001524 100730122 ENSCPOG00000001504 TMEM255B cavPor3
Dipodomys ordii 14912 ENSDORT00000004434 ENSDORG00000004434 Tmem255b dipOrd1
Echinops telfairi 7444 ENSETET00000007261 ENSETEG00000007263 TMEM255B TENREC
Equus caballus 27079 ENSECAT00000000006 100069181 ENSECAG00000000013 TMEM255B equCab2
Felis catus 40858 ENSFCAT00000006902 ENSFCAG00000006900 TMEM255B felCat3
Fugu rubripes 811 ENSTRUT00000044265 ENSTRUG00000017219 TMEM255B fr2
Gallus gallus 2358 ENSGALT00000027155 ENSGALG00000016821 TMEM255B galGal3
Gasterosteus aculeatus 1961 ENSGACT00000020242 ENSGACG00000015319 TMEM255B (2 of 2) gasAcu1
Gorilla gorilla 16246 ENSGGOT00000017226 101143555 ENSGGOG00000017167 FAM70B gorGor3
Homo sapiens 25349 ENST00000375353, NM_182614 348013 ENSG00000184497 TMEM255B hg19,GRCh37
Loxodonta africana 13027 ENSLAFT00000025939 ENSLAFG00000027990 TMEM255B loxAfr3
Macropus eugenii 794 ENSMEUT00000000787 ENSMEUG00000000793 TMEM255B Meug_1.0
Monodelphis domestica 28463 ENSMODT00000004610 100021370 ENSMODG00000003681 FAM70B monDom5
Mus musculus 41300 ENSMUST00000044736 272465 ENSMUSG00000038457 Fam70b mm9
Myotis lucifugus 7745 ENSMLUT00000007638 ENSMLUG00000007643 TMEM255B myoLuc1
Ochotona princeps 11698 ENSOPRT00000010578 ENSOPRG00000010576 TMEM255B OchPri2.0
Ornithorhynchus anatinus 10495 ENSOANT00000030221 ENSOANG00000020770 ornAna1
Ornithorhynchus anatinus 19931 ENSOANT00000024665 100084848 ENSOANG00000015644 FAM70B ornAna1
Oryzias latipes 15201 ENSORLT00000005964 ENSORLG00000004739 TMEM255B oryLat2
Pan troglodytes 10999 ENSPTRT00000011143 749508 ENSPTRG00000006067 FAM70B panTro2
Procavia capensis 4959 ENSPCAT00000014495 ENSPCAG00000014512 TMEM255B proCap1
Pteropus vampyrus 12149 ENSPVAT00000015441 ENSPVAG00000015441 TMEM255B pteVam1
Rattus norvegicus 14545 ENSRNOT00000030100 290877 ENSRNOG00000026336 Fam70b rn4
Rhesus macaque 18815 ENSMMUT00000010390 715939 ENSMMUG00000007432 rheMac2
Sus scrofa 3182 ENSSSCT00000010485 100738464 ENSSSCG00000009564 TMEM255B susScr2
Taeniopygia guttata 232 ENSTGUT00000009705 100231442 ENSTGUG00000009312 TMEM255B taeGut1
Tetraodon nigroviridis 14180 ENSTNIT00000012513 ENSTNIG00000009450 TMEM255B tetNig2
Tursiops truncatus 2478 ENSTTRT00000008997 101315825 ENSTTRG00000008998 TMEM255B turTru1
Xenopus tropicalis 13887 ENSXETT00000030261 100493173 ENSXETG00000013827 tmem255b xenTro2

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Anolis carolinensis 385 ENSACAP00000000357 100560244 ENSACAG00000000417 TMEM255B anoCar1
Bos taurus 9203 ENSBTAP00000026592 618499 ENSBTAG00000019965 TMEM255B bosTau4
Branchiostoma floridae 31146 fgenesh2_pg.scaffold_7000180 braFlo1
Callithrix jacchus 32608 ENSCJAP00000035178 ENSCJAG00000018945 TMEM255B calJac3
Canis familiaris 13772 ENSCAFP00000009583 ENSCAFG00000006398 FAM70B canFam2
Cavia porcellus 13965 ENSCPOP00000001360 100730122 ENSCPOG00000001504 TMEM255B cavPor3
Dipodomys ordii 14015 ENSDORP00000004146 ENSDORG00000004434 Tmem255b dipOrd1
Echinops telfairi 5884 ENSETEP00000005890 ENSETEG00000007263 TMEM255B TENREC
Equus caballus 13 ENSECAP00000000006 100069181 ENSECAG00000000013 TMEM255B equCab2
Felis catus 6637 ENSFCAP00000006406 ENSFCAG00000006900 TMEM255B felCat3
Fugu rubripes 44117 ENSTRUP00000044117 ENSTRUG00000017219 TMEM255B fr2
Gallus gallus 19013 ENSGALP00000027104 ENSGALG00000016821 TMEM255B galGal3
Gasterosteus aculeatus 19674 ENSGACP00000020203 ENSGACG00000015319 TMEM255B (2 of 2) gasAcu1
Gorilla gorilla 13074 ENSGGOP00000016755 101143555 ENSGGOG00000017167 FAM70B gorGor3
Homo sapiens 34026 ENSP00000364502 348013 ENSG00000184497 TMEM255B hg19,GRCh37
Loxodonta africana 9936 ENSLAFP00000026485 ENSLAFG00000027990 TMEM255B loxAfr3
Macropus eugenii 735 ENSMEUP00000000727 ENSMEUG00000000793 TMEM255B Meug_1.0
Monodelphis domestica 3862 ENSMODP00000004511 100021370 ENSMODG00000003681 FAM70B monDom5
Mus musculus 54411 ENSMUSP00000045702 272465 ENSMUSG00000038457 Fam70b mm9
Myotis lucifugus 6977 ENSMLUP00000006972 ENSMLUG00000007643 TMEM255B myoLuc1
Ochotona princeps 10208 ENSOPRP00000009662 ENSOPRG00000010576 TMEM255B OchPri2.0
Ornithorhynchus anatinus 16693 ENSOANP00000026419 ENSOANG00000020770 ornAna1
Ornithorhynchus anatinus 3085 ENSOANP00000024661 100084848 ENSOANG00000015644 FAM70B ornAna1
Oryzias latipes 5543 ENSORLP00000005963 ENSORLG00000004739 TMEM255B oryLat2
Pan troglodytes 507 ENSPTRP00000010310 749508 ENSPTRG00000006067 FAM70B panTro2
Procavia capensis 4664 ENSPCAP00000013544 ENSPCAG00000014512 TMEM255B proCap1
Pteropus vampyrus 11451 ENSPVAP00000014561 ENSPVAG00000015441 TMEM255B pteVam1
Rattus norvegicus 11804 ENSRNOP00000034382 290877 ENSRNOG00000026336 Fam70b rn4
Rhesus macaque 19237 ENSMMUP00000009751 715939 ENSMMUG00000007432 rheMac2
Sus scrofa 10180 ENSSSCP00000010213 100738464 ENSSSCG00000009564 TMEM255B susScr2
Taeniopygia guttata 13087 ENSTGUP00000009602 100231442 ENSTGUG00000009312 TMEM255B taeGut1
Tetraodon nigroviridis 10151 ENSTNIP00000012322 ENSTNIG00000009450 TMEM255B tetNig2
Tursiops truncatus 2340 ENSTTRP00000008533 101315825 ENSTTRG00000008998 TMEM255B turTru1
Xenopus tropicalis 10570 ENSXETP00000030261 100493173 ENSXETG00000013827 tmem255b xenTro2

multiple sequence alignment in CLUSTALW format

Ornithorhynchus_anatinus|10495 ------------------------------------------------------------
Oryzias_latipes|15201          ------------------------------------------------------------
Tetraodon_nigroviridis|14180   ------------------------------------------------------------
Gasterosteus_aculeatus|1961    ------------------------------------------------------------
Fugu_rubripes|811              ------------------------------------------------------------
Ornithorhynchus_anatinus|19931 ------------------------------------------------------------
Xenopus_tropicalis|13887       ------------------------------------------------------------
Pteropus_vampyrus|12149        ------------------------------------------------------------
Dipodomys_ordii|14912          ------------------------------------------------------------
Ochotona_princeps|11698        ------------------------------------------------------------
Myotis_lucifugus|7745          ------------------------------------------------------------
Bos_taurus|4002                ------------------------------------------------------------
Macropus_eugenii|794           ------------------------------------------------------------
Echinops_telfairi|7444         ------------------------------------------------------------
Anolis_carolinensis|5970       ------------------------------------------------------------
Gallus_gallus|2358             ------------------------------------------------------------
Taeniopygia_guttata|232        ------------------------------------------------------------
Procavia_capensis|4959         ------------------------------------------------------------
Loxodonta_africana|13027       ------------------------------------------------------------
Monodelphis_domestica|28463    ------------------------------------------------------------
Mus_musculus|41300             ------------------------------------------------------------
Felis_catus|40858              ------------------------------------------------------------
Sus_scrofa|3182                ------------------------------------------------------------
Callithrix_jacchus|41147       ------------------------------------------------------------
Rhesus_macaque|18815           ------------------------------------------------------------
Gorilla_gorilla|16246          ------------------------------------------------------------
Homo_sapiens|25349             ------------------------------------------------------------
Pan_troglodytes|10999          ------------------------------------------------------------
Cavia_porcellus|17761          ------------------------------------------------------------
Rattus_norvegicus|14545        ------------------------------------------------------------
Tursiops_truncatus|2478        ------------------------------------------------------------
Equus_caballus|27079           ------------------------------------------------------------
Canis_familiaris|12943         ------------------------------------------------------------

Ornithorhynchus_anatinus|10495 ------------------------------------------------------------
Oryzias_latipes|15201          ------------------------------------------------------------
Tetraodon_nigroviridis|14180   ------------------------------------------------------------
Gasterosteus_aculeatus|1961    ------------------------------------------ATGCAGCAGCCCGAAACG
Fugu_rubripes|811              ---------------------------------------------------------ACA
Ornithorhynchus_anatinus|19931 ------------------------------------------------------------
Xenopus_tropicalis|13887       ------------------------------------------------TGCCTTGCAATG
Pteropus_vampyrus|12149        ------------------------------------------------ATGCAGCCGCCG
Dipodomys_ordii|14912          ------------------------------------------------ATGCAGCCGCTC
Ochotona_princeps|11698        ------------------------------------------------------------
Myotis_lucifugus|7745          ------------------------------------------------------------
Bos_taurus|4002                ---------------------------------------------------------CGG
Macropus_eugenii|794           ------------------------------------------------------------
Echinops_telfairi|7444         ------------------------------------------------------------
Anolis_carolinensis|5970       ------------------------------------------------------------
Gallus_gallus|2358             ---------------------------------------------------------TCT
Taeniopygia_guttata|232        ------------------------------------------------------------
Procavia_capensis|4959         ------------------------------------------------------------
Loxodonta_africana|13027       ------------------------------------------------------------
Monodelphis_domestica|28463    ---------------------------------------------------------CCT
Mus_musculus|41300             ------------------------------------------------------------
Felis_catus|40858              ---------------------------------------------------------ATG
Sus_scrofa|3182                ------------------------------------------------------------
Callithrix_jacchus|41147       ------------------------------------------------------------
Rhesus_macaque|18815           ---------------------------------------------------------ATG
Gorilla_gorilla|16246          ---------------------------------------------------------ATG
Homo_sapiens|25349             ---------------------------------------------------------ATG
Pan_troglodytes|10999          ------------------------------------------------------------
Cavia_porcellus|17761          ------------------------------------------------------------
Rattus_norvegicus|14545        ------------------------------------------------------------
Tursiops_truncatus|2478        ------------------------------------------------ATGCAGCCGCTC
Equus_caballus|27079           ------------------------------------------------------------
Canis_familiaris|12943         ---------------------------------------------------------ATG

Oryzias_latipes|15201          ------------------------------------------------------------
Tetraodon_nigroviridis|14180   ------------------CCCTGCTCC---------------TCAGTTGAG---------
Ornithorhynchus_anatinus|19931 ------------------------------------------CACAGGGCA---------
Ochotona_princeps|11698        ------------------------------------------------GGC---------
Myotis_lucifugus|7745          ------------------------------------------------GGG---------
Macropus_eugenii|794           ------------------------------------------------CAG---------
Echinops_telfairi|7444         ------------------------------------------------GGG---------
Anolis_carolinensis|5970       TCtccctcaccaccaccaccaacCTTC---------------ACAGCACac---------
Gallus_gallus|2358             TCCCCCTCGCCCCCCCCTCCACTTTTT---------------ACAGGGCAA---------
Taeniopygia_guttata|232        ---------------ccctcactcTCT---------------ACAGGACAG---------
Procavia_capensis|4959         ------------------------------------------------GGG---------
Loxodonta_africana|13027       ------------------------------------------ACAGAAGTG---------
Mus_musculus|41300             atggtgggggcagaggggaggtggagg---gagaagggaaatgaccaaagg---------
Sus_scrofa|3182                ------------------------------------------------------------
Callithrix_jacchus|41147       ---------------------------------------CCTACAGAAGGG---------
Pan_troglodytes|10999          ------------------------------------------------------------
Rattus_norvegicus|14545        ------------------------------------------ACAGAGGGC---------
Equus_caballus|27079           ------------------------------------------------------------

Ornithorhynchus_anatinus|10495 ---------------------------------------------GGGCCGCGCTGCCGG
Oryzias_latipes|15201          ---------------------------------------------------CGGCGGGAG
Tetraodon_nigroviridis|14180   ---------------------------------------------TACCGGCGTCGCCGG
Gasterosteus_aculeatus|1961    ---------------------------------------------TACCTGCGGCGGAGG
Fugu_rubripes|811              ---------------------------------------------CCaaaGCGTCGCAGG
Ornithorhynchus_anatinus|19931 ---------------------------------------------GTTTGCCAAAAGAAA
Xenopus_tropicalis|13887       ---------------------------------------------TTTGCTAAAAGGAAA
Pteropus_vampyrus|12149        ---------------------------------------------TTTGTGAGAAGAAAG
Dipodomys_ordii|14912          ---------------------------------------------TTCGCCAGGAGGAAG
Ochotona_princeps|11698        ---------------------------------------------TTTGGAAAGAGGAAG
Myotis_lucifugus|7745          ---------------------------------------------TTTGGGAGAAGAAAG
Bos_taurus|4002                ---------------------------------------------TTTGTGAGAAGAAAG
Macropus_eugenii|794           ---------------------------------------------TTTGCAAAAAGAAAG
Echinops_telfairi|7444         ---------------------------------------------TTTGCAAGGAGGAAG
Anolis_carolinensis|5970       ---------------------------------------------tttgcaaaaagaaag
Gallus_gallus|2358             ---------------------------------------------TTTGCAAAAAGGAAG
Taeniopygia_guttata|232        ---------------------------------------------Tttgcaaaaaggaag
Procavia_capensis|4959         ---------------------------------------------TTTGCAAAGAGAAAG
Loxodonta_africana|13027       ---------------------------------------------TTTGCAAAAAGAAAG
Monodelphis_domestica|28463    ---------------------------------------------TTTGCGAGAAGAAAG
Mus_musculus|41300             ---------------------------------------------agaggtagaaagaag
Felis_catus|40858              ---------------------------------------------TTTGCCAGAAGA---
Sus_scrofa|3182                ---------------------------------------------TTTGCCAGAAGAAAG
Callithrix_jacchus|41147       ---------------------------------------------CTTGCAAGGAGGAAG
Rhesus_macaque|18815           ---------------------------------------------CTTTCGAGGAGGAAG
Gorilla_gorilla|16246          ---------------------------------------------CTTTCGAGGAGGAAG
Homo_sapiens|25349             ---------------------------------------------CTTTCGAGGAGGAAG
Pan_troglodytes|10999          ------------------------------------------------------------
Cavia_porcellus|17761          ---------------------------------------------TTTGCCCGGAGAAAG
Rattus_norvegicus|14545        ---------------------------------------------TTTGCAAGGAGAAAG
Tursiops_truncatus|2478        ---------------------------------------------TTTGCGAGAAGAAAG
Equus_caballus|27079           ------------------------------------------------------------
Canis_familiaris|12943         ---------------------------------------------TTTGCGAAGAGGAAG

Ornithorhynchus_anatinus|10495 CAGGCCCCACCGTGGTTCGGG---------------------------------------
Ornithorhynchus_anatinus|19931 GAAGAC------------------------------------------------------
Mus_musculus|41300             cgcggtggagtagaggagagCGGACAC---------AGGGCTGCATTTCTTGAAACTGCT
Pan_troglodytes|10999          ------------------------------------------------------------
Equus_caballus|27079           ------------------------------------------------------------

Ornithorhynchus_anatinus|10495 ------------------------------------------------------------
Branchiostoma_floridae|24811   GGACTC------------------------------------------------------
Oryzias_latipes|15201          GGTCTG------------------------------------------------------
Tetraodon_nigroviridis|14180   GGCCTG------------------------------------------------------
Gasterosteus_aculeatus|1961    GGTCTG------------------------------------------------------
Fugu_rubripes|811              GGCCTG------------------------------------------------------
Ornithorhynchus_anatinus|19931 ------------------------------------------------------------
Xenopus_tropicalis|13887       GGCCTA------------------------------------------------------
Pteropus_vampyrus|12149        GGCCTC------------------------------------------------------
Dipodomys_ordii|14912          GGCCTG------------------------------------------------------
Ochotona_princeps|11698        GGCCTT------------------------------------------------------
Myotis_lucifugus|7745          GGCCTC------------------------------------------------------
Bos_taurus|4002                GGCCTG------------------------------------------------------
Macropus_eugenii|794           GGCCTT------------------------------------------------------
Echinops_telfairi|7444         GGCCTT------------------------------------------------------
Anolis_carolinensis|5970       GGCCTT------------------------------------------------------
Gallus_gallus|2358             GGTCTG------------------------------------------------------
Taeniopygia_guttata|232        GGTCTG------------------------------------------------------
Procavia_capensis|4959         GGCCTT------------------------------------------------------
Loxodonta_africana|13027       GGCCTT------------------------------------------------------
Monodelphis_domestica|28463    GGCCTT------------------------------------------------------
Felis_catus|40858              GGCCTC------------------------------------------------------
Sus_scrofa|3182                GGCCTC------------------------------------------------------
Callithrix_jacchus|41147       GGGCTG------------------------------------------------------
Rhesus_macaque|18815           GGGCTG------------------------------------------------------
Gorilla_gorilla|16246          GGGCTG------------------------------------------------------
Homo_sapiens|25349             GGGCTG------------------------------------------------------
Pan_troglodytes|10999          ------------------------------------------------------------
Cavia_porcellus|17761          GGCCTC------------------------------------------------------
Rattus_norvegicus|14545        GGCCTT------------------------------------------------------
Tursiops_truncatus|2478        GGCCTC------------------------------------------------------
Equus_caballus|27079           ------------------------------------------------------------
Canis_familiaris|12943         GGCCTG------------------------------------------------------

Ornithorhynchus_anatinus|10495 ---------------------CCTGGGAGGGCAAGAGAAACAAACGCCAGACCGCCG---
Branchiostoma_floridae|24811   ---------------------CGCGCTCACTTTGTCACCGACAACGTTAAAGTGGGGGCG
Oryzias_latipes|15201          ---------------------CTCTCAGCCACCCGCACAGACAACGTGCCCGCTTCGGGA
Tetraodon_nigroviridis|14180   ---------------------ATCTCCGCCACCCGCACCGACAACGTGCCCGTGGCCGGC
Gasterosteus_aculeatus|1961    ---------------------ATCTCCGCCACTCGCACGGACAACGTGCCCGTGGCTGGC
Fugu_rubripes|811              ---------------------ATCTCCGCCACCCGCACGGACAACGTGCCCGTCGCTGGA
Ornithorhynchus_anatinus|19931 ---------------------TTCTCTGTGGTTCGCTGTCTCTCTTCTGATTGTATCGGT
Xenopus_tropicalis|13887       ---------------------GTGGCAACTACAAGGACAGAGAATATAACTGTGGGAGGC
Pteropus_vampyrus|12149        ---------------------GCCGCTACCACCAGGACGGAGAACGTGACTGTGGGGGGC
Dipodomys_ordii|14912          ---------------------GCCGCCAACACCAGGACAGAGAACGTGACTGTGGGGGGC
Ochotona_princeps|11698        ---------------------GCAGCCACCACCAGGACGGAGAACGTGACCGTGGGAGGC
Myotis_lucifugus|7745          ---------------------GCTGCCACCACCAGGACGGAGAATGTGACCGTGGGGGGC
Bos_taurus|4002                ---------------------GCCGCAACCACCAGGACTGAGAATGTGACCGTGGGCGGC
Macropus_eugenii|794           ---------------------GCAGCAACGACCAGAACTGAGAATGTGACTGTGGGAGGC
Echinops_telfairi|7444         ---------------------GCTGCGACCACCAGGACTGAGAATGTGACGGTGGGAGGC
Anolis_carolinensis|5970       ---------------------GCAGCTACTACAAGAACAGAAAATGTATCCGTAGGTGGC
Gallus_gallus|2358             ---------------------GCAGCTACAACAAGAACAGAAAATGTTACTGTGGGAGGC
Taeniopygia_guttata|232        ---------------------GCAGCTACcacaagaacagaaaatgttACTGTGGGAGGC
Procavia_capensis|4959         ---------------------GCTGCAACAACCAGAACGGAGAATGTGACCGTGGGCGGC
Loxodonta_africana|13027       ---------------------GCCGCAACGACCAGAACTGAGAATGTGACTGTGGGAGGC
Monodelphis_domestica|28463    ---------------------GCAGCGACAACCAGAACTCAGAATGTGACCGTGGGAGGC
Felis_catus|40858              ---------------------GCTGCCACCACCAGGACAGAGAACGTGACCGTGGGGGGC
Sus_scrofa|3182                ---------------------ACGGCCAACACCAGGACAGAGAACGTGGCCGTGGGGGGC
Callithrix_jacchus|41147       ---------------------GCCGCCACAACCAGGACGGAGAACGTGACCGTGGGGGGC
Rhesus_macaque|18815           ---------------------GCTGCCACCACCAGGACAGAGAACGTGGCCGTGGGCGGC
Gorilla_gorilla|16246          ---------------------GCTGCCACCACCAGGACGGAGAATGTGACCGTAGGGGGC
Homo_sapiens|25349             ---------------------GCTGCCACCACCAGGACGGAGAATGTGACCGTTGGGGGC
Pan_troglodytes|10999          ------------------------------------------------------------
Cavia_porcellus|17761          ---------------------GCTGCTACCACCAGGACGGAGAATGTCACCGTGGGTGGC
Rattus_norvegicus|14545        ---------------------GCTGCTACCACCAGGACTGAGAATGTGACTGTGGGCGGC
Tursiops_truncatus|2478        ---------------------GCTGCCACCACCAGGACGGAGAACGTGACCATGGGCGGC
Equus_caballus|27079           ------------------------------------------------------------
Canis_familiaris|12943         ---------------------ACTGCCACCACCAGGACAGAGAACGTGACCATGGGGGGC

Ornithorhynchus_anatinus|10495 ------------------CCCCCCCTCGGTCCGGAAAGGGGGCCAGCTGGGTGG------
Pan_troglodytes|10999          ------------------------------------------------------------
Equus_caballus|27079           ------------------------------------------------------------

Ornithorhynchus_anatinus|10495 ---------------------------------------------CCGGAGCGG------
Branchiostoma_floridae|24811   TCT------------------------------------------CAGAAGGGC------
Oryzias_latipes|15201          GTG------------------------------------------GAGAACCGC------
Tetraodon_nigroviridis|14180   GTG------------------------------------------GAAAACCGC------
Gasterosteus_aculeatus|1961    GTG------------------------------------------GAAAACCGC------
Fugu_rubripes|811              GTG------------------------------------------GAAAACCGC------
Ornithorhynchus_anatinus|19931 CTA------------------------------------------CTACCCTGG------
Xenopus_tropicalis|13887       GTA------------------------------------------GAAAATAGA------
Pteropus_vampyrus|12149        GTG------------------------------------------GAGAATCGA------
Dipodomys_ordii|14912          GTG------------------------------------------GAGAACAGA------
Ochotona_princeps|11698        NNN------------------------------------------NNNNNNNNN------
Myotis_lucifugus|7745          NNN------------------------------------------NNNNNNNGA------
Bos_taurus|4002                ATG------------------------------------------GAGAACAGG------
Macropus_eugenii|794           GTG------------------------------------------GAGAACAGA------
Echinops_telfairi|7444         NNN------------------------------------------NNNNNNNNN------
Anolis_carolinensis|5970       GTA------------------------------------------GAGAACCGG------
Gallus_gallus|2358             GTA------------------------------------------GAGAACAGA------
Taeniopygia_guttata|232        GTA------------------------------------------GAAAACAGA------
Procavia_capensis|4959         GTG------------------------------------------GAGAATAGA------
Loxodonta_africana|13027       GTG------------------------------------------GAGAACAGA------
Monodelphis_domestica|28463    GTG------------------------------------------GAAAACAGA------
Felis_catus|40858              NNN------------------------------------------NNNNNNNNN------
Sus_scrofa|3182                GTG------------------------------------------GAGAACAGA------
Callithrix_jacchus|41147       GTG------------------------------------------GAGAATAGA------
Rhesus_macaque|18815           GTG------------------------------------------GAGAATAGA------
Gorilla_gorilla|16246          GTG------------------------------------------GAGAATAGA------
Homo_sapiens|25349             GTG------------------------------------------GAGAATAGA------
Pan_troglodytes|10999          ------------------------------------------------------------
Cavia_porcellus|17761          GTG------------------------------------------GAGAACAGA------
Rattus_norvegicus|14545        GTG------------------------------------------GAGAATAGA------
Tursiops_truncatus|2478        GTG------------------------------------------GAGAATAGA------
Equus_caballus|27079           ------------------------------------------------------------
Canis_familiaris|12943         GTG------------------------------------------GAGAACAGA------

Ornithorhynchus_anatinus|10495 ---------------------------------------------------ACCGGGACG
Branchiostoma_floridae|24811   ---------------------AGAATATGGATGGCTGCAGGAATGGTGGTGCTGGGGGTG
Oryzias_latipes|15201          ---------------------AGGCCCATGCTTGTAGCTGCAATAATCTTCATCAGTATT
Tetraodon_nigroviridis|14180   ---------------------AGGCCGATGCTTCTGGCAGCGATAATATTCATCAGCATC
Gasterosteus_aculeatus|1961    ---------------------AGGCCCATGCTGGTGGCAGCGATCATATTCATCAGCATG
Fugu_rubripes|811              ---------------------CGCTCGATGCTCCTGGCGGCgatcatcttcatcagcatc
Ornithorhynchus_anatinus|19931 ---------------------AATCATCcaTTGGTAGCCTCGATCGTATTTATCAGCTTT
Xenopus_tropicalis|13887       ---------------------AAACAAATGCTGGTAGCATCTATTGTTTTTATAAGCTTT
Pteropus_vampyrus|12149        ---------------------AGGCAAATGTTGGTAGCAGCCATTGTGTTTATCAGCTTT
Dipodomys_ordii|14912          ---------------------AGACAAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Ochotona_princeps|11698        ---------------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Myotis_lucifugus|7745          ---------------------AGGCAAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Bos_taurus|4002                ---------------------AAACAAATGCTGGTGGCGGCCATCGTGTTCGTCAGCTTT
Macropus_eugenii|794           ---------------------AGACAAATGTTGGTAGCTGCCATAGTATTCATCAGCTTT
Echinops_telfairi|7444         ---------------------NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Anolis_carolinensis|5970       ---------------------AAGCAAATGCTGATAGCATCCATTGTGTTCATCAGCTTT
Gallus_gallus|2358             ---------------------AGACAAATGTTAGTAGCCTCCATCGTGTTTATCAGCTTT
Taeniopygia_guttata|232        ---------------------AGACCAATAtTGGTTGCCTCTATCGTGTTTATCAGCTTT
Procavia_capensis|4959         ---------------------AGGCAAATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Loxodonta_africana|13027       ---------------------AGGCAAATGTTGGTAGCAGCGATCGTGTTTATCAGCTTT
Monodelphis_domestica|28463    ---------------------AGACAAATGTTGGTAGCAGCCATAGTATTTATCAGCTTT
Felis_catus|40858              ---------------------NNNNNNNNNCTGGTCGCGGCCATCGTGTTCATCAGCTTC
Sus_scrofa|3182                ---------------------CGGCAAATGCTGGTGGCGGCCGTCGTGTTCATCAGCTTC
Callithrix_jacchus|41147       ---------------------AGACAAATGGTAAGAAAGTTCATCGAAACTTCCAACTGT
Rhesus_macaque|18815           ---------------------AGGCAAATGCTGGTGGCAGCGATTGTGTTCATCAGTTTT
Gorilla_gorilla|16246          ---------------------AGGCAAATGCTGGTGGCAGCGATCGTGTTTATCAGTTTT
Homo_sapiens|25349             ---------------------AGGCAAATGCTGGTGGCAGCGATCGTGTTTATCAGTTTT
Pan_troglodytes|10999          ------------------------------------------------------------
Cavia_porcellus|17761          ---------------------AGACAAATGCTGGTGGCAGCCATTGTGTTCATCAGCTTT
Rattus_norvegicus|14545        ---------------------AGACAAATGCTGGTGGCGGCCATTGTGTTCCTCAGCTTT
Tursiops_truncatus|2478        ---------------------AAGCAAATGCTGGTGGCGGCCATCGTGTTCGTCAGCTTC
Equus_caballus|27079           ---------------------------CAGCTGGTGGCAGCCGTGGTGTTCCTCAGCTTC
Canis_familiaris|12943         ---------------------AGGCAGGTGCTGTTCGCGGCCATCGTGTTCATCAGCTTT

Pan_troglodytes|10999          ------------------------------------------------------------

Pan_troglodytes|10999          ------------------------------------------------------------

Ornithorhynchus_anatinus|10495 CGCTGGCCG---------------------------------------------------
Branchiostoma_floridae|24811   GGTTAC------------------------------------------------------
Oryzias_latipes|15201          GGCTATGCTTATGACAGCTACAGTGTAGAGgatcaaaaaatctttttttcaaaactgttc
Gasterosteus_aculeatus|1961    GGCTACGCCTACGACAACTACTATGCTGAG------------------------------
Fugu_rubripes|811              GGCTACGCCTATGACAGCTACTACACAGAG------------------------------
Ornithorhynchus_anatinus|19931 GGATTCGTCTACGATGTTTATCAGACAGAG------------------------------
Xenopus_tropicalis|13887       GGGATTGCATATGACTCTTACCAGACTGAA------------------------------
Pteropus_vampyrus|12149        NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN------------------------------
Dipodomys_ordii|14912          GGGTACCTGTATGATGTTTATGAGACAGAG------------------------------
Ochotona_princeps|11698        GGACACTTCTATGACGTCCACCACACGGAG------------------------------
Myotis_lucifugus|7745          GGATACTTGCCCGACGTCTACCAGACGGAG------------------------------
Bos_taurus|4002                GGCTACCTACATGACGTCCACCAGACGGAG------------------------------
Macropus_eugenii|794           GGATTCTTGTATGACGTCTACCAGACCGAG------------------------------
Echinops_telfairi|7444         GGATATTTATATGACATCTATCAGACAGAG------------------------------
Anolis_carolinensis|5970       GGATTCCTATATGATGTCTACCAGACAGAG------------------------------
Gallus_gallus|2358             GGATTCCTATATGATGCCTACCAAACAGAG------------------------------
Taeniopygia_guttata|232        GGATTCCTATATGATGCCTACCAGACTGAG------------------------------
Procavia_capensis|4959         GGATACTTATACGATGTCTACCAGACAGAG------------------------------
Loxodonta_africana|13027       GGATATTTATACGATGTCTACCAAACAGAG------------------------------
Monodelphis_domestica|28463    GGATTCTTATATGACGTCTACCAGACCGAG------------------------------
Mus_musculus|41300             GGGTACTTGTATGACGTCTATCAGACAGAG------------------------------
Felis_catus|40858              GGTTATGTGCACGACGCCTACCAGACAGAG------------------------------
Callithrix_jacchus|41147       GGTGGGGTGGATGAGGTGGCGGGCACCAGG------------------------------
Rhesus_macaque|18815           TGTCACCTCCCACAAGGCAGCCCTGCCTTG------------------------------
Gorilla_gorilla|16246          GGGTACTTGTACGACGTCTATCAGACAGAG------------------------------
Homo_sapiens|25349             GGGTACTTGTACGATGTCTACCAGACAGAG------------------------------
Pan_troglodytes|10999          ------------------------------------------------------------
Cavia_porcellus|17761          GGGTACTTGTATGACGTCTACCAGACTGAG------------------------------
Rattus_norvegicus|14545        GGGTACTTGTACGATGTCTATCAGACAGAG------------------------------
Tursiops_truncatus|2478        GGCTACCTGCACGATGTCTACCAGACGGAG------------------------------
Equus_caballus|27079           GGGTACCTGCAGGACGTCTACCAGACAGAG------------------------------
Canis_familiaris|12943         GGCTACGTGCACGACACCTACCAGACGGAG------------------------------

Ornithorhynchus_anatinus|10495 ------------------------------------CTCGGGGCG------------GGA
Branchiostoma_floridae|24811   ------------------------------------GTAACGTGCGGTGAGGCCGGGTAC
Oryzias_latipes|15201          CTGTGG------------------------------AAGACATGC------------GGC
Gasterosteus_aculeatus|1961    ------------------------------------GTGCCGTGC------------CGT
Fugu_rubripes|811              ------------------------------------GTGACATGT------------CGT
Ornithorhynchus_anatinus|19931 ------------------------------------GTCATGTGT------------TAC
Xenopus_tropicalis|13887       ------------------------------------GTGACATGC------------TAT
Pteropus_vampyrus|12149        ------------------------------------NNNNNNNNN------------NNN
Dipodomys_ordii|14912          ------------------------------------NNNNNNNNN------------NNN
Ochotona_princeps|11698        ------------------------------------NNNNNNNNN------------NNN
Myotis_lucifugus|7745          ------------------------------------NNNNNNNNN------------NNN
Bos_taurus|4002                ------------------------------------GTCACCTGT------------CAC
Macropus_eugenii|794           ------------------------------------GTCACCTGC------------CAT
Echinops_telfairi|7444         ------------------------------------GTCACCTGT------------CAC
Anolis_carolinensis|5970       ------------------------------------GTGACATGT------------TAC
Gallus_gallus|2358             ------------------------------------GTGACATGT------------TAT
Taeniopygia_guttata|232        ------------------------------------GTTACATGT------------CAT
Procavia_capensis|4959         ------------------------------------GTGACCTGT------------CAC
Loxodonta_africana|13027       ------------------------------------GTCACCTGT------------CAC
Monodelphis_domestica|28463    ------------------------------------GTCACCTGT------------CAC
Mus_musculus|41300             ------------------------------------GTCACCTGC------------TAC
Felis_catus|40858              ------------------------------------GTCACCTGT------------CAC
Callithrix_jacchus|41147       ------------------------------------GTCACCTGT------------CAC
Rhesus_macaque|18815           ------------------------------------GTCACCTGT------------CAC
Gorilla_gorilla|16246          ------------------------------------GTCACCTGT------------CAC
Homo_sapiens|25349             ------------------------------------GTCACCTGT------------CAC
Pan_troglodytes|10999          ------------------------------------GTCACCTGT------------CAC
Cavia_porcellus|17761          ------------------------------------GTCACCTGC------------TAC
Rattus_norvegicus|14545        ------------------------------------GTCACCTGC------------TAC
Tursiops_truncatus|2478        ------------------------------------GTTACCTGC------------CAC
Equus_caballus|27079           ------------------------------------GTCACCTGC------------CAC
Canis_familiaris|12943         ------------------------------------GTCACCTGT------------CAC

Ornithorhynchus_anatinus|10495 TTCCGCCCC------GGCGGCGGCGGCGACGACGGTGAGGGCGACTCG------------
Fugu_rubripes|811              TCGTTTGAC------AAATCGTGCAAGCTGAAGCTGAGGAGCAACacctgctactgctgc

Ornithorhynchus_anatinus|10495 ------------------GAGGGTCCGGCGCCG---GCCCCCCCACCCGCCCGA------
Oryzias_latipes|15201          TACCTGTAC---------AACTGTGAGAGACCA---GACTACCACACACACTAT------
Tetraodon_nigroviridis|14180   TACCTGTAC---------AACTGTGAGAGCACA---GAGTACCACACACAGTAC------
Gasterosteus_aculeatus|1961    TACCTGTAC---------AACTGTGCGAGCACG---GAGTTCCACACGCAGTAC------
Fugu_rubripes|811              tacctGTAC---------AACTGTGAGAGCACA---GAGTACCACACACAGTAC------
Ornithorhynchus_anatinus|19931 GACCTGTAT---------AACTGTGAAAACGCT---GAGCAGTCCAGCAGCTAC------
Xenopus_tropicalis|13887       GATCTCTAC---------AACTGTGAAAGTCCA---GATCCACCCTCCAGCTAC------
Pteropus_vampyrus|12149        NNNNNNNNN---------NNNNNNNNNNNCACC---GAGTACTCTCCCACATAC------
Dipodomys_ordii|14912          NNNNNNNNN---------NNNNNNNNNNNCTCT---GAGCACTCACCTGCCTAC------
Ochotona_princeps|11698        NNNNNNNNN---------NNNNNNNNNNNNNNN---NNNNNNNNNNNNNCTTAC------
Myotis_lucifugus|7745          NNNNNNNNN---------NNNNNNNNNNNCACC---GAGTACTCTCCCACCTAC------
Bos_taurus|4002                GACCTCTAC---------GACTGCCAGGGCACC---CAGAGCCCCCCCATTTAT------
Macropus_eugenii|794           GACTTGTAC---------AACTGTGAGAACACA---GAACACTCTACCAGTTAC------
Echinops_telfairi|7444         GACCTGTAC---------CACTGCGAAAACACC---GAGCACTCCACGAGCTAC------
Anolis_carolinensis|5970       GATTTGTAC---------AACTGTGAAAACTCT---GAACATGCAACCAGCTAC------
Gallus_gallus|2358             GACCTGTAC---------AACTGTGAGAACTCA---GAGCAGTCCTCCAGCTAC------
Taeniopygia_guttata|232        GATCTGTAC---------AACTGTGAGAATTCA---GACCAGTCCTCCAGCTAC------
Procavia_capensis|4959         GACCTGTAC---------AACTGTGATGGCACT---GAGCACTCTACAAACTAC------
Loxodonta_africana|13027       GACCTGTAC---------AACTGTGGTAGCACA---GAGCACTCTACAAGTTAC------
Monodelphis_domestica|28463    GACTTATAC---------AACTGTGAGAACACA---GAACACTCTACCAGTTAC------
Mus_musculus|41300             GACCTCTAC---------GCCTGTGGGAGCACT---GAGCCCTCGCCTGCCTAC------
Felis_catus|40858              GACCTCTAC---------AATTGTCAGAGCACT---GAACCTTCTCCCACCTAC------
Callithrix_jacchus|41147       GACCTGTAC---------ACCTGCGGGAGTGCG---GAACCCTCACCCGCCTAC------
Rhesus_macaque|18815           GACCTCTac---------gcctgtgggagCCCA---GAGTCCTCGCCCGCCTAC------
Gorilla_gorilla|16246          GACCTCTAT---------GCCTGCGGGAGCACA---GAGCCCTCGCCTGCCTAC------
Homo_sapiens|25349             GACCTCTAT---------GCCTGCGGGAGCGCA---GAGCCCTCGCCCGCCTAC------
Pan_troglodytes|10999          GACCTCTAT---------GCCTGCGGGAGCGCA---GAGCCCTCGCCCGCCTAC------
Cavia_porcellus|17761          GACCTCTAC---------ACGTGTGAGAGTGCG---GAGCTGTCCCCCACTTAC------
Rattus_norvegicus|14545        GACCTCTAT---------GCCTGTGGGAGCGCA---GAGCCCTCGCCTGCCTAC------
Tursiops_truncatus|2478        GACCTCTAT---------GACTGCCACAGCACC---GAGCACCCGCCCACCTAC------
Equus_caballus|27079           GACCTGTAC---------CCCTGCCAGAGCTCC---GAGCACCCCCCCGCCTAC------
Canis_familiaris|12943         GACCTCTAC---------AACTGCCAGAGCACT---GAACACCCTCCTGCCTAT------

Ornithorhynchus_anatinus|10495 ------------CTCATGTGCAGTTGCTCTCCATCT------------------------
Oryzias_latipes|15201          TACCTGTACGAGGGggtcagcagctgcagggatgtG---ATCCACCTGTACCGTCTCCTG
Fugu_rubripes|811              TACGAGTTCACCGgggtcagcagctgctgggacgtG---ATCCACCTGCACCGCCTGCTG
                                              .*  .    **     .                            

Ornithorhynchus_anatinus|10495 ---TCGCCCACCAAGGTCGGTGTGGCCCCGCTGAGGGGCGGGCTG---------------
                                      * .      * .. .         *       *   *                

Ornithorhynchus_anatinus|10495 ---------------------------CAGCCTCCAGCGTCGGGCCCGGGCGGGCCAGGG

Branchiostoma_floridae|24811   CCTGCCACCCCCGTGGTGATC---------------------TACAATGGCGCAGGCCAG
Oryzias_latipes|15201          CCTCCT---CCTCACATCCTA---------------------TACAAC---CCCAAC---
Tetraodon_nigroviridis|14180   GCCGCCACCCCACATCTTGTA---------------------CAATCCCACCCAGCACAT
Gasterosteus_aculeatus|1961    CCGGCC---CCCCACATCCTG---------------------TACAAC---CCGACG---
Fugu_rubripes|811              CCTCCG---CCCCACATCTTG---------------------TACAAC---CCCACC---
Ornithorhynchus_anatinus|19931 CCGTCC---GCCCAGATCCTC---------------------TACAAC---CCAGCTCAG
Xenopus_tropicalis|13887       CCACCT---CCTCAGATTCTG---------------------TACAAT---CCAGCC---
Pteropus_vampyrus|12149        GCTCCA---CCTCAGATCCTC---------------------TACAAC---CCTGCC---
Dipodomys_ordii|14912          CCCCCA---CCTCAGATCCTC---------------------TACAAC---CCTGCC---
Ochotona_princeps|11698        GCCCCA---CCCCCCGCCATC---------------------TACAAC---CCGGCC---
Myotis_lucifugus|7745          GCTCCA---CCTCAGATCCTC---------------------TACAAC---CCTGCC---
Bos_taurus|4002                ATGGCA---CCTCGGGTCCTC---------------------TACGAC---CCCGCC---
Macropus_eugenii|794           NNNNNN---NNNNNNNNNNNN---------------------NNNNNN---NNNNNN---
Echinops_telfairi|7444         TCACCG---CCCCAGATCCTG---------------------TACAAT---CCCGCC---
Anolis_carolinensis|5970       CCACTG---CCGCAGATTCTT---------------------TATAAC---CCAGCT---
Gallus_gallus|2358             CCACCT---CCTCAGATCCTA---------------------TACAAC---CCTGCG---
Taeniopygia_guttata|232        CCTCCT---CCTCAGATCCTG---------------------TACAAT---CCTGCC---
Procavia_capensis|4959         TCTCCT---CCTCAGATCCTC---------------------TACAAT---CCCGCC---
Loxodonta_africana|13027       TCTCCT---CCTCAGATCCTC---------------------TACAAT---CCCGCC---
Monodelphis_domestica|28463    CCTCCT---CCTCAAATTCTC---------------------TACAAT---CCAGCG---
Mus_musculus|41300             CCGCCA---CCTCAGATTCTC---------------------TATAAC---CCTGCA---
Felis_catus|40858              GCTGCA---CCCCAGATCCTC---------------------TGCAAC---CCTGCC---
Sus_scrofa|3182                TCACCA---CCTCAGACCCTC---------------------TACAAC---CCCGCC---
Callithrix_jacchus|41147       GTCCCT---CCACAGACCCTC---------------------TACAAC---CCTGCC---
Rhesus_macaque|18815           GTCCCA---CCGCAGACCCTC---------------------TACAAC---CCTGCC---
Gorilla_gorilla|16246          GTCCCA---CCACAGACCCTC---------------------TACAAC---CCCGCC---
Homo_sapiens|25349             GTCCCA---CCACAGACCCTC---------------------TACAAC---CCCGCC---
Pan_troglodytes|10999          GTCCCA---CCACAGACCCTC---------------------TACAAC---CCCGCC---
Cavia_porcellus|17761          TCCCCA---CCTCAGATTCTC---------------------TACAAC---CCTGCC---
Rattus_norvegicus|14545        CCACCA---CCTCAGATCCTC---------------------TACAAC---CCAGCA---
Tursiops_truncatus|2478        ACAGCG---CCTCAGGCCCTC---------------------TACAAC---CCCGCC---
Equus_caballus|27079           GCTCTG---CCTCAGATCCTC---------------------TACAAC---CCCGCC---
Canis_familiaris|12943         GCTCTG---CCTCAGATCCTC---------------------TACAAC---CCCGCC---


Branchiostoma_floridae|24811   ------------CCCGCCTACCCCAACGGG------------------------------
Ochotona_princeps|11698        ACCTATCCTCTGCCACTTCAG---------------------------------------
Echinops_telfairi|7444         CCCTACCCTTTGCCTCTTCAG---------------------------------------
Equus_caballus|27079           TCCTATCCGCTGCCTCTGCAG---------------------------------------

Branchiostoma_floridae|24811   ------------------------GAGGGGCAGCAGCGACCAGGCAAC------------
Oryzias_latipes|15201          ---ATGCAG---------------CCGCAGGCACAGGGAGCCACCCAGGACCCGGGGGGA
Gasterosteus_aculeatus|1961    ------------------------CCGCAGCCTCAGGGGGCCACTCAGGAGCCGGGCGGC
Dipodomys_ordii|14912          TCCTTGCCG---------------GAGGATGTATGGCCTCCCAGCCAA------------
Ochotona_princeps|11698        ------------------------------------------------------------
Echinops_telfairi|7444         ------------------------------------------------------------
Felis_catus|40858              CCTCTGTCT---------------GAGGATTTGCAGCCTACGACC---------------
Tursiops_truncatus|2478        ------------------------------------------------------------
Equus_caballus|27079           ------------------------------------------------------------
Canis_familiaris|12943         CCTCTGTCT---------------GAGGATGTGCAGCCTCCC------------------

Branchiostoma_floridae|24811   ---------------------------------------------------------GAG
Ochotona_princeps|11698        ------------------------------------------------------------
Bos_taurus|4002                CAC---------------------CCCCTCAGCGCCCCCACCCACCTCCTCCCCGGGGAG
Echinops_telfairi|7444         ------------------------------------------------------------
Felis_catus|40858              ------------------------CCCCTCTCTGTGCCAGCCCACTTCCTTCCAGGAGAG
Equus_caballus|27079           ------------------------------------------------------------

Ornithorhynchus_anatinus|10495 GCTCAGTCGCCACTC---------
Branchiostoma_floridae|24811   AAACCACCCCGCTACTCCTTGTAG
Oryzias_latipes|15201          AAACCCCCACCGTACGCCTGCTGA
Tetraodon_nigroviridis|14180   AAACCCCCTCCGTACGCCTGCTGA
Gasterosteus_aculeatus|1961    AAGCCGCCTCCGTACGCCTGCTGA
Fugu_rubripes|811              AAACCCCCGCCGTACGCCTGCTGA
Ornithorhynchus_anatinus|19931 AAACCCCCGCCCTACGCGCCCTGA
Xenopus_tropicalis|13887       AAGCCACCACCATATGTCCCCTAA
Pteropus_vampyrus|12149        AAGCCTCCCCCCTACGCACCGTGA
Dipodomys_ordii|14912          AAGCCACCCCCATACGCACCCTGA
Ochotona_princeps|11698        ------------------------
Myotis_lucifugus|7745          AAGCCTCCCCCCTACGCACCATGA
Bos_taurus|4002                AAGCCCCCTCCCTACACACCGTGA
Macropus_eugenii|794           AAGCCTCCACCATATGCACCATGA
Echinops_telfairi|7444         ------------------------
Anolis_carolinensis|5970       AAGCCTCCACCATACATCCCT---
Gallus_gallus|2358             AAGCCTCCACCATATGCACCATAG
Taeniopygia_guttata|232        AAGCCTCCACCATATGCACCA---
Procavia_capensis|4959         AAACCTCCCCCCTATGCGCCGTGA
Loxodonta_africana|13027       AAACCTCCCCCCTACGCACCA---
Monodelphis_domestica|28463    AAGCCTCCACCATATGCACCATGA
Mus_musculus|41300             AAGCCACCCCCCTACGCACCCTGA
Felis_catus|40858              AAGCCTCCCCCCTACACTCCCTGA
Sus_scrofa|3182                AAGCCTCCCCCCTACGCACCCTGA
Callithrix_jacchus|41147       AAGCCACCCCCGTATGCACCCTGA
Rhesus_macaque|18815           AAGCCACCCCCGTATGCACCCTGA
Gorilla_gorilla|16246          AAGCCACCCCCCTACGCACCCTGA
Homo_sapiens|25349             AAGCCACCCCCCTACGCACCCTGA
Pan_troglodytes|10999          AAGCCACCCCCCTACGCACCCTGA
Cavia_porcellus|17761          AAGCCGCCCCCTTATGCCCCC---
Rattus_norvegicus|14545        AAGCCTCCCCCCTACGTACCCTGA
Tursiops_truncatus|2478        AAACCTCCCCCCTACGCACCGTGA
Equus_caballus|27079           ------------------------
Canis_familiaris|12943         AAGCCCCCCCCCTACACTCCATGA

multiple sequence alignment in CLUSTALW format

Ornithorhynchus_anatinus|16693 -----------------------------------------PPRGGQQPPASGPGGL---
Oryzias_latipes|5543           ------------------------------------------------------------
Tetraodon_nigroviridis|10151   ----------------------------------------------PCS-----SVE---
Gasterosteus_aculeatus|19674   ----------------------------------MQQPETQRTIQQTATEVLDPSVR---
Fugu_rubripes|44117            ---------------------------------------TSPEIQDPSGMILPSSNL---
Ornithorhynchus_anatinus|3085  ------------------------------------------------------HRA---
Xenopus_tropicalis|10570       ------------------------------------CLAMNPARHSSVLSATYKTGL---
Pteropus_vampyrus|11451        ------------------------------------MQPPALPVPGPLA-LLDTTEG---
Dipodomys_ordii|14015          ------------------------------------MQPLPPPVPGPLA-LLDTTEG---
Ochotona_princeps|10208        --------------------------------------------------------G---
Myotis_lucifugus|6977          --------------------------------------------------------G---
Bos_taurus|9203                ---------------------------------------RDPPRAQHLTHRLLLCPPPAE
Macropus_eugenii|735           --------------------------------------------------------Q---
Echinops_telfairi|5884         --------------------------------------------------------G---
Anolis_carolinensis|385        ----------------------------------------SPSPPPPTF-----TAH---
Gallus_gallus|19013            ---------------------------------------SSPSPPPPLF-----TGQ---
Taeniopygia_guttata|13087      ---------------------------------------------PSLS-----TGQ---
Procavia_capensis|4664         --------------------------------------------------------G---
Loxodonta_africana|9936        ------------------------------------------------------TEV---
Monodelphis_domestica|3862     ---------------------------------------PPPPVPGPLA-LLDAAGQ---
Mus_musculus|54411             ----------------------------------------MVGAEGRWR-EKGNDQR---
Felis_catus|6637               ---------------------------------------MQPPVPGPLA-LLDNTEG---
Sus_scrofa|10180               ------------------------------------------------------------
Callithrix_jacchus|32608       -----------------------------------------------------PTEG---
Rhesus_macaque|19237           ---------------------------------------MQPPVPGPPG-LLDAAEG---
Gorilla_gorilla|13074          ---------------------------------------MQPPVPGTLG-LLDPAEG---
Homo_sapiens|34026             ---------------------------------------MQPPVPGPLG-LLDPAEG---
Pan_troglodytes|507            ------------------------------------------------------------
Cavia_porcellus|13965          ----------------------------------------QAPVPGPLAALLDTTEG---
Rattus_norvegicus|11804        ------------------------------------------------------TEG---
Tursiops_truncatus|2340        ------------------------------------MQPLPPPVPGPLA-LLDTTEG---
Equus_caballus|13              ------------------------------------------------------------
Canis_familiaris|13772         ---------------------------------------MQPSVPGPLA-LLDATEG---

Ornithorhynchus_anatinus|16693 ---------------GPRCRQAPPWFG---------------------------------
Branchiostoma_floridae|31146   QTNRTLSDVNFRCKEYVSKQKRAVQLCIVTLLVALGSFAVGL------------------
Oryzias_latipes|5543           -----------------RRERTALWVTTALLVLALVVLTVGL------------------
Tetraodon_nigroviridis|10151   ---------------YRRRRRSALWVTVSLLALSLVVLTVGL------------------
Gasterosteus_aculeatus|19674   ---------------YLRRRKAALWVTVSLLALALVVLAVGL------------------
Fugu_rubripes|44117            ---------------PKRRRRSALWVTVALLALSLVVLTIGL------------------
Ornithorhynchus_anatinus|3085  ---------------VCQKKED--------------------------------------
Xenopus_tropicalis|10570       ---------------FAKRKRTSLLFAISLLVLSLFILTIGL------------------
Pteropus_vampyrus|11451        ---------------FVRRKKTSLWFVGSLLVVSVFILTIGL------------------
Dipodomys_ordii|14015          ---------------FARRKKISLWFLGSLLLVSALILTVGL------------------
Ochotona_princeps|10208        ---------------FGKRKRTAQWFVGSLLAVSILIVTIGL------------------
Myotis_lucifugus|6977          ---------------FGRRKKTSLWFVGSLLVVSVFILTIGL------------------
Bos_taurus|9203                ---------------FVRRKKTALWFVGALLAVSASILTVGL------------------
Macropus_eugenii|735           ---------------FAKRKQISLWFAVSLLVASIFILTIGL------------------
Echinops_telfairi|5884         ---------------FARRKKTSLWFAVSLLVVSTFILTIGL------------------
Anolis_carolinensis|385        ---------------FAKRKKTSLWFTISLLVVSVFILTIGL------------------
Gallus_gallus|19013            ---------------FAKRKKTSLWFTVSLLVVSIFILTIGL------------------
Taeniopygia_guttata|13087      ---------------FAKRKKTSLWFTVALLVVSVFILTIGL------------------
Procavia_capensis|4664         ---------------FAKRKKTSLWFAISLLVVSIFILTIGL------------------
Loxodonta_africana|9936        ---------------FAKRKKTSLWFAVSLLVVSILILTIGL------------------
Monodelphis_domestica|3862     ---------------FARRKQISLSFAVSLLVVSIFILTIGL------------------
Mus_musculus|54411             ---------------RGRKKRGGVEESGH---RAAFLETAGTLKPNHRAGGASGHCPPSG
Felis_catus|6637               ---------------FARR-KTSFWFVGSLLVASVCILTIGL------------------
Sus_scrofa|10180               ---------------FARRKKTSLWFVGSLLVVSTFILTLGL------------------
Callithrix_jacchus|32608       ---------------LARRKKTSLWFVGSLLLVSVLIVTVGL------------------
Rhesus_macaque|19237           ---------------LSRRKKTSLWFVGSLLLVSVLIVTVGL------------------
Gorilla_gorilla|13074          ---------------LSRRKKTSLWFVGSLLLVSVLIVTVGL------------------
Homo_sapiens|34026             ---------------LSRRKKTSLWFVGSLLLVSVLIVTVGL------------------
Pan_troglodytes|507            ------------------------------------------------------------
Cavia_porcellus|13965          ---------------FARRKRTSLWFVGSLLLVSALILTIGL------------------
Rattus_norvegicus|11804        ---------------FARRKKISLWFVGSLLLVSTLILTIGL------------------
Tursiops_truncatus|2340        ---------------FARRKKTSLWFVGSLLVVSTSILTVGL------------------
Equus_caballus|13              ------------------------------------------------------------
Canis_familiaris|13772         ---------------FAKRKKTSLWFVGSLLVVSVSILTVGL------------------

Ornithorhynchus_anatinus|16693 -------PGRARETNARPP-------PPLGPERGPAGW-----------------PER--
Branchiostoma_floridae|31146   -------RAHFVTDNVKVGAFWPGIVVAVGSLVSLLGVCKS--------------QKG--
Oryzias_latipes|5543           -------LSATRTDNVPASGYYPGIALSFGAFLGIVGIYLV--------------ENR--
Tetraodon_nigroviridis|10151   -------ISATRTDNVPVAGYYPGIILSFGAFLGIVGIHLV--------------ENR--
Gasterosteus_aculeatus|19674   -------ISATRTDNVPVAGYYAGITLSFGAFLGIVGIHLV--------------ENR--
Fugu_rubripes|44117            -------ISATRTDNVPVAGYYPGIILSFGAFLGIVGIHLV--------------ENR--
Ornithorhynchus_anatinus|3085  -------FSVVRCLSSDCIGFHPDHWLGNDHQDGERHRGRL--------------LPW--
Xenopus_tropicalis|10570       -------VATTRTENITVGGYYPGIILGFGSFLGIIGIHLV--------------ENR--
Pteropus_vampyrus|11451        -------AATTRTENVTVGGYYPGIILGFGSFLGIIGINLV--------------ENR--
Dipodomys_ordii|14015          -------AANTRTENVTVGGYYPGIILGFGAFLGLTGVNLV--------------ENR--
Ochotona_princeps|10208        -------AATTRTENVTVGGYYPGIIXXXXXXXXXXXXXXX--------------XXX--
Myotis_lucifugus|6977          -------AATTRTENVTVGGYYPGIIXXXXXXXXXXXXXXX--------------XXX--
Bos_taurus|9203                -------AATTRTENVTVGGYYPGIILGFGSFLGIIGINLM--------------ENR--
Macropus_eugenii|735           -------AATTRTENVTVGGYYPGIILGFGSFLGIIGINLV--------------ENR--
Echinops_telfairi|5884         -------AATTRTENVTVGGYYPGIIXXXXXXXXXXXXXXX--------------XXX--
Anolis_carolinensis|385        -------AATTRTENVSVGGYYPGIILGFGSFLGIIGIHLV--------------ENR--
Gallus_gallus|19013            -------AATTRTENVTVGGYYPGIILGFGSFLGIVGIHLV--------------ENR--
Taeniopygia_guttata|13087      -------AATTRTENVTVGGYYPGIVLGFGSFLGIVGIYLV--------------ENR--
Procavia_capensis|4664         -------AATTRTENVTVGGYYPGIILGFGSFLGIIGINLV--------------ENR--
Loxodonta_africana|9936        -------AATTRTENVTVGGYYPGIILGFGSFLGIIGINLV--------------ENR--
Monodelphis_domestica|3862     -------AATTRTQNVTVGGYYPGIILGFGSFLGIIGINLV--------------ENR--
Felis_catus|6637               -------AATTRTENVTVGGYYPGVIXXXXXXXXXXXXXXX--------------XXX--
Sus_scrofa|10180               -------TANTRTENVAVGGYYPGIVLGFGSFLGIIGIHLV--------------ENR--
Callithrix_jacchus|32608       -------AATTRTENVTVGGYYPGIILGFGSFLGIIGIHLV--------------ENR--
Rhesus_macaque|19237           -------AATTRTENVAVGGYYPGVILGFGSFLGIIGINLV--------------ENR--
Gorilla_gorilla|13074          -------AATTRTENVTVGGYYPGIILGFGSFLGIIGINLV--------------ENR--
Homo_sapiens|34026             -------AATTRTENVTVGGYYPGIILGFGSFLGIIGINLV--------------ENR--
Pan_troglodytes|507            ------------------------------------------------------------
Cavia_porcellus|13965          -------AATTRTENVTVGGYYPGIILGFGSFLGIIGIHLV--------------ENR--
Rattus_norvegicus|11804        -------AATTRTENVTVGGYYPGIILGFGSFLGIIGIHLV--------------ENR--
Tursiops_truncatus|2340        -------AATTRTENVTMGGYYPGIILGFGSFLGIIGINLV--------------ENR--
Equus_caballus|13              ------------------------------------------------------------
Canis_familiaris|13772         -------TATTRTENVTMGGYYPGIILGFGAFLGIIGINLV--------------ENR--

Ornithorhynchus_anatinus|16693 -----------------TGTGRAARSPERRRPGMGPASHPAAPPPPLTQGRYTPPSSPPV
Pan_troglodytes|507            ------------------------------------------------------------

Ornithorhynchus_anatinus|16693 RWP-----------------------------LGA----GFRP--GGGGDDGEGDS----
Branchiostoma_floridae|31146   GY------------------------------VTCGEAGYWTF--GKCDMVVYHRTCYCC
Oryzias_latipes|5543           GYAYDSYSVEDQKIFFSKLFLW----------KTC----GTLN--EHCKLQVKSNTCYCC
Gasterosteus_aculeatus|19674   GYAYDNYYAE----------------------VPC----RSFD--KTCKLKLRSNTCYCC
Fugu_rubripes|44117            GYAYDSYYTE----------------------VTC----RSFD--KSCKLKLRSNTCYCC
Ornithorhynchus_anatinus|3085  GFVYDVYQTE----------------------VMC----YTLT--SKCQLKVKSNTCYCC
Xenopus_tropicalis|10570       GIAYDSYQTE----------------------VTC----YRED--NTCRLRLKTHTCYCC
Pteropus_vampyrus|11451        XXXXXXXXXX----------------------XXX----XXXX--XXXXXXXXXXXXXXX
Dipodomys_ordii|14015          GYLYDVYETE----------------------XXX----XXXX--XXXXXXXXXXXXXXX
Ochotona_princeps|10208        GHFYDVHHTE----------------------XXX----XXXX--XXXXXXXXXXXXXXX
Myotis_lucifugus|6977          GYLPDVYQTE----------------------XXX----XXXX--XXXXXXXXXXXXXXX
Bos_taurus|9203                GYLHDVHQTE----------------------VTC----HSPN--GGCPLKVKSNTCYCC
Macropus_eugenii|735           GFLYDVYQTE----------------------VTC----HSLT--SKCQLKVKSNTCYCC
Echinops_telfairi|5884         GYLYDIYQTE----------------------VTC----HSLT--GHCQLKVKSNTCYCC
Anolis_carolinensis|385        GFLYDVYQTE----------------------VTC----YTLN--SKCLLKVKSNTCYCC
Gallus_gallus|19013            GFLYDAYQTE----------------------VTC----YTLN--TKCQLKVKSNTCYCC
Taeniopygia_guttata|13087      GFLYDAYQTE----------------------VTC----HTLN--SKCQLKVKSNTCYCC
Procavia_capensis|4664         GYLYDVYQTE----------------------VTC----HTLN--GKCQLKVKSNTCYCC
Loxodonta_africana|9936        GYLYDVYQTE----------------------VTC----HSLN--GKCQLKVKSNTCYCC
Monodelphis_domestica|3862     GFLYDVYQTE----------------------VTC----HSLT--SKCQLKVKSNTCYCC
Mus_musculus|54411             GYLYDVYQTE----------------------VTC----YSLN--GRCQLKVRSNTCYCC
Felis_catus|6637               GYVHDAYQTE----------------------VTC----HSFN--GQCLLKVKSSTCYCC
Callithrix_jacchus|32608       GGVDEVAGTR----------------------VTC----HSLN--GKCQLKVRSNTCYCC
Rhesus_macaque|19237           CHLPQGSPAL----------------------VTC----HSLD--GQCQLKVRSNTCYCC
Gorilla_gorilla|13074          GYLYDVYQTE----------------------VTC----HSLD--GKCQLKVRSNTCYCC
Homo_sapiens|34026             GYLYDVYQTE----------------------VTC----HSLD--GKCQLKVRSNTCYCC
Pan_troglodytes|507            --------------------------------VTC----HSLD--GKCQLKVRSNTCYCC
Cavia_porcellus|13965          GYLYDVYQTE----------------------VTC----YSLM--GKCQLKVRSNTCYCC
Rattus_norvegicus|11804        GYLYDVYQTE----------------------VTC----YSLS--GRCQLKVRSNTCYCC
Tursiops_truncatus|2340        GYLHDVYQTE----------------------VTC----HSLN--GRCQLKVKSNTCYCC
Equus_caballus|13              GYLQDVYQTE----------------------VTC----HSPN--GKCQLKVKSNTCYCC
Canis_familiaris|13772         GYVHDTYQTE----------------------VTC----HSSN--GQCQLKVRSSTCYCC

Ornithorhynchus_anatinus|16693 ------EGPAP-APPPAR------LMCSCSPS---------SPTKVGVAPLRGGL-----
                                                        :  *             .. :.   :  .:     


Branchiostoma_floridae|31146   ----PAYPNG------------------EGQQRPGN-----------------------E
Ochotona_princeps|10208        TYPLPLQ-----------------------------------------------------
Echinops_telfairi|5884         PYPLPLQ-----------------------------------------------------
Felis_catus|6637               SYPLPLQRCGHLPASTPRDPPLS-----EDLQPTT-------------PLSVPAHFLPGE
Tursiops_truncatus|2340        SYPLPLQMCSLLPPAPAR--------------------------PPAPPIFALTHFLPGE
Equus_caballus|13              SYPLPLQ-----------------------------------------------------
Canis_familiaris|13772         SYPLPLQRCGGFPASTPRDPPLS-----EDVQPP-----------NTPSLCAPAHFLPGE

Ornithorhynchus_anatinus|16693 AQSPL--
Branchiostoma_floridae|31146   KPPRYSL
Oryzias_latipes|5543           KPPPYAC
Tetraodon_nigroviridis|10151   KPPPYAC
Gasterosteus_aculeatus|19674   KPPPYAC
Fugu_rubripes|44117            KPPPYAC
Ornithorhynchus_anatinus|3085  KPPPYAP
Xenopus_tropicalis|10570       KPPPYVP
Pteropus_vampyrus|11451        KPPPYAP
Dipodomys_ordii|14015          KPPPYAP
Ochotona_princeps|10208        -------
Myotis_lucifugus|6977          KPPPYAP
Bos_taurus|9203                KPPPYTP
Macropus_eugenii|735           KPPPYAP
Echinops_telfairi|5884         -------
Anolis_carolinensis|385        KPPPYIP
Gallus_gallus|19013            KPPPYAP
Taeniopygia_guttata|13087      KPPPYAP
Procavia_capensis|4664         KPPPYAP
Loxodonta_africana|9936        KPPPYAP
Monodelphis_domestica|3862     KPPPYAP
Mus_musculus|54411             KPPPYAP
Felis_catus|6637               KPPPYTP
Sus_scrofa|10180               KPPPYAP
Callithrix_jacchus|32608       KPPPYAP
Rhesus_macaque|19237           KPPPYAP
Gorilla_gorilla|13074          KPPPYAP
Homo_sapiens|34026             KPPPYAP
Pan_troglodytes|507            KPPPYAP
Cavia_porcellus|13965          KPPPYAP
Rattus_norvegicus|11804        KPPPYVP
Tursiops_truncatus|2340        KPPPYAP
Equus_caballus|13              -------
Canis_familiaris|13772         KPPPYTP