Orthologs Set ID: EOG4006DH

Orthology Database
Gene Symbol(s)

Phylogenetic Tree:

Transcript Architecture:

Species Transcript ID Positions
Apis mellifera 33521 1592
Bombyx mori 6491 1770
Culex quinquefasciatus 12274 13
Drosophila grimshawi 9243 1770
Drosophila persimilis 5519 1770
Drosophila willistoni 1556 1770
Ixodes scapularis 8629
Linepithema humile 14353 598, 1383, 1592
Pediculus humanus 706 886, 1770
Pogonomyrmex barbatus 5033 1592, 1770
Tribolium castaneum 11102 1770

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Apis mellifera 33521 GB17292-PA apiMel3
Bombyx mori 6491 BGIBMGA002784-TA v2.0
Culex quinquefasciatus 12274 CPIJ009923-RA 6042701 CPIJ009923 CpipJ1
Drosophila grimshawi 9243 FBtr0150045 6558178 FBgn0122107 GH14631 droGri2
Drosophila persimilis 5519 FBtr0190235 6597086 FBgn0162209 GL24620 droPer1
Drosophila willistoni 1556 FBtr0241193 6651907 FBgn0212557 GK10542 r1.3
Ixodes scapularis 8629 ISCW010423-RA ISCW010423 IscaW1
Linepithema humile 14353 LH20978-RA 1.2
Pediculus humanus 706 PHUM045060-RA 8232703 PHUM045060 PhumU1
Pogonomyrmex barbatus 5033 PB24282-RA 1.2
Tribolium castaneum 11102 GLEAN_12482 Tcas3.0

Species ID Accessions Entrez Gene ID Ensembl Gene Gene Symbol Build
Apis mellifera 7290 GB17292 apiMel3
Bombyx mori 2784 BGIBMGA002784-PA v2.0
Culex quinquefasciatus 7822 CPIJ009923 CpipJ1
Drosophila grimshawi 4527 FBpp0148537 6558178 FBgn0122107 GH14631 droGri2
Drosophila persimilis 14200 FBpp0188727 6597086 FBgn0162209 GL24620 droPer1
Drosophila willistoni 537 FBpp0239685 6651907 FBgn0212557 GK10542 r1.3
Ixodes scapularis 8643 ISCW010423-PA ISCW010423 IscaW1
Linepithema humile 6590 LH20978-PA 1.2
Pediculus humanus 697 PHUM045060-PA 8232703 PHUM045060 PhumU1
Pogonomyrmex barbatus 14282 PB24282-PA 1.2
Tribolium castaneum 12163 GLEAN_12482 Tcas3.0

multiple sequence alignment in CLUSTALW format

Ixodes_scapularis|8629       ------------------------------------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_persimilis|5519   ------------------------------------------------------------
Drosophila_grimshawi|9243    ------------------------------------------------------------
Drosophila_willistoni|1556   ------------------------------------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_persimilis|5519   ------------------------------------------------------------
Drosophila_grimshawi|9243    ------------------------------------------------------------
Drosophila_willistoni|1556   ------------------------------------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_persimilis|5519   ------------------------------------------------------------
Drosophila_grimshawi|9243    ------------------------------------------------------------
Drosophila_willistoni|1556   ------------------------------------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_persimilis|5519   ------------------------------------------------------------
Drosophila_grimshawi|9243    ------------------------------------------------------------
Drosophila_willistoni|1556   ------------------------------------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_persimilis|5519   ------------------------------------------------------------
Drosophila_grimshawi|9243    ------------------------------------------------------------
Drosophila_willistoni|1556   ------------------------------------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_persimilis|5519   ------------------------------GAAAGGGATGTGGACGGTGGGGACGGTGAT
Drosophila_grimshawi|9243    ------------------------------ACTACTGCTGCTGGCAATGGTAATGGAAAT
Drosophila_willistoni|1556   ------------------------------------------------GATGACGATAAT
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------ATGCGAAAATATGGTTGTGATCAGTTGAAA
Linepithema_humile|14353     ------------------------------ATGATCGAGACTGAAAATCAGTTAGGTTCA
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ---------------ATGGAAGCCAATGGAACAGGC------------------------
Drosophila_grimshawi|9243    GGAAATGGTGTT---GGTGATGGTGATGACGACGGT---------------------GGC
Drosophila_willistoni|1556   GGGGCAGGAGTT---GATTTGGACGAAGACCGCGGT---------------------AGC
Pediculus_humanus|706        ATGAGTTTAAGTACAATCGAAGGTTCATCCGTTGGT------------------------
Bombyx_mori|6491             ---------------ATGTCGCGTCGCGTACACCGC------------------------
Tribolium_castaneum|11102    ---------------ATGCAGCAGTACGAAGATGGC------------------------
Pogonomyrmex_barbatus|5033   AGAATTCCAGTTCCGTTCCGCTCAGATACGATGAGA------------------------
Linepithema_humile|14353     CATACCGACAAAGTGGAACAGAACGAAGAGAAGGAG------------------------
Apis_mellifera|33521         ---------------ATGGCCGGCTTT---------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ---------------------------------------------------CCGCGGATA
Pogonomyrmex_barbatus|5033   ---------------------------------AAAGAGGAGCAAGAAACGTCGCGGACT
Linepithema_humile|14353     ---------------------------------------ACAACGGCGGTCGGTGATCAT
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_grimshawi|9243    AGTTCGAACTCACAAGTCGAAGGAAACGTTTCGCCG------------------------
Drosophila_willistoni|1556   AGTTCGAACGCACAGCTCGAGGGAAACGTTACGCCG---------------------AAG
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             CAAGCCCGTCTCCGCCCGCAGGCCGCCCCGGAGCCCGCACCG------------------
Tribolium_castaneum|11102    GGCGGCGGCGAAGACGTCGCT---------------------------------CCCGCA
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Pediculus_humanus|706        ------ACATTTTCTGATTTTGACGTTTTATCCGTC------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_grimshawi|9243    AGCCACAACTTTGATAGCAATCGCAAC---------------------------------
Drosophila_willistoni|1556   AGCAATAATAACGACAGCAACCGCAGT---------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Tribolium_castaneum|11102    GGCGCGCACCACGAAAGC------------------------------------------
Pogonomyrmex_barbatus|5033   GAGGAAGAAGAGGAGGAGGGAGACGAG---------------------------------
Linepithema_humile|14353     ACCGCGAGCATTGCGACGCCCATGGCA---------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_grimshawi|9243    ------------------------AGTCCCACAAAGAGTCCAACATCACGACGCGCCGGC
Drosophila_willistoni|1556   ------------------------AGCCCCACCAAGAGCCCCACACGC---------AAT
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_willistoni|1556   ATATCATCGAGTTTTCAAATC------------------AACTACGATGACGAGGAG---
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Culex_quinquefasciatus|12274 AACAAGCCAACG------------------------ACGCCAATTCGGGACATCAATGGC
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------ATATCG
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_willistoni|1556   ---------------GACCTAACAGAAGAT---AAGCCGGCATTGGCTGCTGGGATTGGA
Pediculus_humanus|706        ---------------------------------GTTACCGAATTCGTATCAAGTCGACCT
Bombyx_mori|6491             ---------------------------------CCACCGGAACCGCCCCAACCTGAGCCC
Tribolium_castaneum|11102    ---------------------------------GACGACGACGACGCCGAAGACGACCCT
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Pediculus_humanus|706        GCAAGTCCCGGTGGTGGTATGAACGACGGAGGTTCTGAA---------------------
Bombyx_mori|6491             GACCATCCGCCTTCCGAAGAGGAACGAGAACCAGGCGAC---------------------
Tribolium_castaneum|11102    CCCAACCCCGTCAACGGGGGCTAC------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_persimilis|5519   ------------------------------------------------------------
Drosophila_grimshawi|9243    ------------------------------------------------------------
Drosophila_willistoni|1556   ------------------------------------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_persimilis|5519   TGGCAGCCAAGG------------------------------------------------
Drosophila_grimshawi|9243    TGGCAACAGCGC------------------------------------------------
Drosophila_willistoni|1556   TGGCAACAGCGT------------------------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             TGGCGAGCCTCT------------------------------------------------
Tribolium_castaneum|11102    TGGCGG------------------------------------------------------
Pogonomyrmex_barbatus|5033   TGGAGGCAGAGC------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         TGGAGGCAGAGC------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_persimilis|5519   ------------------------------------------------------------
Drosophila_grimshawi|9243    ------------------------------------------------------------
Drosophila_willistoni|1556   ------------------------------------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------AAGGCT------------------
Drosophila_persimilis|5519   ------------------------------------AACGGCGGC---GGCTCAGTCCAC
Drosophila_grimshawi|9243    ------------------------------------AACGGGGCAGCTGGGTCAATTAGT
Drosophila_willistoni|1556   ------------------------------------AACGGAGGAGCCGGATCA------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Culex_quinquefasciatus|12274 GTGGTGGTGAAGGGTGGTAAGATCGGTTCTAgtggtggtggtgcaatcggtggtggtggt
Tribolium_castaneum|11102    ------------------------------------CAGGGGGCC---------------
Pogonomyrmex_barbatus|5033   ------------------------------------AGACCCTCC---------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------AGACCCTCC---------------

Ixodes_scapularis|8629       ---------------------------------------GCTGCCGCGGTTGCACCT---
Drosophila_willistoni|1556   ---------------------------------------AGTTGCGCAATCAGCCCTGGA
Pediculus_humanus|706        ---------------------------------------TCTTCATCGATGCCACCG---
Bombyx_mori|6491             ---------------------------------------CGGCCATCCTCCCCTCCACAG
Tribolium_castaneum|11102    ---------------------------------------TCGCGAGCTGCGAGCCCCGCC
Pogonomyrmex_barbatus|5033   ---------------------------------------AGTCCCCGCATGCCGCCT---
Linepithema_humile|14353     ---------------------------------------GAGGGTGTAATGACGACG---
Apis_mellifera|33521         ---------------------------------------AGTCCCCGCATGCCGCCT---

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_persimilis|5519   TACCTGGACAACATGAGCGAGAACTCGGAG------------------------------
Drosophila_grimshawi|9243    TATTTGGATAACATGAGCGAGAATTCGGAG------------------------------
Drosophila_willistoni|1556   TATTTGGATAACATGAGTGAGAATTCGGAG------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             CGCCCTGATGACATCTCAGAAGGCTCG---------------------------------
Tribolium_castaneum|11102    ATGGGCGACAACGCCAGC------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ------------------------------------------------------CGAATT
Drosophila_persimilis|5519   ------------------------------------------------------CAACCG
Drosophila_grimshawi|9243    ------------------------------------------------------CAACCG
Drosophila_willistoni|1556   ------------------------------------------------------CAACCG
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------GAACCT
Tribolium_castaneum|11102    ------------------------------------------------------GACTCC
Pogonomyrmex_barbatus|5033   ------------------------------------------------------CCGGAG
Linepithema_humile|14353     ------------------------------------------------------CAAGAA
Apis_mellifera|33521         ---------------------------------------------------------CCG

Pediculus_humanus|706        ------------------AGGCCAAAATCCAGGCCAGATCATTCG---------------
Bombyx_mori|6491             CCACGACCG------------------ATCAGAACAGAACCCGCC---------------
                                                        :  .     **     .                

Ixodes_scapularis|8629       ------------------------------------------------------------
Drosophila_persimilis|5519   ---------------------------------------------------AGTGCGGCG
Drosophila_grimshawi|9243    ---------------------------------------------------AGTGCTGCT
Drosophila_willistoni|1556   ---------------------------------------------------AGCTCCGCC
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ---CAGCGGAAGGCGCTCATGGGCACC---------------------TTCTTTGCCAAC
                                   .. :*  . .:  *    :                       ** *:    ** 

                             ** ** ** *:     * **  * .*. *    :: .  ** ** .* **  *    :  

                              * **     *  : **  .  * :     ..  *  *  * .   . ** *  .*  : 

                             .* **    .* ** ** .* .. .:.      ** ** **  * **.** **    :  

Drosophila_willistoni|1556   TATGTCGTCTCCTCATTTAAGGCATTTAAGGGT---------------------------
Pediculus_humanus|706        TATGTCGTGTCCAGTTATAAAACGTTTAAGACTTTTCCC---------------------
Culex_quinquefasciatus|12274 TACGTAGCGTCCTCGTTCAAAGTCTTCAAG------------------------------
Tribolium_castaneum|11102    TATGTTGTGTCGTCGTATAAGACGTTCAAG------------------------------
Pogonomyrmex_barbatus|5033   TACGTAGTGTCTAGCTATAAGACATTTAAG------------------------------
Linepithema_humile|14353     TACGTAGTGTCCAGCTACAAGACTTTCAAA------------------------------
Apis_mellifera|33521         TACGTCGTATCCAGCTACAAAACGTTCAAG------------------------------
                             ** ** *  **    *  *...  ** *..                              

Drosophila_persimilis|5519   ------------GCCCCAACTCCGGCTCCGGCTCCG------------------------
Drosophila_grimshawi|9243    ACGCTGGCGGTAGCTGCGTGCCACATGGGCGCACAA------------------------
Drosophila_willistoni|1556   ------------GCCGGGTGTAAAAAGGAGAGCAAG------------------------
Pediculus_humanus|706        ------------TTTCCCTTACCCTCCCCCCCAAAA------------------------
Bombyx_mori|6491             ------------GTAGTGCTACGACGCTACGCAATT------------------------
Culex_quinquefasciatus|12274 ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Drosophila_persimilis|5519   ------------------------------------------------------------
Drosophila_grimshawi|9243    ------------------------------------------------------------
Drosophila_willistoni|1556   ------------------------------------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Culex_quinquefasciatus|12274 ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Culex_quinquefasciatus|12274 ---------------------GTAGGTACCCTCCAAAAA---------------------
Tribolium_castaneum|11102    ---------------------GTTTTAAAGACGCTCAAC---------------------
Pogonomyrmex_barbatus|5033   ---------------------ATTAAAACACTAGTTGGTAACAACCTTGATTCG------
Linepithema_humile|14353     ---------------------GTAAGTGATCTTTATCAA---------------------
Apis_mellifera|33521         ---------------------GTAACGCTGGTTTTCTATTTATATACAATGTACGCGATT

Drosophila_persimilis|5519   CCCCAAGTGGGAGTCAAG------------------------------------------
Drosophila_grimshawi|9243    CGGAGCACAAAGCAC---------------------------------------------
Drosophila_willistoni|1556   AACTTCCACTTCTCCGCCAACTTC------------------------------------
Pediculus_humanus|706        CCCGTGACA---------------------------------------------------
Bombyx_mori|6491             GAC---------------------------------------------------------
Culex_quinquefasciatus|12274 ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         AAAATCTTGAATAACGCGTTA---------------------------------------

Drosophila_persimilis|5519   ------------------------------------------------------------
Drosophila_grimshawi|9243    ------------------------------------------------------------
Drosophila_willistoni|1556   ------------------------------------------------------------
Pediculus_humanus|706        ------------------------------------------------------------
Bombyx_mori|6491             ------------------------------------------------------------
Culex_quinquefasciatus|12274 ------------------------------------------------------------
Tribolium_castaneum|11102    ------------------------------------------------------------
Pogonomyrmex_barbatus|5033   ------------------------------------------------------------
Linepithema_humile|14353     ------------------------------------------------------------
Apis_mellifera|33521         ------------------------------------------------------------

Ixodes_scapularis|8629       ACTACGCCTCGAGTTTATTAG
Drosophila_persimilis|5519   ------------------TAG
Drosophila_grimshawi|9243    ------------------TAA
Drosophila_willistoni|1556   ------------------TGA
Pediculus_humanus|706        ------------------TAA
Bombyx_mori|6491             ------------------TAG
Culex_quinquefasciatus|12274 ------------------TAA
Tribolium_castaneum|11102    ------------------TAA
Pogonomyrmex_barbatus|5033   ------------------TGA
Linepithema_humile|14353     ------------------TAA
Apis_mellifera|33521         ------------------TGA

multiple sequence alignment in CLUSTALW format

Ixodes_scapularis|8643      ------------------------------------------------------------
Drosophila_persimilis|14200 MNEENDDYLAHEAAAMADE-----------------------------------------
Drosophila_grimshawi|4527   MSNEENDYLD-GLGAVAGT-----------------------------------------
Drosophila_willistoni|537   MSNEENDYIG-GPGAA--------------------------------------------
Pediculus_humanus|697       ------------------------------------------------------------
Bombyx_mori|2784            ------------------------------------------------------------
Tribolium_castaneum|12163   ------------------------------------------------------------
Pogonomyrmex_barbatus|14282 ------------------------------------------------------------
Linepithema_humile|6590     ------------------------------------------------------------
Apis_mellifera|7290         ------------------------------------------------------------

Ixodes_scapularis|8643      ------------------------------------------------------------
Drosophila_persimilis|14200 ------------------------------------------------------------
Drosophila_grimshawi|4527   ------------------------------------------------------------
Drosophila_willistoni|537   ------------------------------------------------------------
Pediculus_humanus|697       ------------------------------------------------------------
Bombyx_mori|2784            ------------------------------------------------------------
Tribolium_castaneum|12163   ------------------------------------------------------------
Pogonomyrmex_barbatus|14282 ------------------------------------------------------------
Linepithema_humile|6590     ------------------------------------------------------------
Apis_mellifera|7290         ------------------------------------------------------------

Ixodes_scapularis|8643      -------------------------MEANGTG----------------------------
Drosophila_grimshawi|4527   ----------TTAAGNGNGNGNGV-GDGDDDG-------GL--AAVNSEPILGGQTMAQI
Drosophila_willistoni|537   ----------------DDDNGAGV-DLDEDRG-------SVAAAAASHEPMLVGQTMPQI
Pediculus_humanus|697       --------------------MSLSTIEGSSVG----------------------------
Bombyx_mori|2784            -------------------------MSRRVHR-------------------------PRI
Tribolium_castaneum|12163   -------------------------MQQYEDG----------VNDEEHATADGAMAAPGV
Pogonomyrmex_barbatus|14282 ----------MRKYGCDQLKRIPVPFRSDTMR-------------------KEEQETSRT
Linepithema_humile|6590     ----------MIETENQLGSHTDKVEQNEEKE---------------------TTAVGDH
Apis_mellifera|7290         -------------------------MAGF-------------------------------

Ixodes_scapularis|8643      ------------------------------------------------------------
Drosophila_grimshawi|4527   SSNSQVEGNVSP--------TGHLDDND-NQINHNNTASNSHNFDSNRN-----------
Drosophila_willistoni|537   SSNAQLEGNVTP-------KTTQFDDNQINNNASNKLLHQSNNNDSNRS-----------
Pediculus_humanus|697       ----------------------TFSDFDVLSV----------------------------
Bombyx_mori|2784            QARLRPQAAPEPAP----------------------------------------------
Tribolium_castaneum|12163   GGGEDVA-----------PATPRHDKPANSLSAPLALVGNGAHHES--------------
Apis_mellifera|7290         ------------------------------------------------------------

Ixodes_scapularis|8643      ------------------------------------------------------------
Drosophila_willistoni|537   --------SPTKSPTR---NISSSFQI------NYDDEE------DLTED-KPALAAGIG
Pediculus_humanus|697       ---------------------------------------------------VTEFVSSRP
Bombyx_mori|2784            ---------------------------------------------------PPEPPQPEP
Tribolium_castaneum|12163   ---------------------------------------------------DDDDAEDDP
Pogonomyrmex_barbatus|14282 --------------------------------------------EGEIAVEGGMSTQEEV
Linepithema_humile|6590     --------------------------------------ISAIPVDDIEDEEDEEEEEENV
Apis_mellifera|7290         ------------------------------------------------------------

Ixodes_scapularis|8643      ------------------------------------------------------------
Drosophila_persimilis|14200 SGPGVGVGNRHVPGT-DY----------------------WQPR----------------
Drosophila_grimshawi|4527   AAVGGGIGRASGGGIPDY----------------------WQQR----------------
Drosophila_willistoni|537   PAPEAG-ATAGRGGVPDY----------------------WQQR----------------
Pediculus_humanus|697       ASPGGGMNDGGSE-----------------------------------------------
Bombyx_mori|2784            DHPPSEEEREPGD---------------------------WRAS----------------
Tribolium_castaneum|12163   PNPVNGGY--------------------------------WR------------------
Pogonomyrmex_barbatus|14282 GGVLAGSEGGGGGGMAGY----------------------WRQS----------------
Linepithema_humile|6590     EGEEEEEERDEKGGIAV-------------------------------------------
Apis_mellifera|7290         ----------------------------------------WRQS----------------

Ixodes_scapularis|8643      --------------------------------KA-------------------AAAVAP-
Drosophila_persimilis|14200 --------------------------------NGG-GSVHGGGVQSGIQSGHQSRALSPS
Drosophila_grimshawi|4527   --------------------------------NGAAGSISGG---AGAQSGHQSRALSPS
Drosophila_willistoni|537   --------------------------------NGGAGS---------------SCAISPG
Pediculus_humanus|697       -----------------------------------------------------SSSMPP-
Bombyx_mori|2784            -----------------------------------------------------RPSSPPQ
Tribolium_castaneum|12163   --------------------------------QGA------------------SRAASPA
Pogonomyrmex_barbatus|14282 --------------------------------RPS------------------SPRMPP-
Linepithema_humile|6590     -----------------------------------------------------EGVMTT-
Apis_mellifera|7290         --------------------------------RPS------------------SPRMPP-

Ixodes_scapularis|8643      --------------------------------------RIRKVNSTHSRFLAEAA-----
Drosophila_persimilis|14200 YLDNMSENSE----------------------------QPPVVPLVRSKSRPEIS-----
Drosophila_grimshawi|4527   YLDNMSENSE----------------------------QPPVVPLTRSKSRPEIS-----
Drosophila_willistoni|537   YLDNMSENSE----------------------------QPPVVPLVRSKSRPEIS-----
Pediculus_humanus|697       ----------------------------------------------RPKSRPDHS-----
Bombyx_mori|2784            RPDDISEGS-----------------------------EPPRP------IRTEPA-----
Tribolium_castaneum|12163   MGDNAS--------------------------------DSSMIPPARPKSRVEMT-----
Pogonomyrmex_barbatus|14282 --------------------------------------PEQSEQPSRPKSRHELQ-----
Linepithema_humile|6590     --------------------------------------QEESEQSSRPKSRHEPQ-----
Apis_mellifera|7290         ---------------------------------------PEQPELTRPKSRHEPA-----

Ixodes_scapularis|8643      ---------------------QRKALMGT-------FFANGDPFSSGIKVSIIPGRDFKT
Drosophila_persimilis|14200 -----------------SAAASRYSNLSYWKARRVVFYRNGDPFFPGVELRYRPGRDVTS
Drosophila_grimshawi|4527   -----------------SAAASRYSNLSYWKARRVVFYRNGDPFFPGVELRYRPGRDVTS
Drosophila_willistoni|537   -----------------SSAASRYSNLSYWKARRVVFYRNGDPFFPGVELRYRPGRDVTS
Pediculus_humanus|697       ---------------------AKYNNLSYWRAKKLVFYKNGDPFFPGLEFRFKPGRDVGS
Bombyx_mori|2784            ---------------------SRYANLNYWKARRVTFYRNGDPFHPGVEFRFKPGRDLAS
Tribolium_castaneum|12163   --------------------TSRYNNLSYWKARRVLFYKNGDPFFPGIEFRFKPGRDIVS
Pogonomyrmex_barbatus|14282 --------------------AARYNNLGYWRARRVTFYKNGDPYFPGVEFRFKPGRDIGS
Linepithema_humile|6590     --------------------GARYNNLGYWRARRVTFYKNGDPYFPGIEFRFKPGRDIGS
Apis_mellifera|7290         --------------------PARYNNLGYWRARRVTFYKNGDPYFPGIEFRFKPGRDIGS
                                                  :   :.        *: ****: .*::.   ****. :

                            :: : * :* ::::. *.* :* :**.:   *::****  **.*. :.*.          

Drosophila_persimilis|14200 ----APTPAPAP--------------------------------ATTLMLVAKWQDQQPL
Drosophila_grimshawi|4527   TLAVAACHMGAQ--------------------------------KATMNNTRAWSLEHGA
Drosophila_willistoni|537   ----AGCKKESK--------------------------------KMEMKERKERTNEKTR
Pediculus_humanus|697       ----FPLPSPPK-------------------------------KKKKVDFFFNYFFFWGS
Bombyx_mori|2784            ----VVLRRYAI--------------------------------ATFVARLHYMDQEYRL
Culex_quinquefasciatus|7822 -----------------------------------------------VGTLQK-------
Tribolium_castaneum|12163   -----------------------------------------------VLKTLN-------
Pogonomyrmex_barbatus|14282 -----------------------------------------------IKTLVGNNLDS--
Linepithema_humile|6590     -----------------------------------------------VSDLYQ-------
Apis_mellifera|7290         -----------------------------------------------VTLVFYLYTMYAI

Drosophila_persimilis|14200 PQVGVK----------------------------------------
Drosophila_grimshawi|4527   RSTKH-----------------------------------------
Drosophila_willistoni|537   NFHFSANF--------------------------------------
Pediculus_humanus|697       PVT-------------------------------------------
Bombyx_mori|2784            D---------------------------------------------
Culex_quinquefasciatus|7822 ----------------------------------------------
Tribolium_castaneum|12163   ----------------------------------------------
Pogonomyrmex_barbatus|14282 ----------------------------------------------
Linepithema_humile|6590     ----------------------------------------------
Apis_mellifera|7290         KILNNAL---------------------------------------