Orthologs Set ID: EOG4006CW

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Bos taurus 9435 1828, 2024, 2314, 2448
Callithrix jacchus 32783 1828, 2024, 2314, 2448
Canis familiaris 1087 137, 182, 236, 415, 549, 695, 743, 859, 1009, 1297, 1434, 1575, 1598, 1626, 1644, 1750, 1794, 2024, 2314, 2448
Cavia porcellus 21226 1828, 2024, 2314, 2448
Choloepus hoffmanni 9874 2314, 2448, 2450
Dasypus novemcinctus 11947 1828, 2542, 2575, 2596
Echinops telfairi 10237 1828, 2024, 2277, 2289, 2314
Gorilla gorilla 20046 1828, 2024, 2314, 2448
Homo sapiens 40868 1828, 2024, 2314, 2448
Loxodonta africana 17689 1828, 2024, 2113, 2337, 2376, 2421, 2448
Macropus eugenii 1051 1869, 1901, 2010, 2300, 2310, 2382
Macropus eugenii 14166 1901, 2028, 2300, 2314, 2448
Microcebus murinus 18139 1831, 2024, 2277, 2314, 2448
Mus musculus 38504 1828, 2024, 2314, 2448
Ornithorhynchus anatinus 7406 2028, 2056, 2110, 2307, 2448
Oryctolagus cuniculus 25997 2024, 2115, 2314, 2448
Otolemur garnettii 14939 1839, 2024, 2277, 2314
Pan troglodytes 19613 1828, 2024, 2314, 2448
Pongo abelii 14506 1828, 2024, 2314, 2448
Procavia capensis 7842 1828, 2024, 2314, 2322, 2370, 2416, 2429, 2438, 2448, 2565, 2568
Rattus norvegicus 1670 1828, 2024, 2314, 2448
Rhesus macaque 21437 2024, 2277, 2314, 2448
Sorex araneus 3006 1956, 2024, 2277, 2314
Tursiops truncatus 5417 1890, 1905, 2024, 2314, 2448

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Bos taurus 9435 ENSBTAT00000031780 526736 ENSBTAG00000015129 KLK10 bosTau4
Callithrix jacchus 32783 ENSCJAT00000012229 100403540 ENSCJAG00000006295 KLK10 calJac3
Canis familiaris 1087 ENSCAFT00000004619 ENSCAFG00000002886 KLK11 canFam2
Cavia porcellus 21226 ENSCPOT00000020778 100716705 ENSCPOG00000022082 KLK10 cavPor3
Choloepus hoffmanni 9874 ENSCHOT00000009867 ENSCHOG00000009851 KLK10 choHof1
Dasypus novemcinctus 11947 ENSDNOT00000010411 101416787 ENSDNOG00000010421 KLK10 dasNov2
Echinops telfairi 10237 ENSETET00000009963 ENSETEG00000009963 KLK10 TENREC
Gorilla gorilla 20046 ENSGGOT00000001437 101148793 ENSGGOG00000001427 KLK10 gorGor3
Homo sapiens 40868 ENST00000391805, NM_001077500 5655 ENSG00000129451 KLK10 hg19,GRCh37
Loxodonta africana 17689 ENSLAFT00000029708 100666907 ENSLAFG00000007611 KLK10 loxAfr3
Macropus eugenii 14166 ENSMEUT00000014157 ENSMEUG00000014123 Meug_1.0
Macropus eugenii 1051 ENSMEUT00000001049 ENSMEUG00000001048 Meug_1.0
Microcebus murinus 18139 ENSMICT00000016889 ENSMICG00000016894 KLK10 micMur1
Mus musculus 38504 ENSMUST00000014058 69540 ENSMUSG00000030693 Klk10 mm9
Ornithorhynchus anatinus 7406 ENSOANT00000021633 ENSOANG00000013715 KLK10 ornAna1
Oryctolagus cuniculus 25997 ENSOCUT00000021953 100344799 ENSOCUG00000025396 KLK10 oryCun2.0
Otolemur garnettii 14939 ENSOGAT00000014347 100953748 ENSOGAG00000014345 KLK10 otoGar1
Pan troglodytes 19613 ENSPTRT00000049327 ENSPTRG00000011367 KLK10 panTro2
Pongo abelii 14506 ENSPPYT00000011985 100435742 ENSPPYG00000010306 KLK10 ponAbe2
Procavia capensis 7842 ENSPCAT00000001359 ENSPCAG00000001368 KLK10 proCap1
Rattus norvegicus 1670 ENSRNOT00000048240 292850 ENSRNOG00000030281 Klk10 rn4
Rhesus macaque 21437 ENSMMUT00000021663 ENSMMUG00000015451 KLK10 rheMac2
Sorex araneus 3006 ENSSART00000002930 ENSSARG00000002947 KLK10 sorAra1
Tursiops truncatus 5417 ENSTTRT00000000900 101334169 ENSTTRG00000000900 turTru1

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Bos taurus 24438 ENSBTAP00000031726 526736 ENSBTAG00000015129 KLK10 bosTau4
Callithrix jacchus 24641 ENSCJAP00000011593 100403540 ENSCJAG00000006295 KLK10 calJac3
Canis familiaris 8894 ENSCAFP00000004273 ENSCAFG00000002886 KLK11 canFam2
Cavia porcellus 16731 ENSCPOP00000015765 100716705 ENSCPOG00000022082 KLK10 cavPor3
Choloepus hoffmanni 8723 ENSCHOP00000008715 ENSCHOG00000009851 KLK10 choHof1
Dasypus novemcinctus 10564 ENSDNOP00000008053 101416787 ENSDNOG00000010421 KLK10 dasNov2
Echinops telfairi 8081 ENSETEP00000008094 ENSETEG00000009963 KLK10 TENREC
Gorilla gorilla 15880 ENSGGOP00000001411 101148793 ENSGGOG00000001427 KLK10 gorGor3
Homo sapiens 31328 ENSP00000375681 5655 ENSG00000129451 KLK10 hg19,GRCh37
Loxodonta africana 10268 ENSLAFP00000025853 100666907 ENSLAFG00000007611 KLK10 loxAfr3
Macropus eugenii 968 ENSMEUP00000000965 ENSMEUG00000001048 Meug_1.0
Macropus eugenii 12884 ENSMEUP00000012875 ENSMEUG00000014123 Meug_1.0
Microcebus murinus 15393 ENSMICP00000015390 ENSMICG00000016894 KLK10 micMur1
Mus musculus 11875 ENSMUSP00000014058 69540 ENSMUSG00000030693 Klk10 mm9
Ornithorhynchus anatinus 22646 ENSOANP00000021630 ENSOANG00000013715 KLK10 ornAna1
Oryctolagus cuniculus 22867 ENSOCUP00000016868 100344799 ENSOCUG00000025396 KLK10 oryCun2.0
Otolemur garnettii 12855 ENSOGAP00000012854 100953748 ENSOGAG00000014345 KLK10 otoGar1
Pan troglodytes 22999 ENSPTRP00000043006 ENSPTRG00000011367 KLK10 panTro2
Pongo abelii 17854 ENSPPYP00000011542 100435742 ENSPPYG00000010306 KLK10 ponAbe2
Procavia capensis 7360 ENSPCAP00000001276 ENSPCAG00000001368 KLK10 proCap1
Rattus norvegicus 27038 ENSRNOP00000043107 292850 ENSRNOG00000030281 Klk10 rn4
Rhesus macaque 35974 ENSMMUP00000020263 ENSMMUG00000015451 KLK10 rheMac2
Sorex araneus 2668 ENSSARP00000002653 ENSSARG00000002947 KLK10 sorAra1
Tursiops truncatus 5106 ENSTTRP00000000847 101334169 ENSTTRG00000000900 turTru1

multiple sequence alignment in CLUSTALW format

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      AAG---------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      AAG---------------------------------------------------------
Mus_musculus|38504            AAG---------------------------------------------------------
Rattus_norvegicus|1670        AAG---------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        AAG---------------------------------------------------------
Dasypus_novemcinctus|11947    CAG---------------------------------------------------------
Echinops_telfairi|10237       AAG---------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         AAG---------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               GGG---------------------------------------------------------
Callithrix_jacchus|32783      AAG---------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            AAG---------------------------------------------------------
Pan_troglodytes|19613         AAG---------------------------------------------------------
Gorilla_gorilla|20046         AAG---------------------------------------------------------
Homo_sapiens|40868            AAG---------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------TTCCTG
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------CTGCTG
Mus_musculus|38504            ------------------------------------------------------CTTCTG
Rattus_norvegicus|1670        ------------------------------------------------------CTACTG
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------CTGCTG
Dasypus_novemcinctus|11947    ------------------------------------------------------CTGCTG
Echinops_telfairi|10237       ------------------------------------------------------CTGCTG
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------CTCCTG
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------AAGCTGCTGCTG
Callithrix_jacchus|32783      ---------------------------------------------------------CTG
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ---------------------------------------------------------CTG
Pan_troglodytes|19613         ---------------------------------------------------------CTG
Gorilla_gorilla|20046         ---------------------------------------------------------CTG
Homo_sapiens|40868            ---------------------------------------------------------CTG

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      CTGCCCCTCCTGATGGCGCAGCTCTGT---------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      CCGGCGCTGCTGTTGGCGCAACTC------------------------------------
Mus_musculus|38504            CTGCCGCTACTGATGGTGCAACTCTGG---------------------------------
Rattus_norvegicus|1670        CTGCCGCTACTGATGATGCAACTCTGG---------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        CTGCCGCTGCTGATGGCGCAACTCTGG---------------------------------
Dasypus_novemcinctus|11947    CTGCCGCGGCTGTTGGCGCCGCTCTGG---------------------------------
Echinops_telfairi|10237       CTGCCGCTGTGGATGGCGCAACTTTGG---------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         TTTCCACTACTGATGGTGCAACTCTGG---------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               CTGCCGTTACTAGTGGCGCAATTCTGG---------------------------------
Callithrix_jacchus|32783      CTGCCGCTGCTGGTGACGCAATTCTGG---------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            CTGCCGCTGCTGATGGCGCAACTCTGG---------------------------------
Pan_troglodytes|19613         CTAACGCTGCTGATGGCGCAACTCTGG---------------------------------
Gorilla_gorilla|20046         CTGCCGCTGCTGATGGCGCAACTCTGG---------------------------------
Homo_sapiens|40868            CTGCCGCTGCTGATGGCGCAACTCTGG---------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ------------------------------------------------------------
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ------------------------------------------------------------
Mus_musculus|38504            ------------------------------------------------------------
Rattus_norvegicus|1670        ------------------------------------------------------------
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ------------------------------------------------------------
Procavia_capensis|7842        ------------------------------------------------------------
Dasypus_novemcinctus|11947    ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ------------------------------------------------------------
Tursiops_truncatus|5417       ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ------------------------------------------------------------
Callithrix_jacchus|32783      ------------------------------------------------------------
Rhesus_macaque|21437          ------------------------------------------------------------
Pongo_abelii|14506            ------------------------------------------------------------
Pan_troglodytes|19613         ------------------------------------------------------------
Gorilla_gorilla|20046         ------------------------------------------------------------
Homo_sapiens|40868            ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 ------------------------------------------------------------
Loxodonta_africana|17689      ---------------------------GCTGCAGAGGTGGCTCTGCTCCCCAGAAACCAC
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Microcebus_murinus|18139      ---------------------------TGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
Mus_musculus|38504            ---------------------------GCGGCGCAGGCTCTGCTGCTCCCGGGAAACGCC
Rattus_norvegicus|1670        ---------------------------GCGGCGCAGGCTCTGCTGCTCCCGGGAAACACC
Macropus_eugenii|14166        ------------------------------------------------------------
Macropus_eugenii|1051         ---------------------------------------------TTTCCCCAGTTCCGG
Procavia_capensis|7842        ---------------------------GCTGCAGAGGCGACTCTGCTCCCTAGAAACCAC
Dasypus_novemcinctus|11947    ---------------------------GCCGCGGAGGCAGCGCTGATCCCCAAAAACGAC
Echinops_telfairi|10237       ---------------------------GCTGTGGAGGCCACTCTGCTCCCCAGAAACCAG
Sorex_araneus|3006            ------------------------------------------------------------
Cavia_porcellus|21226         ---------------------------GTCGCGGACGCGCAG---CTGCCTGAAAACCTG
Tursiops_truncatus|5417       ------------------------------------------------------AACGAC
Otolemur_garnettii|14939      ---------------------------------GCCGAGCTGCTGCTACCCGGAAACGAC
Oryctolagus_cuniculus|25997   ------------------------------------------------------------
Bos_taurus|9435               ---------------------------GTCTCGGAGGCTCTTCTGCTCCCCGCAAACGAC
Callithrix_jacchus|32783      ---------------------------GCCGCGGAGGCGGTGCTGCTCCCCCAAAACGAC
Rhesus_macaque|21437          ---------------------------GCCGCGGAGGCGGTGCTGCTTCCCCAAAACGAC
Pongo_abelii|14506            ---------------------------GCCGCAGAGGCGGTGCTGCTCCCCCAAAACGAC
Pan_troglodytes|19613         ---------------------------GCCGCAGAGGCGGCGCTGCTCCCCAAAAACGAC
Gorilla_gorilla|20046         ---------------------------GCCGCAGAGGCGGCGCTGCTCCCCCAAAACGAC
Homo_sapiens|40868            ---------------------------GCCGCAGAGGCGGCGCTGCTCCCCCAAAACGAC

Ornithorhynchus_anatinus|7406 ------------------------------------------TGCGGGCGGGATTCGCAC
Choloepus_hoffmanni|9874      ------------------------------------------------------------
Macropus_eugenii|14166        ------------CCCGAGGGCCAGGATTAC---------CCGTGCTCCCGGGGCTCTCAG
Sorex_araneus|3006            ------------------------------------------------------------
Oryctolagus_cuniculus|25997   ------------------------------------------------------------

Choloepus_hoffmanni|9874      ------------------------------------------------------------
Sorex_araneus|3006            ------------------TTCAACGGCCTCTCGTTC---TGTGCGGGCGTCCTGGTGGAC
Oryctolagus_cuniculus|25997   ---------------------------------TTCCACTGCGCCGGCGTCCTGGTGGAC

Choloepus_hoffmanni|9874      ---------------------------------------------CCACTGTGGGCTCGA
Macropus_eugenii|1051         CGCAAATGCATATTAACCGCAGCCCATTGC------------------------------

                                          **       *:     *       *. .*. *                

                                  :    .. *        .                     .        :       

                                     . *: .* *. .*      . *  .             *       .  .   

                               . .   .                    .             .*  .    ** .. .  

                                    **    .                                            .. 

                                     .     .  .             ..                       .    

Sorex_araneus|3006            AGCGGCATGATGTTTGCAGGGCTGCATCAG------------------------------
                                     .. . .  .  .                                         

Microcebus_murinus|18139      ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------

Microcebus_murinus|18139      ------------------------------------------------------------
Echinops_telfairi|10237       ------------------------------------------------------------
Sorex_araneus|3006            ------------------------------------------------------------
Otolemur_garnettii|14939      ------------------------------------------------------------

Ornithorhynchus_anatinus|7406 AACAAAATCATCAAGAACAACTGA
Loxodonta_africana|17689      CATGGCACCATCAAATCGAAC---
Choloepus_hoffmanni|9874      GAGAAAACCATTCACACCAACTGA
Microcebus_murinus|18139      ------------------------
Mus_musculus|38504            CGAAGAGTCATTCGTTTCAAATGA
Rattus_norvegicus|1670        CGAAGAGTCATCCGTTCCAAATGA
Macropus_eugenii|14166        GAGAGGATCATTCGGACCCACTGA
Macropus_eugenii|1051         GAGAGGATCATTCGGACCCACTGA
Procavia_capensis|7842        CAGAAGATCATACGTTCCAACTGA
Dasypus_novemcinctus|11947    AAGAAAACCATGCACTCCAACTGA
Echinops_telfairi|10237       ------------------------
Sorex_araneus|3006            ------------------------
Cavia_porcellus|21226         CAGAAAATCATCCACTCCAACTGA
Tursiops_truncatus|5417       GAGAAAACCATCGGCTCCAAGTGA
Otolemur_garnettii|14939      ------------------------
Canis_familiaris|1087         GAGAAAACCATACGCTCC------
Oryctolagus_cuniculus|25997   CGGAAAACCATCCTCTCCGGCTGA
Bos_taurus|9435               GAGAAGACCATCCGCTCCAACTGA
Callithrix_jacchus|32783      AATAAAGTCATACGCTCCAACTGA
Rhesus_macaque|21437          AATAAAGTCATACGCTCCAACTGA
Pongo_abelii|14506            AATAAAGTCATACGCTCCAACTGA
Pan_troglodytes|19613         AATAAAGTCATACGCTCCAACTGA
Gorilla_gorilla|20046         AATAAAGTCATACGCTCCAACTGA
Homo_sapiens|40868            AATAAAGTCATACGCTCCAACTGA

multiple sequence alignment in CLUSTALW format

Ornithorhynchus_anatinus|22646 ------------------------------------------------------------
Loxodonta_africana|10268       ------------------------------------------------------------
Choloepus_hoffmanni|8723       ------------------------------------------------------------
Microcebus_murinus|15393       ------------------------------------------------------------
Mus_musculus|11875             ------------------------------------------------------------
Rattus_norvegicus|27038        ------------------------------------------------------------
Macropus_eugenii|12884         ------------------------------------------------------------
Macropus_eugenii|968           ------------------------------------------------------------
Procavia_capensis|7360         ------------------------------------------------------------
Dasypus_novemcinctus|10564     ------------------------------------------------------------
Echinops_telfairi|8081         ------------------------------------------------------------
Sorex_araneus|2668             ------------------------------------------------------------
Cavia_porcellus|16731          ------------------------------------------------------------
Tursiops_truncatus|5106        ------------------------------------------------------------
Otolemur_garnettii|12855       ------------------------------------------------------------
Oryctolagus_cuniculus|22867    ------------------------------------------------------------
Bos_taurus|24438               ------------------------------------------------------------
Callithrix_jacchus|24641       ------------------------------------------------------------
Rhesus_macaque|35974           ------------------------------------------------------------
Pongo_abelii|17854             ------------------------------------------------------------
Pan_troglodytes|22999          ------------------------------------------------------------
Gorilla_gorilla|15880          ------------------------------------------------------------
Homo_sapiens|31328             ------------------------------------------------------------

Ornithorhynchus_anatinus|22646 ------------------------------------------------------------
Loxodonta_africana|10268       ------------------------------------------------------------
Choloepus_hoffmanni|8723       ------------------------------------------------------------
Microcebus_murinus|15393       ------------------------------------------------------------
Mus_musculus|11875             ------------------------------------------------------------
Rattus_norvegicus|27038        ------------------------------------------------------------
Macropus_eugenii|12884         ------------------------------------------------------------
Macropus_eugenii|968           ------------------------------------------------------------
Procavia_capensis|7360         ------------------------------------------------------------
Dasypus_novemcinctus|10564     ------------------------------------------------------------
Echinops_telfairi|8081         ------------------------------------------------------------
Sorex_araneus|2668             ------------------------------------------------------------
Cavia_porcellus|16731          ------------------------------------------------------------
Tursiops_truncatus|5106        ------------------------------------------------------------
Otolemur_garnettii|12855       ------------------------------------------------------------
Oryctolagus_cuniculus|22867    ------------------------------------------------------------
Bos_taurus|24438               ------------------------------------------------------------
Callithrix_jacchus|24641       ------------------------------------------------------------
Rhesus_macaque|35974           ------------------------------------------------------------
Pongo_abelii|17854             ------------------------------------------------------------
Pan_troglodytes|22999          ------------------------------------------------------------
Gorilla_gorilla|15880          ------------------------------------------------------------
Homo_sapiens|31328             ------------------------------------------------------------

Ornithorhynchus_anatinus|22646 ------------------------------------------------------------
Loxodonta_africana|10268       ------------------------------------------------------------
Choloepus_hoffmanni|8723       ------------------------------------------------------------
Microcebus_murinus|15393       ------------------------------------------------------------
Mus_musculus|11875             ------------------------------------------------------------
Rattus_norvegicus|27038        ------------------------------------------------------------
Macropus_eugenii|12884         ------------------------------------------------------------
Macropus_eugenii|968           ------------------------------------------------------------
Procavia_capensis|7360         ------------------------------------------------------------
Dasypus_novemcinctus|10564     ------------------------------------------------------------
Echinops_telfairi|8081         ------------------------------------------------------------
Sorex_araneus|2668             ------------------------------------------------------------
Cavia_porcellus|16731          ------------------------------------------------------------
Tursiops_truncatus|5106        ------------------------------------------------------------
Otolemur_garnettii|12855       ------------------------------------------------------------
Oryctolagus_cuniculus|22867    ------------------------------------------------------------
Bos_taurus|24438               ------------------------------------------------------------
Callithrix_jacchus|24641       ------------------------------------------------------------
Rhesus_macaque|35974           ------------------------------------------------------------
Pongo_abelii|17854             ------------------------------------------------------------
Pan_troglodytes|22999          ------------------------------------------------------------
Gorilla_gorilla|15880          ------------------------------------------------------------
Homo_sapiens|31328             ------------------------------------------------------------

Ornithorhynchus_anatinus|22646 ------------------------------------------------------------
Loxodonta_africana|10268       ------------------------------------------------------------
Choloepus_hoffmanni|8723       ------------------------------------------------------------
Microcebus_murinus|15393       ------------------------------------------------------------
Mus_musculus|11875             ------------------------------------------------------------
Rattus_norvegicus|27038        ------------------------------------------------------------
Macropus_eugenii|12884         ------------------------------------------------------------
Macropus_eugenii|968           ------------------------------------------------------------
Procavia_capensis|7360         ------------------------------------------------------------
Dasypus_novemcinctus|10564     ------------------------------------------------------------
Echinops_telfairi|8081         ------------------------------------------------------------
Sorex_araneus|2668             ------------------------------------------------------------
Cavia_porcellus|16731          ------------------------------------------------------------
Tursiops_truncatus|5106        ------------------------------------------------------------
Otolemur_garnettii|12855       ------------------------------------------------------------
Oryctolagus_cuniculus|22867    ------------------------------------------------------------
Bos_taurus|24438               ------------------------------------------------------------
Callithrix_jacchus|24641       ------------------------------------------------------------
Rhesus_macaque|35974           ------------------------------------------------------------
Pongo_abelii|17854             ------------------------------------------------------------
Pan_troglodytes|22999          ------------------------------------------------------------
Gorilla_gorilla|15880          ------------------------------------------------------------
Homo_sapiens|31328             ------------------------------------------------------------

Ornithorhynchus_anatinus|22646 ------------------------------------------------------------
Loxodonta_africana|10268       ----------------------MRPSHLRLSAASGARALKK-------------------
Choloepus_hoffmanni|8723       ------------------------------------------------------------
Microcebus_murinus|15393       ----------------------MRAPHRHLSAASGAWALAK-------------------
Mus_musculus|11875             ----------------------MRVPLLHLSTASGSWSLVK-------------------
Rattus_norvegicus|27038        ----------------------MRVPLLHLPTASGSLSLVK-------------------
Macropus_eugenii|12884         ------------------------------------------------------------
Macropus_eugenii|968           ------------------------------------------------------------
Procavia_capensis|7360         ----------------------MGPPHLRLSVASGAPVLKK-------------------
Dasypus_novemcinctus|10564     ----------------------MRPPHLRLSAAAGAWILQQ-------------------
Echinops_telfairi|8081         ----------------------MSTPHLRHSAASGARALLK-------------------
Sorex_araneus|2668             ------------------------------------------------------------
Cavia_porcellus|16731          ----------------------MRPLHLHLSATSGAWALMK-------------------
Tursiops_truncatus|5106        ------------------------------------------------------------
Otolemur_garnettii|12855       ------------------------------------------------------------
Oryctolagus_cuniculus|22867    ------------------------------------------------------------
Bos_taurus|24438               ----------------------MTPRHLHLSAASGAQGGLG-------------------
Callithrix_jacchus|24641       ----------------------MRPPLLHLSAASGARTLAK-------------------
Rhesus_macaque|35974           ------------------------------------------------------------
Pongo_abelii|17854             ----------------------MRAPHLHLSAASGARALAK-------------------
Pan_troglodytes|22999          ----------------------MRAPHLHLSAASGARALAK-------------------
Gorilla_gorilla|15880          ----------------------MRAPHLHLSAASGARALAK-------------------
Homo_sapiens|31328             ----------------------MRAPHLHLSAASGARALAK-------------------

Ornithorhynchus_anatinus|22646 ------------------------------------------------------------
Loxodonta_africana|10268       ------------------FLLPLLMAQLC-------------------------------
Choloepus_hoffmanni|8723       ------------------------------------------------------------
Microcebus_murinus|15393       ------------------LLPALLLAQL--------------------------------
Mus_musculus|11875             ------------------LLLPLLMVQLW-------------------------------
Rattus_norvegicus|27038        ------------------LLLPLLMMQLW-------------------------------
Macropus_eugenii|12884         ------------------------------------------------------------
Macropus_eugenii|968           ------------------------------------------------------------
Procavia_capensis|7360         ------------------LLLPLLMAQLW-------------------------------
Dasypus_novemcinctus|10564     ------------------LLLPRLLAPLW-------------------------------
Echinops_telfairi|8081         ------------------LLLPLWMAQLW-------------------------------
Sorex_araneus|2668             ------------------------------------------------------------
Cavia_porcellus|16731          ------------------LLFPLLMVQLW-------------------------------
Tursiops_truncatus|5106        ------------------------------------------------------------
Otolemur_garnettii|12855       ------------------------------------------------------------
Oryctolagus_cuniculus|22867    ------------------------------------------------------------
Bos_taurus|24438               ----------------KLLLLPLLVAQFW-------------------------------
Callithrix_jacchus|24641       -------------------LLPLLVTQFW-------------------------------
Rhesus_macaque|35974           ------------------------------------------------------------
Pongo_abelii|17854             -------------------LLPLLMAQLW-------------------------------
Pan_troglodytes|22999          -------------------LLTLLMAQLW-------------------------------
Gorilla_gorilla|15880          -------------------LLPLLMAQLW-------------------------------
Homo_sapiens|31328             -------------------LLPLLMAQLW-------------------------------

Ornithorhynchus_anatinus|22646 ------------------------------------------------------------
Loxodonta_africana|10268       ------------------------------------------------------------
Choloepus_hoffmanni|8723       ------------------------------------------------------------
Microcebus_murinus|15393       ------------------------------------------------------------
Mus_musculus|11875             ------------------------------------------------------------
Rattus_norvegicus|27038        ------------------------------------------------------------
Macropus_eugenii|12884         ------------------------------------------------------------
Macropus_eugenii|968           ------------------------------------------------------------
Procavia_capensis|7360         ------------------------------------------------------------
Dasypus_novemcinctus|10564     ------------------------------------------------------------
Echinops_telfairi|8081         ------------------------------------------------------------
Sorex_araneus|2668             ------------------------------------------------------------
Cavia_porcellus|16731          ------------------------------------------------------------
Tursiops_truncatus|5106        ------------------------------------------------------------
Otolemur_garnettii|12855       ------------------------------------------------------------
Oryctolagus_cuniculus|22867    ------------------------------------------------------------
Bos_taurus|24438               ------------------------------------------------------------
Callithrix_jacchus|24641       ------------------------------------------------------------
Rhesus_macaque|35974           ------------------------------------------------------------
Pongo_abelii|17854             ------------------------------------------------------------
Pan_troglodytes|22999          ------------------------------------------------------------
Gorilla_gorilla|15880          ------------------------------------------------------------
Homo_sapiens|31328             ------------------------------------------------------------

Ornithorhynchus_anatinus|22646 ------------------------------------------------------------
Loxodonta_africana|10268       ------------------------------------------------------------
Choloepus_hoffmanni|8723       ------------------------------------------------------------
Microcebus_murinus|15393       ------------------------------------------------------------
Mus_musculus|11875             ------------------------------------------------------------
Rattus_norvegicus|27038        ------------------------------------------------------------
Macropus_eugenii|12884         ------------------------------------------------------------
Macropus_eugenii|968           ------------------------------------------------------------
Procavia_capensis|7360         ------------------------------------------------------------
Dasypus_novemcinctus|10564     ------------------------------------------------------------
Echinops_telfairi|8081         ------------------------------------------------------------
Sorex_araneus|2668             ------------------------------------------------------------
Cavia_porcellus|16731          ------------------------------------------------------------
Tursiops_truncatus|5106        ------------------------------------------------------------
Otolemur_garnettii|12855       ------------------------------------------------------------
Oryctolagus_cuniculus|22867    ------------------------------------------------------------
Bos_taurus|24438               ------------------------------------------------------------
Callithrix_jacchus|24641       ------------------------------------------------------------
Rhesus_macaque|35974           ------------------------------------------------------------
Pongo_abelii|17854             ------------------------------------------------------------
Pan_troglodytes|22999          ------------------------------------------------------------
Gorilla_gorilla|15880          ------------------------------------------------------------
Homo_sapiens|31328             ------------------------------------------------------------

Ornithorhynchus_anatinus|22646 ------------------------------------------------------------
Loxodonta_africana|10268       ------------------------------------------------------------
Choloepus_hoffmanni|8723       ------------------------------------------------------------
Microcebus_murinus|15393       ------------------------------------------------------------
Mus_musculus|11875             ------------------------------------------------------------
Rattus_norvegicus|27038        ------------------------------------------------------------
Macropus_eugenii|12884         ------------------------------------------------------------
Macropus_eugenii|968           ------------------------------------------------------------
Procavia_capensis|7360         ------------------------------------------------------------
Dasypus_novemcinctus|10564     ------------------------------------------------------------
Echinops_telfairi|8081         ------------------------------------------------------------
Sorex_araneus|2668             ------------------------------------------------------------
Cavia_porcellus|16731          ------------------------------------------------------------
Tursiops_truncatus|5106        ------------------------------------------------------------
Otolemur_garnettii|12855       ------------------------------------------------------------
Oryctolagus_cuniculus|22867    ------------------------------------------------------------
Bos_taurus|24438               ------------------------------------------------------------
Callithrix_jacchus|24641       ------------------------------------------------------------
Rhesus_macaque|35974           ------------------------------------------------------------
Pongo_abelii|17854             ------------------------------------------------------------
Pan_troglodytes|22999          ------------------------------------------------------------
Gorilla_gorilla|15880          ------------------------------------------------------------
Homo_sapiens|31328             ------------------------------------------------------------

Ornithorhynchus_anatinus|22646 ------------------------------------------------------------
Loxodonta_africana|10268       ------------------------------------------------------------
Choloepus_hoffmanni|8723       ------------------------------------------------------------
Microcebus_murinus|15393       ------------------------------------------------------------
Mus_musculus|11875             ------------------------------------------------------------
Rattus_norvegicus|27038        ------------------------------------------------------------
Macropus_eugenii|12884         ------------------------------------------------------------
Macropus_eugenii|968           ------------------------------------------------------------
Procavia_capensis|7360         ------------------------------------------------------------
Dasypus_novemcinctus|10564     ------------------------------------------------------------
Echinops_telfairi|8081         ------------------------------------------------------------
Sorex_araneus|2668             ------------------------------------------------------------
Cavia_porcellus|16731          ------------------------------------------------------------
Tursiops_truncatus|5106        ------------------------------------------------------------
Otolemur_garnettii|12855       ------------------------------------------------------------
Oryctolagus_cuniculus|22867    ------------------------------------------------------------
Bos_taurus|24438               ------------------------------------------------------------
Callithrix_jacchus|24641       ------------------------------------------------------------
Rhesus_macaque|35974           ------------------------------------------------------------
Pongo_abelii|17854             ------------------------------------------------------------
Pan_troglodytes|22999          ------------------------------------------------------------
Gorilla_gorilla|15880          ------------------------------------------------------------
Homo_sapiens|31328             ------------------------------------------------------------

Ornithorhynchus_anatinus|22646 ----------------------------------CGRDSHPWQVSLFRNLKFRCAGVLVD
Choloepus_hoffmanni|8723       ------------------------------------------------------------
Macropus_eugenii|12884         ------------------------PEGQDY---PCSRGSQPWHVSLFKDLSFRCAGVLVD
Macropus_eugenii|968           ---------------FPQFRRRWGPEGQDY---SCPRGSQPWHISLFKDLSFLCVGVLVD
Sorex_araneus|2668             ----------------------------------------------FNGLSF-CAGVLVD
Tursiops_truncatus|5106        ------------------NDTHSLSVASSA----CYR-SQPWQVSLFNGFWFHCAGVLVD
Oryctolagus_cuniculus|22867    ---------------------------------------------------FHCAGVLVD

Choloepus_hoffmanni|8723       ---------------PLWARVGDDHLLLLQ-GEQLCRTIHPVPHPKYRLGS---GPLLPR
Macropus_eugenii|968           RKCILTAAHC--------------HLLLPDGGEQLNISSVMIPHPKYNVSS---GPSLPA
                                                       :    .   ::        :                

                                   :.:  :                           *    * .               

Microcebus_murinus|15393       SRVTLLSPKACEVFYPGVVTNNMICAGLDQGQDPCQS-----------------------
Echinops_telfairi|8081         SRVSVLSATECDVFYPGVVTNNMICAGLDQGQDPCQ------------------------
Sorex_araneus|2668             AGVRVLSPQDCNDFYPGVLNSGMMFAGLHQ------------------------------
Otolemur_garnettii|12855       SRVTLLSPKQCEVFYPGVVTNNMLCAGLDQGQDPCQ------------------------

Ornithorhynchus_anatinus|22646 GAG-PHPAVYTKICRYSSWINKIIKNN
Loxodonta_africana|10268       GKP-SKPGVYTNLCQFTKWIHGTIKSN
Choloepus_hoffmanni|8723       GSS-HYPSVYTHICKYVNWIEKTIHTN
Microcebus_murinus|15393       ---------------------------
Mus_musculus|11875             GAA-QHPSVYSEICKYTPWIRRVIRFK
Rattus_norvegicus|27038        GAATQYPAVYAKICNYTNWIRRVIRSK
Macropus_eugenii|12884         GSA-HRPAVYTWICKYSSWIERIIRTH
Macropus_eugenii|968           GSV-HQPAVYTWICKYSSWIERIIRTH
Procavia_capensis|7360         XXA-QQPAVYTQICKSC--IQKIIRSN
Dasypus_novemcinctus|10564     GSA-QHPVVYTEVCKYVPWIKKTMHSN
Echinops_telfairi|8081         ---------------------------
Sorex_araneus|2668             ---------------------------
Cavia_porcellus|16731          GSA-QHPAVYTRICKYIGWIQKIIHSN
Tursiops_truncatus|5106        GSA-QRPAVYTEICKYRNWIEKTIGSK
Otolemur_garnettii|12855       ---------------------------
Canis_familiaris|8894          GSA-QHPAVYTQICKYNSWIEKTIRS-
Oryctolagus_cuniculus|22867    GSA-QHPAVYTQICKYLPWIRKTILSG
Bos_taurus|24438               GSA-QHPAVYTQICKYRSWIEKTIRSN
Callithrix_jacchus|24641       GSA-QHPAVYTQICKYTPWINKVIRSN
Rhesus_macaque|35974           GSA-QHPAVYTQICKYMSWINKVIRSN
Pongo_abelii|17854             GSA-QHPAVYTQICKYMSWINKVIRSN
Pan_troglodytes|22999          GSA-QHPAVYTQICKYMSWINKVIRSN
Gorilla_gorilla|15880          GSA-QHPAVYTQICKYMSWINKVIRSN
Homo_sapiens|31328             GSA-QHPAVYTQICKYMSWINKVIRSN