Orthologs Set ID: EOG4006D2

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Drosophila grimshawi 9125
Drosophila sechellia 410
Drosophila willistoni 12973

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Drosophila grimshawi 9125 FBtr0150113 6558960 FBgn0122175 GH14699 droGri2
Drosophila sechellia 410 FBtr0207865 6605016 FBgn0179742 GM24880 droSec1
Drosophila willistoni 12973 FBtr0247216 6639125 FBgn0218567 GK16565 r1.3

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Drosophila grimshawi 4595 FBpp0148605 6558960 FBgn0122175 GH14699 droGri2
Drosophila sechellia 14466 FBpp0206357 6605016 FBgn0179742 GM24880 droSec1
Drosophila willistoni 6451 FBpp0245708 6639125 FBgn0218567 GK16565 r1.3

multiple sequence alignment in CLUSTALW format

                            ********.***** ** *** * *** ************* .* **       ** ** 

Drosophila_willistoni|12973 CGT---------------AGCGTAGCTATGGACGTAGATGAT---GTGGGTTTCGGTATG
                            **                .*  *.*  ***** .*:**:***      ** ** ** :**

Drosophila_sechellia|410    TATCCGCTGGAG------------------GCCACCTCACAGTTGCCA------------
                            *****  *****                  **  **:*****  .*.*            

Drosophila_willistoni|12973 ------------------------------------------------------TCACGC
Drosophila_sechellia|410    ---------------------------------------------------------CAA

Drosophila_willistoni|12973 TTGGGAATGCGCCTCGGTGGGGGG------------------------AATCCAAACTCT
Drosophila_sechellia|410    CTGAGTCGTGGGTTGGGGCGTGGG------------------------------------
                             * . :.      : **  .   *                                    

                                   .  **.**.* ******** .*.**.** *.*     *  . ..***      

Drosophila_willistoni|12973 ---------------------------CAGCAGCATCGCCATCACCCATATAACCGTGTG
Drosophila_sechellia|410    ---------------------------------CATCGTCATCATCCGTACAATCGTGTG
                                                             ** ** ***** ** ** .. ** ***

                            ** **.******** *  ** ** ******** .*  *.*** ****.*..**  **  .

Drosophila_willistoni|12973 AAGGCC---------------------------------------------AGCTACAAC
Drosophila_sechellia|410    GATAAG---------------------------------------------GGCACGTCC
                            .* ..                                              .*. .    

                            . .**       : * *.. :    .:   .  . .:  ..***  *  * ** **.** 

                            ***.* ** ******************** *****.**.*****. **..***.** *  

                            ** ******** ** ** ***** ** ******** ******** **.*********** 

                            ** ** ** ** ***** ** *****.*****.** ** ***** **.** *: ** ** 

                            . *** ** ***** ** .*.** ***** ** *** * ** ** *****  * **.**.

                               *  **:*     **.* *..                **.***.* ** ** ** ***

Drosophila_willistoni|12973 CAGACAAAATCTGTAGAGCAGGTGGTAGCTTCCACTATT---------------------
Drosophila_sechellia|410    CAGATATCGCAGCAGCAGAAGGATAAGGATGCG---------------------------
                            ***. . .. .  :. *..*. :  :. .: *                            

Drosophila_willistoni|12973 ------------------------------------CCTGCACCAACTCCCACTCTCACT
Drosophila_sechellia|410    ------------------------------------CAGCCGCCAAAGCCGGCAGAGGTA
                                                                *.  . **.*. .  .*:   .  

                                   . ** **:.* . *  *.  .*: * ..  * .* **.*.             

Drosophila_willistoni|12973 ------------------------------------------------AAGAATATCGTC
Drosophila_sechellia|410    ------------------------------------CCCACACCCACTCCTTCGCTCTCG
                                                                               :   **   

                               .    .  .***...*...  ** *  .: ...               *. *.:*..

                            *  *.*.            . * **   .  . *  *:  * ..  . ..: . .*  . 

                            . : * .    ..   . :  .*  .   .*. .  :. : :.* :..******.:   .

Drosophila_sechellia|410    GAACCAGAACCAGAGTCCATGGAA------------------------------------
                            .*    .*.* ....:.     .                                     

                                     .   *    . ..* .. .. ... .* .*.. .:  . ..  *.* .. .

                            *     . *  :: ..   .    .:*..  : .** *    *** *.**** ***  . 

                                .    . *** ** :. .. :. :   .  . :  ..: * ..             

Drosophila_sechellia|410    ---------------------------GAGGATGTGGAAATGCCGCCGGCCAAAGAA---
                                                       *.  .:.:  ...* **. *  *..*...*   

Drosophila_willistoni|12973 ---------------------------------------CTAGAAAAGCCTCTCCTCAAG
Drosophila_sechellia|410    ------------------------------------------AACCGGAAAATCTTCCGC
                                                                      ..  .*.. . *  ... 

Drosophila_sechellia|410    GGAAGACAGCAA------------------------------------------------
                            ** .   *. *.                                                

Drosophila_sechellia|410    ---------------------AGAGGAGCAGGCGGAGGTGGA------------------
                                                 * :* :* .   .  **                      

Drosophila_willistoni|12973 ---------TTGACCAAGTGA
Drosophila_grimshawi|9125   CTGGCAACTCTGGCCAAGTGA
Drosophila_sechellia|410    ------------------TAA

multiple sequence alignment in CLUSTALW format

                           **************:*  ***     .:.*:::*  ***:**:*      *.:*      

Drosophila_willistoni|6451 ------------------SRLGMRLGGG--------NPNSTSSSVIWVPVKGQSQQQQ--
Drosophila_sechellia|14466 -------------------QLSRGLGRG--------------NAMMWVPIKGQSAASQ--
                                              :*.   * .               :::***:** .   *  

Drosophila_willistoni|6451 ---------QQHRHHPYNRVAGAKTACCNKSIIELERDLLKA---------------SYN
Drosophila_sechellia|14466 -----------HRHHPYNRVAGAKTACCNKSLVELEKELGDK---------------GTS
                                      :*****.*******.*****::***::: .                .  

                            *  *::.  . * *::******************. **:********************

                           ************:****::* :****:**********.**  *. *..     **:****

Drosophila_willistoni|6451 QTKSVEQVVASTI-------------------PAPTPTLTSTTAATASIAAASEPKP---
Drosophila_sechellia|14466 QISQQQKDKDA---------------------QPPKPAEVEQQAAASATTSTSNPTA---
                           * .. ::   :                       *. : .   **:   :: ::*..   

Drosophila_willistoni|6451 ----------------KNIVAPVLESNGNAIEKGLESANAMGN---DAADEFKAATKETE
Drosophila_sechellia|14466 ------------PTPTPSLSLTLAESNGNGQE-----ETEMEV---PAVSPSISNEAAAA
                                            .:  .  *.. *.        .        ...   :    : 

                            :. .  :  . ..:.**  : :  . .                :  .         :..

                           .   : .    :. *:*.*.    **...     :               .  :*..:  

Drosophila_willistoni|6451 -------------LEKPLLKGAEELAAQDAAILLAKN-----NPVATTAGENGSKPEE--
Drosophila_sechellia|14466 --------------NRKIFRGRQQ-----------------------RGAGGGG------
                                          .   :* ::                        ..  *.      

Drosophila_willistoni|6451 ---LTK
Drosophila_grimshawi|4595  LATLAK
Drosophila_sechellia|14466 ------